Overview

Comprehensive Description

Biology

Adults are found frequently in lakes, ponds, reservoirs and sluggish streams (Ref. 5723, 10294); occur primarily in reservoirs in Hawaii; preferably live in deep weed beds (Ref. 5723). Active mainly during dusk and dawn. They feed upon snails, small crayfish, insects, worms and small minnows (Ref. 5723). Young feed on crustaceans, insects and worms (Ref. 5723, 10294).
  • Page, L.M. and B.M. Burr 1991 A field guide to freshwater fishes of North America north of Mexico. Houghton Mifflin Company, Boston. 432 p. (Ref. 5723)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

This species is native to lakes and streams in the St. Lawrence, Great Lakes, and Mississippi River systems.

Thus, it ranges from Quebec to northern Mexico. However, it has been introduced widely in places such as Hawaii, Africa, Asia, South America, and Europe.

Biogeographic Regions: nearctic (Native ); palearctic (Introduced ); oriental (Introduced ); ethiopian (Introduced ); neotropical (Introduced ); oceanic islands (Introduced )

  • Murdy, E., R. Baker, J. Musick. 1997. Fishes of Chesapeake Bay. Washington, D.C.: Smithsonian Institution Press.
  • Froese, R., D. Pauly, eds.. 2002. "FishBase: Lepomis macrochirus" (On-line). Accessed 26 March 2002 at http://www.fishbase.org.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

This species is native to the St. Lawrence-Great Lakes and Mississippi River basins from Quebec and New York to Minnesota and south to the Gulf of Mexico; also Atlantic and Gulf Slope drainages from the Cape Fear River, Virginia, to the Rio Grande, Texas and New Mexico; also northern Mexico (Page and Burr 1991). It has been introduced throughout North America and in many other parts of the world.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: This species is native to the St. Lawrence-Great Lakes and Mississippi River basins from Quebec and New York to Minnesota and south to the Gulf of Mexico; also Atlantic and Gulf Slope drainages from the Cape Fear River, Virginia, to the Rio Grande, Texas and New Mexico; also northern Mexico (Page and Burr 1991). It has been introduced throughout North America and in many other parts of the world.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

This species is native to lakes and streams in the St. Lawrence, Great Lakes, and Mississippi River systems. Thus, it ranges from Quebec to northern Mexico. However, it has been introduced widely in places such as Hawaii, Africa, Asia, South America, and Europe.

Biogeographic Regions: nearctic (Native ); palearctic (Introduced ); oriental (Introduced ); ethiopian (Introduced ); neotropical (Introduced ); oceanic islands (Introduced )

  • Murdy, E., R. Baker, J. Musick. 1997. Fishes of Chesapeake Bay. Washington, D.C.: Smithsonian Institution Press.
  • Froese, R., D. Pauly, eds.. 2002. "FishBase: Lepomis macrochirus" (On-line). Accessed 26 March 2002 at http://www.fishbase.org.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America: St. Lawrence - Great Lakes and Mississippi river basin; from Quebec to northern Mexico. Widely introduced. Several countries report adverse ecological impact after introduction.
  • Page, L.M. and B.M. Burr 1991 A field guide to freshwater fishes of North America north of Mexico. Houghton Mifflin Company, Boston. 432 p. (Ref. 5723)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern and central North America, introduced elsewhere.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Like other sunfish, bluegill have very deep and highly compressed bodies. In other words, they are "tall" and "flat." They have a small mouth on a short head. The dorsal fin is continuous, with the front part spiny and the back part soft and round with a dark smudge at the base. The tail fin is slightly forked but rounded. The body is mainly olive green with yellowish underneath. Their name "bluegill" comes from the iridescent blue and purple region on the cheek and gill cover (opercle). A close look reveals six to eight olive-colored vertical bars on the sides.

Typically, adults are between 10 and 15 cm but they can grow as large as 41 cm.

Young bluegill are a paler version of the adults, usually silver with a slight purple sheen.

Range mass: 2.2 (high) kg.

Range length: 41.0 (high) cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Like other sunfish, bluegill have very deep and highly compressed bodies. In other words, they are "tall" and "flat." They have a small mouth on a short head. The dorsal fin is continuous, with the front part spiny and the back part soft and round with a dark smudge at the base. The tail fin is slightly forked but rounded. The body is mainly olive green with yellowish underneath. Their name "bluegill" comes from the iridescent blue and purple region on the cheek and gill cover (opercle). A close look reveals six to eight olive-colored vertical bars on the sides.

Typically, adults are between 10 and 15 cm but they can grow as large as 41 cm.

Young bluegill are a paler version of the adults, usually silver with a slight purple sheen.

Range mass: 2.2 (high) kg.

Range length: 41.0 (high) cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 41 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum size: 410 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

41.0 cm TL (male/unsexed; (Ref. 5723)); max. published weight: 2,150 g (Ref. 4699); max. reported age: 10 years (Ref. 72462)
  • International Game Fish Association 1991 World record game fishes. International Game Fish Association, Florida, USA. (Ref. 4699)
  • Altman, P.L. and D.S. Dittmer 1962 Growth, including reproduction and morphological development. Federation of American Societies for Experimental Biology. (Ref. 72462)
  • Page, L.M. and B.M. Burr 1991 A field guide to freshwater fishes of North America north of Mexico. Houghton Mifflin Company, Boston. 432 p. (Ref. 5723)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

A dark blue or black "ear" on an extension of the gill cover called the opercular flap; a prominent dark blotch at the base of the dorsal fin, close to the tail; typically olive-green backs, with a blue or purplish sheen along the sides; faint vertical bars may be present along the sides; breeding males may have more blue and orange coloration on their flanks (Ref. 44091).
  • Yamamoto, M.N. and A.W. Tagawa 2000 Hawai'i's native and exotic freshwater animals. Mutual Publishing, Honolulu, Hawaii. 200 p. (Ref. 44091)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Syntype for Lepomis macrochirus
Catalog Number: USNM 438
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Dry Osteological Specimen
Collector(s): J. Clark
Year Collected: 1851
Locality: Rio Cibolo, Texas., Texas, United States, North America
  • Syntype: Baird, S. F. & Girard, C. F. 1854. Proceedings of the Academy of Natural Sciences of Philadelphia. 7: 25.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Bluegill prefer to live in lakes and slow-moving, rocky streams. They can often be found in deep beds of weeds. In Hawaii they primarily inhabit reservoirs. Though they are freshwater fish, they can tolerate salinities up to 18% and are present in tributaries of the Chesapeake Bay.

Habitat Regions: temperate ; freshwater

Aquatic Biomes: lakes and ponds; rivers and streams

Wetlands: marsh

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Habitat includes warm shallow lakes, reservoirs, ponds, swamps, sloughs, and slow-flowing rivers and streams. Bluegill often are associated with rooted aquatic plants and with bottoms of silt, sand, or gravel. They seldom go much deeper than 16 feet (5 meters). Large individuals seek more open water than do smaller ones. Eggs are laid in nests made in shallow water by males, on bottoms of gravel, sand, or mud that contains pieces of debris.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat Type: Freshwater

Comments: Habitat includes warm shallow lakes, reservoirs, ponds, swamps, sloughs, and slow-flowing rivers and streams. Bluegill often are associated with rooted aquatic plants and with bottoms of silt, sand, or gravel. They seldom go much deeper than 16 feet (5 meters). Large individuals seek more open water than do smaller ones. Eggs are laid in nests made in shallow water by males, on bottoms of gravel, sand, or mud that contains pieces of debris.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Bluegill prefer to live in lakes and slow-moving, rocky streams. They can often be found in deep beds of weeds. In Hawaii they primarily inhabit reservoirs. Though they are freshwater fish, they can tolerate some saltiness and are present in tributaries of the Chesapeake Bay.

Habitat Regions: temperate ; freshwater

Aquatic Biomes: lakes and ponds; rivers and streams

Wetlands: marsh

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

benthopelagic; freshwater; pH range: 7.0 - 7.5; dH range: 10 - 15
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 24 specimens in 5 taxa.

Environmental ranges
  Depth range (m): 0.23 - 15

Graphical representation

Depth range (m): 0.23 - 15
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

The very small mouth of this fish is an adaptation to eating small animals. Bluegills are carnivores, primarily eating invertebrates such as snails, worms, shrimp, aquatic insects, small crayfish, and zooplankton. They can also consume small fish such as minnows and plant material such as algae. Young bluegill eat worms and zooplankton, staying under cover while adults feed more in the open.

Animal Foods: fish; insects; mollusks; aquatic or marine worms; aquatic crustaceans; zooplankton

Plant Foods: algae

Primary Diet: carnivore (Eats non-insect arthropods)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Found frequently in lakes, ponds, reservoirs and sluggish streams; occurs primarily in reservoirs in Hawaii; preferably lives in deep weed beds. Is active mainly during dusk and dawn. Adults feed upon snails, small crayfish, insects, worms and small minnows. Young feed on crustaceans, insects and worms.
  • Honebrink, R. 1990 Fishing in Hawaii: a student manual. Education Program, Division of Aquatic Resources, Honolulu, Hawaii. 79 p. (Ref. 4887)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Feeds opportunistically on aquatic insect larvae, planktonic crustaceans, flying insects, snails, and other small invertebrates; small fishes, fish eggs, crayfish, and algae sometimes are eaten. Larvae and juveniles often eat cladocerans and copepod nauplii. Adults eats mainly aquatic insects, crayfishes, and small fishes, or, in some bodies of water, mostly zooplankton. Feeds at all levels of water column.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

The very small mouth of this fish is an adaptation to eating small animals. Bluegills are carnivores, primarily eating invertebrates such as Gastropoda, Oligochaeta, Malacostraca, aquatic Insecta, small Malacostraca, and zooplankton. They can also consume small fish such as Pimephales notatus and plant material such as algae. Young bluegill eat Oligochaeta and zooplankton, staying under cover while adults feed more in the open.

Animal Foods: fish; insects; mollusks; aquatic or marine worms; aquatic crustaceans; zooplankton

Plant Foods: algae

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Bluegill are an important prey species for larger fish predators. They also impact insect populations by eating aquatic larvae.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Bluegill travel in schools and come into shallow water only at night. During the day they try to remain hidden.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

Bluegill are an important prey species for larger fish predators. They also impact insect populations by eating aquatic larvae.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Bluegill travel in schools and come into shallow water only at night. During the day they try to remain hidden.

Known Predators:

  • great blue herons (Ardea_herodias)
  • belted kingfishers (Cercyle_alcyon)
  • raccoons (Procyon_lotor)
  • brown trout (Salmo_trutta)
  • largemouth bass (Micropterus_salmoides)
  • striped bass (Morone_saxatilis)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Lepomis macrochirus is prey of:
Salmo trutta
Morone saxatilis
Micropterus salmoides
Ardea herodias
Ceryle alcyon
Procyon lotor

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Lepomis macrochirus preys on:
non-insect arthropods

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diseases and Parasites

Philometroides Infestation. Parasitic infestations (protozoa, worms, etc.)
  • Bunkley-Williams, L. and E.H. Williams Jr. 2002 Nematodes of freshwater fishes of the Neotropical region. (Book review). Caribb. J. Sci. 38(3-4):289-294. (Ref. 46699)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Epitheliocystis. Bacterial diseases
  • Lannan, C.N., J.L. Batholomew and J.L. Fryer 1999 Chlamydial infections of fish: Epitheliocystis. p.255-267. In P.T.K. Woo and D.W. Bruno (eds.) Fish Diseases and Disorders Vol. 3: Viral, bacterial and fungal infections. CABI Int'l. (Ref. 48851)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Populations of stunted individuals often occur in closed pond systems with no emigration pathway.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Males change color during breeding season so it seems likely that visual cues are important either to other males or to females. Grunting is involved in courtship.

Communication Channels: visual ; acoustic

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

Males change color during breeding season so it seems likely that visual cues are important either to other males or to females. Grunting is involved in courtship.

Communication Channels: visual ; acoustic

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Males guard the eggs for about 7 days (Ref. 93240).
  • Balon, E.K. 1990 Epigenesis of an epigeneticist: the development of some alternative concepts on the early ontogeny and evolution of fishes. Guelph Ichthyol. Rev. 1:1-48. (Ref. 7471)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Bluegill typically live 4 to 6 years but can reach 8 to 11 years old in captivity.

Range lifespan

Status: captivity:
8.0 to 11.0 years.

Typical lifespan

Status: wild:
4.0 to 6.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

Bluegill typically live 4 to 6 years but can reach 8 to 11 years old in captivity.

Range lifespan

Status: captivity:
8.0 to 11.0 years.

Typical lifespan

Status: wild:
4.0 to 6.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 10 years (wild) Observations: Unverified estimates suggest these animals may live up to 11 years (http://www.fishbase.org/).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Males make nests in colonies with from 20 to 50 other males in shallow water less than 1 m deep. The nests are circular shallow depressions, about 20 to 30cm in diameter, in sand or fine gravel from which the male has fanned all debris (Murdy et al., 1997).

Once his nest is made, a male waits in it and grunts to attract females. When one enters, both male and female swim in circles. Eventually they stop and touch bellies, the male in an upright posture and the female leaning at an angle. They release eggs and sperm and then start the process again by swimming in circles.

A female deposits her eggs into several nests, and a male's nest may be used by several females (Williams, 1996).

Mating System: polygynandrous (promiscuous)

Spawning occurs when water is between 17 and 31 degrees C; in the Chesapeake Bay area it can begin when water temperatures reach 12 degrees C. Females can carry up to 50,000 eggs which take several days to hatch. After a week, young leave the nest.

Breeding season: Breeding occurs from May to September (Chesapeake Bay).

Average number of offspring: 50000.0.

Average gestation period: 3.0 days.

Average : 7.0 days.

Average time to independence: 3 days.

Range age at sexual or reproductive maturity (female): 1.0 to 2.0 years.

Range age at sexual or reproductive maturity (male): 1.0 to 2.0 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); oviparous

Males guard nests both before and after females lay eggs. Paternal care involves fanning the eggs and chasing away predators.

Parental Investment: pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Protecting: Male)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Spawning occurs over an often extended period in spring and summer. Eggs hatch in about 2-3 days. Males guard the eggs and hatchlings. Spawners may be 1 year old, but usually are 2-3 years old. Bluegill often spawn in colonies that may include dozens of crowded craterlike or saucer-shaped nests.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Males make nests in colonies with from 20 to 50 other males in shallow water less than 1 m deep. The nests are circular shallow depressions, about 20 to 30cm in diameter, in sand or fine gravel from which the male has fanned all debris.

Once his nest is made, a male waits in it and grunts to attract females. When one enters, both male and female swim in circles. Eventually they stop and touch bellies, the male in an upright posture and the female leaning at an angle. They release eggs and sperm and then start the process again by swimming in circles.

A female deposits her eggs into several nests, and a male's nest may be used by several females.

Mating System: polygynandrous (promiscuous)

Spawning occurs when water is between 17 and 31 degrees C; in the Chesapeake Bay area it can begin when water temperatures reach 12 degrees C. Females can carry up to 50,000 eggs which take several days to hatch. After a week, young leave the nest.

Breeding season: Breeding occurs from May to September (Chesapeake Bay).

Average number of offspring: 50000.0.

Average time to hatching: 3.0 days.

Average : 7.0 days.

Average time to independence: 3 days.

Range age at sexual or reproductive maturity (female): 1.0 to 2.0 years.

Range age at sexual or reproductive maturity (male): 1.0 to 2.0 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); oviparous

Males guard nests both before and after females lay eggs. Paternal care involves fanning the eggs and chasing away predators.

Parental Investment: pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Protecting: Male)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Lepomis macrochirus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 22 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGGCAATCACACGTTGATTTTTCTCGACCAATCACAAAGACATCGGCACCCTTTATTTAGTATTCGGTGCATGAGCCGGTATAGTGGGTACGGCCCTAAGCCTACTCATTCGAGCAGAGCTCAGCCAACCAGGCGCTCTCCTGGGCGACGACCAAATTTATAACGTAATTGTGACAGCACATGCATTCGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGTGGCTTTGGCAACTGACTTGTCCCATTAATGATTGGAGCCCCCGATATAGCATTCCCCCGAATAAATAACATAAGCTTTTGACTTCTCCCCCCCTCTTTCCTTCTTCTTCTCGCCTCCTCCGGGGTTGAAGCCGGGGCTGGCACAGGATGAACCGTTTACCCCCCTCTCGCTGGTAACCTAGCCCATGCAGGAGCATCAGTCGACCTTACTATCTTCTCCCTGCATCTCGCAGGGGTCTCTTCAATCCTGGGAGCTATTAATTTTATTACCACAATTATTAACATGAAGCCCCCTGCTATTTCCCAGTACCAGACCCCTTTATTTGTCTGATCAGTCCTAATTACTGCCGTCTTACTCCTGCTTTCCCTTCCAGTCCTTGCTGCAGGCATCACAATACTACTTACAGACCGTAATCTAAACACCACTTTCTTTGACCCAGCGGGGGGCGGGGACCCAATCCTCTATCAGCACCTGTTCTGGTTTTTCGGTCACCCCGAAGTCTACATTCTTATTCTTCCAGGGTTTGGCATAATCTCCCACATCGTCGCCTACTATTCCGGGAAAAAAGAGCCCTTTGGCTATATAGGCATGGTTTGGGCCATGATAGCAATTGGCCTTCTAGGCTTCATTGTCTGAGCCCACCACATGTTTACTGTCGGCATGGACGTAGACACACGCGCCTACTTTACGTCCGCCACAATAATTATTGCCATCCCAACCGGCGTAAAAGTCTTTAGCTGGCTGGCAACACTTCACGGGGCCTCTATTAAATGAGAGACCCCTCTTCTATGAGCCCTTGGCTTTATTTTCCTCTTCACCGTGGGGGGACTGACAGGAATCGTCCTGGCCAACTCATCTCTGGACATTGTACTACATGACACATACTATGTAGTCGCACATTTCCATTATGTCTTATCAATGGGGGCTGTATTCGCAATTGTAGCTGCCTTCGTTCACTGATTCCCCCTGTTTTCAGGTTACACCCTACACACCACTTGAACGAAAATCCACTTCGGAATCATATTCATCGGGGTTAACCTCACCTTCTTCCCGCAGCATTTCTTAGGCCTGGCAGGAATACCTCGGCGATACTCAGACTACCCAGACGCCTACACTCTCTGAAACACAATTTCTTCTATTGGTTCATTAGTCTCCCTCGTAGCAGTAATTATGTTCTTATTTATTATCTGAGAAGCATTTGCCGCTAAACGCGAAGTCCTAGCTGTAGAACTAACCACAACTAATGTGGAGTGACTTCACGGCTGCCCCCCACCTTATCACACTTTCGAAGAGCCCGCATTTGTTCAAGTTCAGTCCAATTAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lepomis macrochirus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 23
Specimens with Barcodes: 51
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Bluegill are abundant in their native range. Many individuals are raised in aquaculture facilities and used to stock waterways.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
NatureServe

Reviewer/s
Smith, K. & Darwall, W.R.T.

Contributor/s

Justification
Listed as Least Concern in view of the large extent of occurrence, large number of subpopulations, large population size, and lack of major threats. Trend over the past 10 years or three generations is uncertain but likely relatively stable, or the species may be declining but not fast enough to qualify for any of the threatened categories under Criterion A (reduction in population size).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Bluegill are abundant in their native range. Many individuals are raised in aquaculture facilities and used to stock waterways.

IUCN Red List of Threatened Species: no special status

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is represented by a large number of subpopulations and locations.

Total adult population size is unknown but relatively large.

Has increased in abundance in the lower Missouri River as a result of human-caused changes in the river (e.g., reservoir construction) (Pflieger and Grace 1987).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Localized threats may exist, but on a range-wide scale no major threats are known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Localized threats may exist, but on a range-wide scale no major threats are known.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Currently, this species is of relatively low conservation concern and does not require significant additional protection or major management, monitoring, or research action.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Several countries where this species has been introduced report that it causes ecological problems. Bluegill overcrowd and stunt the growth of other fish and may even be responsible for causing extinction of a native fish in Panama. It is considered a pest in its introduced range.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

This is an important game fish in the United States. Bluegill are fairly easy to catch and are good to eat. They are also used to stock rivers and lakes with food for largemouth bass, another important game fish.

Positive Impacts: food ; ecotourism

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Uses

Comments: Has been cultured extensively, almost entirely in brood ponds. This is the usual forage fish stocked in combination with largemouth bass in southwestern U.S. (Sublette et al. 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

Several countries where this species has been introduced report that it causes ecological problems. Bluegill overcrowd and stunt the growth of other fish and may even be responsible for causing extinction of a native fish in Panama. It is considered a pest in its introduced range.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

This is an important game fish in the United States. Bluegill are fairly easy to catch and are good to eat. They are also used to stock rivers and lakes with food for Micropterus salmoides, another important game fish.

Positive Impacts: food ; ecotourism

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Importance

fisheries: minor commercial; aquaculture: commercial; gamefish: yes; aquarium: commercial
  • International Game Fish Association 1991 World record game fishes. International Game Fish Association, Florida, USA. (Ref. 4699)
  • Welcomme, R.L. 1988 International introductions of inland aquatic species. FAO Fish. Tech. Pap. 294. 318 p. (Ref. 1739)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Bluegill

For the exoatmospheric nuclear test, refer to Bluegill (nuclear test).

The bluegill (Lepomis macrochirus) is a species of freshwater fish sometimes referred to as bream, brim, or copper nose. It is a member of the sunfish family Centrarchidae of the order Perciformes. Lepomis, in Greek, means "scaled gill cover" and macrochirus means large hand, which may be a reference to its body shape. A defining characteristic of the bluegill is the bright blue edging visible on its gill rakers.[1]

The bluegill is the state fish of Illinois.[2]

Distribution[edit]

The bluegill or bluegulli[citation needed] occurs naturally in the United States east of the Rocky Mountains from coastal Virginia to Florida, west to Texas and northern Mexico, and north to western Minnesota and western New York. Today they have been introduced to almost everywhere else in North America, and have also been introduced into Europe, South Africa, Zimbabwe,[3] Asia, South America, and Oceania. Bluegills have also been found in the Chesapeake Bay, indicating they can tolerate up to 1.8% salinity.[4]

In some locations where they have been transplanted, they are considered pests: trade in the species is prohibited in Germany and Japan. In the case of Japan, bluegills were presented to the then-crown prince, Akihito in 1960 as a gift by Richard J. Daley, mayor of Chicago. The prince, in turn, donated the fish to fishery research agencies in Japan from which they escaped, becoming an invasive species which has wreaked havoc with native species, specifically in Lake Biwa in Shiga Prefecture. The emperor has since apologized.[5]

Physical description[edit]

Bluegill from Lake Lanier, Landrum, SC. (Caught & Released, June 14, 2004)

The bluegill is noted for the darkened spot that it has on the posterior edge of the gills and base of the dorsal fin. The sides of its head and chin are a dark shade of blue. It usually contains 5-9 vertical bars on the sides of its body, but these stripes are not always distinct. It has a yellowish breast and abdomen, with the breast of the breeding male being a bright orange.[4] The bluegill has three anal spines, ten to 12 anal fin rays, six to 13 dorsal fin spines, 11 to 12 dorsal rays, and 12 to 13 pectoral rays. They are characterized by their deep, flattened, laterally compressed bodies. They have a terminal mouth, ctenoid scales, and a lateral line that is arched upward anteriorly.[6] The bluegill typically ranges in size from four to 12 inches, and reaches a maximum size just over 16 inches. The largest bluegill ever caught was four pounds, 12 ounces in 1950.[7]

The bluegill is most commonly related to the orangespotted sunfish and the redear sunfish, but different in a distinct spot at or near the base of the soft dorsal fin.[4]

Habitat[edit]

Bluegill live in the shallow waters of many lakes and ponds, along with slow-moving areas of streams and small rivers. They prefer water with many aquatic plants, and hide within fallen logs or water weeds. They can often be found around weed beds, where they search for food or spawn.[8] In the summer, adults move to deep, open water where they suspend just below the surface and feed on plankton and other aquatic creatures. Bluegill try to spend most of their time in water from 60 to 80 °F (16 to 27 °C), and tend to have a home range of about 320 square feet (30 m2) during nonreproductive months. They enjoy heat, but do not like direct sunlight - they typically live in deeper water, but will linger near the water surface in the morning to stay warm.[4] Bluegill are usually found in schools of 10 to 20 fish, and these schools will often include other panfish, such as crappie, pumpkinseeds, and smallmouth bass.[1]

Ecology[edit]

Young bluegills' diet consists of rotifers and water fleas. The adult diet consists of aquatic insect larvae (mayflies, caddisflies, dragonflies), but can also include crayfish, leeches, snails, and other small fish.[9] Their diet can also include the waxworm and nightcrawler that can be provided for them by anglers.[citation needed] If food is scarce, bluegill will also feed on aquatic vegetation, and if scarce enough, will even feed on their own eggs or offspring. As bluegill spend a great deal of time near the surface of water, they can also feed on popping bugs and dry flies. Most bluegills feed during daylight hours, with a feeding peak being observed in the morning and evening (with the major peak occurring in the evening).[1] Feeding location tends to be a balance between food abundance and predator abundance. Bluegill use gill rakers and bands of small teeth to ingest their food. During summer months, bluegills generally consume 35 percent of their body weight each week. To capture prey, bluegills use a suction system in which they accelerate water into their mouth. Prey comes in with this water. Only a limited amount of water is able to be suctioned, so the fish must get within 1.75 centimeters of the prey.[9]

In turn, bluegill are prey to many larger species, including largemouth bass, muskellunge, turtles, northern pike, yellow perch, walleye, catfish, and even larger bluegill. Herons and otters have also been witnessed[citation needed] catching bluegill in shallow water. However, the shape of the fish makes them hard to swallow.[1]

Adaptations[edit]

Bluegills have the ability to travel and change directions at high speeds by means of synchronized fin movements. They use notched caudal fins, soft dorsal fins, body undulations, and pectoral fins to move forward. Having a notched caudal fin allows them to accelerate quickly. The speed of their forward motion depends on the strength of which they abduct or adduct fins. The flat, slender body of the bluegill lowers water resistance and allows the bluegills to cut effectively through water. The large, flexible pectoral fins allow the fish to decelerate quickly. This superior maneuverability allows the bluegill to forage and escape predators very successfully. Bluegills have a lateral line system, as well as inner ears, that act as receptors for vibration and pressure changes. However, bluegills rely heavily on sight to feed, especially in their foraging. Optimal vision occurs in the daylight hours. The mouth of the bluegill is very small and requires the use of the pharynx to suck in prey.[10]

Reproduction and lifestyle[edit]

Spawning season for bluegills starts late in May and extends into August. The peak of the spawning season usually occurs in June in waters of 67 to 80°F. The male bluegills arrive first at the mating site. They will make a spawning bed of six to 12 inches in diameter in shallow water, clustering as many as 50 beds together. The males scoop out these beds in gravel or sand. Males tend to be very protective and chase everything away from their nests, especially other male bluegills. Some bluegills, regardless of their small size, will even attack snorkelers if they approach the edge of the nest. As a female approaches, the male will begin circling and making grunting noises. The motion and sound of the males seem to attract the females. Females are very choosy and will usually pick males with larger bodies and "ears", making larger size a desirable trait for males to have. If the female enters the nest, both the male and female will circle each other, with the male expressing very aggressive behavior toward the female. If the female stays, the pair will enter the nest and come to rest in the middle. With the male in an upright posture, the pair will touch bellies, quiver, and spawn. These actions are repeated at irregular intervals several times in a row. Once the spawning is done, the male will chase the female out of the nest and guard the eggs.[1] The fertilization process is entirely external. The male's sperm combines with the female's eggs in the water. Smaller males will often hide in nearby weeds and dart into the nest as they attempt to fertilize the eggs. They then quickly dart away.[4] The size of the female plays a large role in how many eggs will be produced. A small female can produce as few as 1,000 eggs, and a large, healthy female can produce up to 100,000 eggs. The male continues to watch over the nest until the larvae are able to hatch and swim away on their own. The bluegill generally begins its spawning career at one year of age, but has been found to spawn as early as four months of age under favorable conditions.[11] Anglers find spawning season to be a very successful time to fish for bluegills, as they aggressively attack anything, including a hook, that comes near.[1]

The growth of the bluegill is very rapid in the first three years, but slows considerably once the fish reaches maturity. Many fish reach five to eight years old, and in extreme cases, can live 11 years.[10]

Fishing[edit]

Bluegill caught in an Alabama pond

Bluegills are popular panfish, caught with live bait such as worms or crickets, grasshoppers, flies, pieces of corn, small crankbaits, spinners, American cheese pushed around a hook, maggots, small frogs, bread, or even a bare hook. They mostly bite on vibrant colors like orange, yellow, green, or red, chiefly at dawn and dusk. They are noted for seeking out underwater vegetation for cover; their natural diet consists largely of small invertebrates and very small fish. The bluegill itself is also occasionally used as bait for larger game fish species, such as blue catfish, flathead catfish and largemouth bass.[12]

Fishermen are sometimes able to use polarized sunglasses to see through water and find bluegills' spawning beds.[13] Bluegill have a rather bold character; many have no fear of humans, eating food dropped into the water, and a population in Canada's Lake Scugog will even allow themselves to be stroked by human observers. Because of their size and the method of cooking them, bluegills are often called panfish.[14]

Although the majority of bluegills are caught on live bait—particularly worms, leeches, grubs and crickets—they can also be taken on tiny artificials such as jigs and spinnerbaits. They will rise to small poppers, sponge bugs and dry flies.[15] They will also take wet flies, nymphs, and small streamers.

Management[edit]

Bluegills play an important role in pond and lake management to keep crustacean and insect populations low, as a single bluegill population may eat up to six times its own weight in just one summer.[10]

References[edit]

  1. ^ a b c d e f Paulson, Nicole, and Jay T. Hatch. "Fishes of Minnesota-Bluegill." GC 1112 Welcome. Minnesota Department of Natural Resources, 18 June 2004. Web. 04 May 2011. http://hatch.cehd.umn.edu/research/fish/fishes/bluegill.html
  2. ^ Illinois State Symbols and Their History
  3. ^ https://www.newsday.co.zw/2014/01/11/cat-mouse-game-chivero/
  4. ^ a b c d e Schultz, Ken. Ken Schultz's Field Guide to Freshwater Fish. Hoboken, NJ: J. Wiley & Sons, 2004
  5. ^ "Japan in culinary offensive to stop spread of US fish" report by Justin McCurry from Tokyo in The Guardian November 26, 2007
  6. ^ Sublette, J. E., M. D. Hatch, and M. Sublette. 1990. University of New Mexico Press, Albuquerque. 393 pp
  7. ^ Ross, S. T. 2001. The Inland Fishes of Mississippi. University Press of Mississippi, Jackson. 624 pp
  8. ^ Lee, D. S. 1980. Lepomis macrochirus (Rafinesque 1819), Bluegill. pp. 597 in D. S. Lee, et al. Atlas of North American Freshwater Fishes. N. C. State Mus. Nat. Hist., Raleigh, 854 pp
  9. ^ a b Carlander, K.D. 1997. Handbook of freshwater fishery biology. Volume 2. Life history Data on centrarchid fishes of the United States and Canada. Iowa State Univ.Press, Iowa.
  10. ^ a b c Swingle, H. S. and E. V. Smith. 1943. Factors affecting the reproduction of bluegill bream and large black bass in ponds. Ala. Poly-Tech. Inst. Agr. Exp. Stn. Circ. 87:8
  11. ^ Sternberg, Dick. Freshwater Gamefish of North America. 1987.
  12. ^ Coble, Daniel W. "Effects of Angling on Bluegill Populations: Management Implications." North American Journal of Fisheries Management 8.3 (1988): 277
  13. ^ "Bluegill Fishing 101". bluegillslayer.com. Retrieved 25 November 2014. 
  14. ^ "Fishes of Minnesota: Bluegill Minnesota DNR." Minnesota Department of Natural Resources: Minnesota DNR. Web. 04 May 2011.
  15. ^ "Bluegill." North American Fishing Club. N.p., 8 Sept. 2010. Web. 2 July 2012. <http://www.fishingclub.com/my-nafc/fishing-wiki/topic/bluegill>.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Reported to hybridize with LEPOMIS CYANELLUS, L. GULOSUS, and L. MEGALOTIS. Though the gender of the name LEPOMIS is feminine (see Bailey and Robins, 1988, Bull. Zool. Nomencl. 45(2):100), the 1991 AFS checklist (Robins et al. 1991) retained the masculine ending for MACROCHIRUS and other species, pending a vote by the ICZN on a petition (by Etnier and Warren) to treat LEPOMIS as masculine for nomenclatural purposes. Three subspecies have been recognized, but stocking programs have mixed populations, and subspecies may no longer be recognizable (Page and Burr 1991, Lee et al. 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!