Overview

Comprehensive Description

Lutjanus cyanopterus :

MZUSP 65931 (1, 131), Lagoa de Mundaú ( 9°37’S , 35°48’W ), Maceió , State of Alagoas , Brazil .

  • Rodrigo L. Moura, Kenyon C. Lindeman (2007): A new species of snapper (Perciformes: Lutjanidae) from Brazil, with comments on the distribution of Lutjanus griseus and L. apodus. Zootaxa 1422, 31-43: 32-32, URL:http://www.zoobank.org/urn:lsid:zoobank.org:pub:EDE9214C-AABF-4706-AA56-C303C37A6B3C
Public Domain

MagnoliaPress via Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description: Body wide and relatively thick with a sloping forehead and a large round eye and large terminal mouth. Dorsal-fin base long and anal-fin base short. Prominent stout dorsal, anal, and pelvic-fin spines and a large non-serrated preopercular spine.

Creative Commons Attribution 3.0 (CC BY 3.0)

© www.coralreeffish.com by Benjamin Victor

Source: CORALREEFFISH.COM

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Adults found mainly around ledges over rocky bottoms or around reefs. Young sometimes inhabit mangrove areas. Feeds mainly on fishes, shrimps and crabs (Ref. 55). A wary fish, not easily approached underwater (Ref. 13442).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Western Atlantic: Nova Scotia and Bermuda to mouths of the Amazon, Brazil. Throughout Bahamas, Caribbean, including Antilles
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic: Nova Scotia and Bermuda (Anderson, pers. comm.) to mouths of the Amazon, Brazil. Rare north of Florida and apparently rare in the Gulf of Mexico.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 10; Dorsal soft rays (total): 14; Analspines: 3; Analsoft rays: 7 - 8
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 1600 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

160 cm TL (male/unsexed; (Ref. 55)); max. published weight: 57.0 kg (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

An earlier version of the following description and some of the photographs have previously been published in Zootaxa (copyright reserved by Magnolia Press): Victor, B.C., Hanner, R., Shivji, M., Hyde, J. & Caldow, C. (2009) Identification of the larval and juvenile stages of the Cubera Snapper, Lutjanus cyanopterus, using DNA barcoding. Zootaxa, 2215, 24-36. Diagnosis: Modal fin-ray counts of D-X,14 A-III,8 are shared among most of the regional Lutjanus, including L. analis, L. apodus, L. cyanopterus, L. griseus, L. jocu and the deep-water snappers L. buccanella, L. campechanus, and L. vivanus. Juvenile L. cyanopterus have an indistinct barred pattern without a lateral spot. Adult Cubera snappers are the largest Western Atlantic snappers and can reach four feet in length and weigh up to 125 pounds. (DNA)

Creative Commons Attribution 3.0 (CC BY 3.0)

© www.coralreeffish.com by Benjamin Victor

Source: CORALREEFFISH.COM

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Mouth with thick lips. Preopercular notch and knob weak. Scale rows on back rising obliquely above lateral line. Back and sides pale to dark gray with a reddish tinge. The dorsal and caudal fins are grayish; the anal and pelvic fins reddish; the pectoral fins translucent or grayish.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

MZUSP 65931 (1, 131), Lagoa de Mundaú ( 9°37’S , 35°48’W ), Maceió , State of Alagoas , Brazil .

License not applicable

Rodrigo L. Moura

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Look Alikes

Pretransitional mostly-unmarked stage, usually from 15-18 mm SL: Body: A thin line of melanophores develops on each side just below the base of the spinous dorsal fin, from the third to sixth and then from the eighth to tenth spines (leaving an unpigmented dorsal midline along the base of the fin). Continuing along the base of the soft dorsal fin, the melanophore row widens to cover the outer pterygiophore segments, intensifying beneath the fourth to eighth and the last two rays and then extending along the dorsal midline of the caudal peduncle, ending at the start of the procurrent caudal-fin rays. Early transitional larvae begin to develop short melanophore streaks lining some of the myomere edges along the mid-upper body. A central patch of surface melanophores develops on the end of the caudal peduncle, then filling in progressively from ventral to dorsal. There are a few deep melanophores at the end of the lateral midline of the caudal peduncle. Along the ventral midline of the caudal peduncle there is a line of melanophores starting just after the melanophore underlying the base of the last anal-fin rays and extending up to the procurrent caudal-fin rays. Head: Melanophores on the head consist of a dense patch overlying the brain and on the surface braincase with a scattering developing between the braincase and the first dorsal-fin spine. A patch of small melanophores develops at the tip of the upper jaw and then extends upward along the snout. The lower jaw is mostly unmarked, with only a few small melanophores near the tip. The opercular area is covered in iridescence extending down to the pelvic-fin insertion. The inner cleithral surface of the gill cavity is speckled with large melanophores and there are internal melanophores lining the dorsal aspect of the peritoneum extending down to the vent and overlain by a silvery camouflage layer. Fin Spines: The dorsal and anal-fin spines are relatively slender, without prominent internal reticulations or serrations. The second dorsal-fin spine is the longest, with the spines becoming progressively and evenly shorter such that the profile of the spinous tips forms a straight downward-sloping line. Fins: Melanophores on the dorsal-fin membranes are present along the full length of the membrane just behind the second dorsal-fin spine and then densely on the outer third of all of the subsequent spinous-dorsal-fin membranes. The soft dorsal fin is unmarked. There are a few melanophores between the bases of the lower central caudal-fin segmented rays. The anal fin is unmarked. The pelvic fins have dense melanophores along the outer third of the fin membranes of the longest two or three rays. Pretransitional analogues: Pretransitional larvae (mostly-unmarked, usually from 15-18 mm SL) have relatively slender and smooth dorsal and anal-fin spines, without the prominent internal reticulations and anterior serrations found in L. griseus, L. apodus, and L. jocu. In addition, amongst the regional Lutjanus only L. cyanopterus and L. analis have a mostly unmarked anal fin, with no melanophores on the membranes or even at teh base of most of the anal-fin elements before transition. Pretransitional L. cyanopterus share the relatively slender and smooth dorsal-fin spines and snout melanophores with L. analis, but have a distinctly-wider caudal peduncle and melanophores on the outer third of the longest pelvic-fin membranes (vs. full-length or none). On larval L. cyanopterus the dorsal-fin spines (after the first) are evenly and progressively shorter, unlike some other species. The anterior snout and upper jaw are speckled with melanophores with only a few on the lower jaw (vs. roughly similar on the upper and lower jaw and/or not on the snout as well in other species). L. cyanopterus larvae have a wider caudal peduncle than other regional Lutjanus species (body depth after last dorsal ray goes fewer than 2.5 times into body depth at first dorsal-fin spine).

Juveniles: Juvenile L. cyanopterus have few distinguishing markings, primarily indistinct vertical bars and a dark outer portion of the spinous dorsal fin with abruptly-light edging. The black markings on the outer third of the pelvic-fin membranes shown by larvae can also persist well into the juvenile stage. Dark variants develop a black cap across the eyeball, uniformly-darkened pelvic-fin membranes, and intensified dark bars on the body and black edging to the spinous dorsal fin. Even in the juvenile stage, Cubera snappers have markedly-enlarged canine teeth. The body shape of juveniles and adults differs from other regional snappers in being longer and narrower; the body depth (predorsal) of L. cyanopterus juveniles goes at least 2.8 times into SL (vs. 2.4 or fewer). Juvenile analogues: Juvenile L. cyanopterus have no lateral spot (vs. L. analis, L. mahogoni, L. synagris, and the deep-water snappers) and lack the prominent eye stripes or blue lines across the cheek characteristic of L. apodus, L. jocu and L. griseus. In addition, the other regional Lutjanus have distinctly wider bodies as both juveniles and adults: the predorsal body depth of L. cyanopterus juveniles goes at least 2.8 times into SL (vs. 2.4 or fewer).

Creative Commons Attribution 3.0 (CC BY 3.0)

© www.coralreeffish.com by Benjamin Victor

Source: CORALREEFFISH.COM

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Adults found mainly around ledges over rocky bottoms or around reefs. Young sometimes inhabit mangrove areas.
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

nektonic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; brackish; marine; depth range 18 - 55 m (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 54 specimens in 1 taxon.
Water temperature and chemistry ranges based on 38 samples.

Environmental ranges
  Depth range (m): 0.3 - 37.5
  Temperature range (°C): 26.618 - 28.035
  Nitrate (umol/L): 0.269 - 3.153
  Salinity (PPS): 34.217 - 36.487
  Oxygen (ml/l): 4.352 - 4.686
  Phosphate (umol/l): 0.055 - 0.211
  Silicate (umol/l): 1.180 - 5.080

Graphical representation

Depth range (m): 0.3 - 37.5

Temperature range (°C): 26.618 - 28.035

Nitrate (umol/L): 0.269 - 3.153

Salinity (PPS): 34.217 - 36.487

Oxygen (ml/l): 4.352 - 4.686

Phosphate (umol/l): 0.055 - 0.211

Silicate (umol/l): 1.180 - 5.080
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 18 - 55m.
From 18 to 55 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Adults found mainly around ledges over rocky bottoms or around reefs. Young sometimes inhabit mangrove areas. Feeds mainly on fishes, shrimps and crabs (Ref. 55). A wary fish, not easily approached underwater (Ref. 13442). Carnivore (Ref. 42771, 57616).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Diet

Feeds mainly on fishes, shrimps and crabs
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Lutjanus cyanopterus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATCTAGTATTCGGTGCCTGAGCCGGTATAGTAGGCACGGCCCTGAGCCTGCTCATTCGAGCAGAACTAAGCCAACCAGGAGCTCTTCTTGGAGATGACCAAATTTATAATGTAATTGTTACAGCACATGCATTTGTAATAATTTTCTTTATAGTAATGCCAATCATGATCGGAGGGTTTGGAAACTGACTGATCCCCTTAATAATCGGAGCCCCGGATATAGCATTCCCCCGAATGAATAACATGAGCTTTTGACTCCTCCCTCCATCATTCCTTCTACTTCTAGCCTCCTCAGGCGTAGAAGCTGGTGCTGGAACTGGATGAACAGTCTACCCCCCTCTCGCAGGTAATCTGGCACACGCAGGGGCATCTGTTGACTTAACTATCTTCTCCCTCCACCTAGCGGGTGTATCTTCAATTCTGGGGGCAATCAACTTCATTACAACAATTATTAACATAAAACCCCCTGCCATCTCCCAATATCAAACACCACTATTCGTTTGAGCTGTTCTGATCACGGCTGTCCTACTCCTTCTTTCCCTTCCAGTACTAGCGGCCGGAATCACAATGCTTCTTACAGACCGAAATCTAAATACCACCTTCTTCGACCCAGCAGGAGGAGGAGACCCAATCCTCTACCAACATCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lutjanus cyanopterus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A2d

Version
2.3

Year Assessed
1996
  • Needs updating

Assessor/s
Huntsman, G.

Reviewer/s

Contributor/s
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Vulnerable (VU) (A2d)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; gamefish: yes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Cubera snapper

The Cubera snapper, Lutjanus cyanopterus, is a species of snapper native to the western Atlantic Ocean from Nova Scotia to the Amazon River in Brazil, though it is rare north of Florida. It can also be found in the Caribbean Sea and, rarely, in the Gulf of Mexico. It inhabits areas associated with reefs, preferring areas with rocky substrates. It can be found at depths from 18 to 55 metres (59 to 180 ft). This species can reach a length of 160 cm (63 in), though most do not exceed 90 cm (35 in). The greatest recorded weight for a specimen of this species is 57 kg (126 lb). It is commercially important and is also sought-after as a game fish, though it has been reported to cause ciguatera poisoning.[2]

References[edit]

  1. ^ Huntsman, G. 1996. Lutjanus cyanopterus. In: IUCN 2013. IUCN Red List of Threatened Species. Version 2013.2. <www.iucnredlist.org>. Downloaded on 13 January 2014.
  2. ^ Froese, Rainer and Pauly, Daniel, eds. (2013). "Lutjanus cyanopterus" in FishBase. December 2013 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!