Overview

Comprehensive Description

Biology

Does not undertake a diurnal, vertical migration. Feeds heavily on crustaceans (Ref. 4525). Oviparous, with planktonic eggs and larvae (Ref. 35604).
  • Masuda, H., K. Amaoka, C. Araga, T. Uyeno and T. Yoshino 1984 The fishes of the Japanese Archipelago. Vol. 1. Tokai University Press, Tokyo, Japan. 437 p. (text). (Ref. 559)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North Pacific: off the Pacific coast of northern Japan and the Bering Sea to the Gulf of Alaska southward to northern Baja California, Mexico.
  • Masuda, H., K. Amaoka, C. Araga, T. Uyeno and T. Yoshino 1984 The fishes of the Japanese Archipelago. Vol. 1. Tokai University Press, Tokyo, Japan. 437 p. (text). (Ref. 559)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 8 - 13; Analspines: 0; Analsoft rays: 15 - 25; Vertebrae: 44 - 51
  • Masuda, H., K. Amaoka, C. Araga, T. Uyeno and T. Yoshino 1984 The fishes of the Japanese Archipelago. Vol. 1. Tokai University Press, Tokyo, Japan. 437 p. (text). (Ref. 559)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 250 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

25.0 cm SL (male/unsexed; (Ref. 4525))
  • Fitch, J.E. and R.J. Lavenberg 1968 Deep-water teleostean fishes of California. California Natural History Guides:25. University of California Press, Berkeley and Los Angeles, California. 115 p. (Ref. 4525)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Body slender and compressed. Anal fin base long and about twice the length of dorsal fin base. Eye diameter about twice snout length. Upper end of gill slit reaching above midline of side of body. No knob-like process in interorbital space. Dorsoposterior edge of operculum not curved inward. Traces of detached scales black. Color black or dark brown; bluish black on head and ventral surfaces, and on peritoneum (Ref. 6885).
  • Masuda, H., K. Amaoka, C. Araga, T. Uyeno and T. Yoshino 1984 The fishes of the Japanese Archipelago. Vol. 1. Tokai University Press, Tokyo, Japan. 437 p. (text). (Ref. 559)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Paratype for Bathylagus borealis
Catalog Number: USNM 48681
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1890
Locality: Bering Sea; 284 Fms., Alaska, United States, Aleutian Islands, Bering Sea, Pacific
Depth (m): 519 to 519
Vessel: Albatross
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known from seamounts and knolls
  • Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

bathypelagic; marine; depth range 0 - 7700 m (Ref. 50610), usually 600 - 800 m (Ref. 28981)
  • Russian Academy of Sciences 2000 Catalog of vertebrates of Kamchatka and adjacent waters. 166 p. (Ref. 50610)
  • Shinohara, G., K. Yabe, M. Nakaya, G. Anma, S. Yamaguchi and K. Amaoka 1994 Deep-sea fishes collected from the North Pacific by the T/S Oshoro-Maru. Bull. Fac. Fish. Hokkaido Univ. 45 (2):48-80. (Ref. 28981)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.

Environmental ranges
  Depth range (m): 519 - 519
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 25 specimens in 1 taxon.
Water temperature and chemistry ranges based on 21 samples.

Environmental ranges
  Depth range (m): 133 - 50000
  Temperature range (°C): 1.710 - 11.212
  Nitrate (umol/L): 25.896 - 46.349
  Salinity (PPS): 33.037 - 34.629
  Oxygen (ml/l): 0.282 - 6.334
  Phosphate (umol/l): 2.102 - 3.291
  Silicate (umol/l): 34.474 - 175.223

Graphical representation

Depth range (m): 133 - 50000

Temperature range (°C): 1.710 - 11.212

Nitrate (umol/L): 25.896 - 46.349

Salinity (PPS): 33.037 - 34.629

Oxygen (ml/l): 0.282 - 6.334

Phosphate (umol/l): 2.102 - 3.291

Silicate (umol/l): 34.474 - 175.223
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 230 - 7700m.
From 230 to 7700 meters.

Habitat: bathypelagic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous (Ref. 35604).
  • Moser, H.G. and E.H. Ahlstrom 1996 Bathylagidae: blacksmelts and smoothtounges. p. 188-207. In H.G. Moser (ed.) The early stages of fishes in the California Current Region. California Cooperative Oceanic Fisheries Investigations (CalCOFI) Atlas No. 33. 1505 p. (Ref. 35604)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Bathylagus pacificus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTACCTCATCTTTGGTGCCTGAGCTGGAATAGTCGGCACGGCCTTAAGCCTCTTAATCCGAGCCGAACTTAGCCAGCCGGGAGCCCTCTTAGGGGACGACCAGATCTACAACGTTATTGTAACAGCACATGCTTTTGTTATAATCTTTTTTATAGTAATGCCAATCATAATCGGCGGCTTTGGAAACTGACTGATCCCGCTTATGATCGGAGCCCCTGATATGGCCTTCCCTCGCATAAATAATATGAGCTTCTGGCTCCTTCCCCCTTCATTCCTTCTCCTCCTGGCCTCTTCTGGTGTTGAAGCCGGAGCAGGCACAGGATGAACAGTATATCCCCCTCTAGCAGGTAATCTTGCTCATGCAGGAGCTTCCGTAGACCTGACTATTTTCTCCCTTCACCTCGCTGGGATTTCTTCAATTCTGGGGGCAATCAACTTCATCACAACTATTATTAACATGAAACCCCCAGCTATCTCCCAGTACCAAACACCCCTCTTTATTTGAGCTGTCCTAATCACAGCTGTTCTTCTCCTCCTCTCCCTTCCTGTTCTGGCCGCAGGAATCACCATACTACTTACAGACCGAAACCTGAATACTACCTTCTTCGACCCTGCTGGAGGAGGAGACCCCATTCTTTACCAGCACCTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Bathylagus pacificus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!