Overview

Comprehensive Description

L. coubie Rueppel , 1832

BMNH 1862.6.17.132-139, 7 specimens, Nile River, Khartoum, Republic of Sudan ; BMNH 2005.4.18.112-113, 1 specimen, mouth of Alibori River (Niger basin), Benin ; BMNH 2006.4.17.28- 29, 2 specimens, Comoé River, Côte d’Ivoire ;

  • Timo Moritz (2007): Description of a new cyprinid species, Labeo meroensis n. sp. (Teleostei: Cyprinidae), from the River Nile. Zootaxa 1612, 55-62: 55-55, URL:http://www.zoobank.org/urn:lsid:zoobank.org:pub:D6B4BF95-912E-47AD-9307-25A41BAD8D36
Public Domain

MagnoliaPress via Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Inhabit rivers (Ref. 4967).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Africa: Very widespread, within the drainage basin of the Nile River, and Chad, Niger-Bénoué, Volta, Senegal and Gambia basins, as well as Cross River and Cameroon coastal rivers (Ref. 1440). Not reliable known from the Congo River basin (Ref. 1440) and one controversial record from the East coast of Africa (Ref. 1440).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Range Description

This species is only known from Tonga, on the White Nile River, Sudan.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

This is a widespread species, known from Senegal to Ethiopia, with populations present also in the Nile, south to Lake Albert.

Central Africa: Labeo coubie is known from Pool Malebo (Stanley Pool) to Kisangani, Democratic Republic of Congo.

Eastern Africa: It is present in Lake Albert, Murchison Nile, and Kingani.

Northern Africa: Rare in This species is known from upper Egyptian Nile.

Northeast Africa: It is found in Baro River, Ethiopia

Western Africa: This species is known from Chad, Niger-Benue, Volta, Senegal and Gambia basins, Cross River and Cameroon coastal rivers.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Africa.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal soft rays (total): 11 - 13; Analsoft rays: 8; Vertebrae: 31 - 33
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 750 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

75.0 cm SL (male/unsexed; (Ref. 2801)); max. published weight: 5,000 g (Ref. 3799)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Small posterior barbel at angle of mouth. Anterior barbel visible in young disappears with age. Dorsal upper edge straight to convex, certain forms with dorsal very round and described under the name L. pseudocoubie. Gill rakers on 1st branchial arch. Dark body, bluish gray to violet black back and sides, light belly. Fins blackish or bluish-gray. Scales on sides with violet or red-violet center and bluish or blackish outer portion. Young grayish with scale rows separated by longitudinal dark sinuous lines. Outer lip has a series of folds (Ref.4967).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
No information available.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Labeo coubie is a benthopelagic and potamodromous species. It inhabits rivers and lakes (Skelton 1993), particularly sheltered bays. It is a bottom feeder, on mud, plant debris and diatoms. Mature ovaries are voluminous and well developed in spring and summer.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

benthopelagic; potamodromous (Ref. 51243); freshwater
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Potamodromous. Migrating within streams, migratory in rivers, e.g. Saliminus, Moxostoma, Labeo. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Two forms of this species are different in the shape of the dorsal fin (Ref. 4967).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Fish species Associates in the Senegal River

There are 141 species of fish recorded in the Senegal River, most of which are native; however, there are no endemic species of fish in the Senegal Basin. Among the larger native benthopelagic taxa are: the 170 centimetre (cm) North African Catfish (Clarias gariepinus), the 149 cm Electric Catfish (Malapterurus electricus), and the 92 cm African Carp (Labeo coubie).

Some of the larger native demersal fishes of the Senegal Basin are: the 204 cm Aba (Gymnarchus niloticus). the 200 cm Nile Perch (Lates niloticus), the 183 cm Sampa (Heterobranchus longifilis), and the 150 cm Cornish Jack (Mormyrops anguilloides).

Pelagic native fishes in the Senegal River include the 65 cm True Big-scale Tetra (Brycinus macrolepidotus) and the 16 cm Ansorge Fangtooth Pellonuline (Odaxothrissa ansorgii).

Creative Commons Attribution 3.0 (CC BY 3.0)

© C. Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Labeo coubie

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CTTTATCTCGTATTTGGTGCCTGAGCCGGAATAGTAGGAACCGCCCTAAGCCTTCTAATTCGAGCTGAATTAAGCCAACCCGGATCGCTTCTCGGTGACGACCAAATTTATAATGTTATCGTAACTGCCCACGCCTTCGTAATAATTTTCTTTATAGTAATGCCTGTCCTCATTGGAGGGTTTGGAAACTGACTTGTACCACTAATGATCGGAGCCCCGGACATAGCATTCCCCCGTATAAACAACATAAGCTTCTGACTCCTACCCCCATCATTCCTACTACTATTAGCTTCTTCTGGTGTTGAGGCTGGAGCTGGAACAGGATGGACAGTATATCCACCTCTTGCCGGCAACTTGGCCCACGCAGGAGCATCAGTAGACCTAACAATTTTCTCACTCCACCTAGCAGGTGTCTCATCAATTTTAGGGGCCATTAATTTTATTACTACAACCATTAACATGAAACCCCCAGCCATTTCACAATATCAAACACCCTTATTCGTCTGATCCGTGCTTGTTACTGCTGTGCTGCTTCTCTTATCACTACCGGTATTAGCAGCGGGTATCACAATGCTTTTAACAGATCGAAACCTTAATACTACATTCTTCGACCCGGCAGGAGGAGGGGACCCAATCCTTTACCAACATCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Labeo coubie

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Getahun, A.

Reviewer/s
Snoeks, J. & Brooks, E.

Contributor/s

Justification
Very little about this species is currently known. More information on the distribution and status of this species is needed before a full assessment can be made.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Azeroual, A., Entsua-Mensah, M., Getahun, A., Hanssens, M., Lalèyè, P., Moelants, T. & Twongo, T.

Reviewer/s
Snoeks, J., Tweddle, D., Getahun, A., Lalèyè, P., Paugy, D., Zaiss, R., Fishar, M.R.A & Brooks, E.

Contributor/s

Justification
This species has a wide distribution, with no known major widespread threats. It is therefore listed as Least Concern. It has also been assessed regionally as Least Concern for central and western Africa. Due to a lack of information on this species distribution, population size, and threats, it has been categorised as Data Deficient for east and northeast Africa. Within the north Africa region the species is assessed as Endangered.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
No information available.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
No data on population trends.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
No information available.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Major Threats
Limited information available, but this species is probably threatened by heavy fishing pressure. In northern Africa, dams, water pollution (agriculture, domestic and commercial/industrial), groundwater extraction and drought pose possible threats.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
No information available. More information is needed on the distribution and status of this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation Actions

Conservation Actions
No information available. More research is needed into this species population numbers and range, biology and ecology, habitat status and threats, as well as monitoring and potential conservation measures.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; aquarium: public aquariums
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Labeo coubie

The African carp (Labeo coubie) is a cyprinid fish, widespread in Africa, where it occurs within the drainage basin of the Nile (Blue, White, Lake Albert) and in the Chad, Niger-Benue, Volta, Senegal and Gambia Rivers, as well as the Cross River and Cameroon coastal rivers. Furthermore, it is also known from East Africa and the middle reaches of the Congo. Records from the Zambezi drainage need confirmation.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!