Overview

Brief Summary

Taxonomy

The ragfish became known to science in 1880, when Lockington obtained two juvenile specimens from a fish market in San Francisco. The two specimens were unfortunately lost in a fire caused by an earthquake that devastated California in 1906.Lockington described the ragfish as being nearly scaleless (only spinous scales on the lateral line) with bony prickles on the fin rays of each fin. Purple spots and blotches are distributed over a yellowish-brown ground colour, a round caudal fin, and small pelvic fins.Seven years later Tartelton H. Bean received a large fish (approximately 182cm) from Mr. Charles Willoughby that was beached in Damon, in the State of Washington. Bean recognised the close resemblance to the ragfish. However because of some differences to the ragfish, Bean described it as Acrotus willoughbyi, in honour of its finder, in 1888.73 years later Clemens and Wilby realised that Icosteus aenigmaticus and Acrotus willoughbyi represent the juveniles and adults of the same species.Still the relationship of the ragfish to other fish remains enigmatic. Many systematics researchers have placed the ragfish close to the butterfishes and their relatives (Stromateoidei), which it resembles superficially.However morphologically the ragfish is a mixture between the whalefishes and their relatives
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Introduction

The ragfish, Icosteus aenigmaticus is a large species that occurs only in the Northern Pacific. Although ragfish can reach up to 2 metres long, it was unknown to science until 1880.The common name and the genus name of the mysterious ragfish, Icosteus aenigmaticus, refer to its flabby appearance and its weakly-ossified skeleton. The species name refers to its unknown relationship with other fish.Adult ragfish are yellowy-brown in colour with purple spots and blotches. They have few scales and bony prickles on the fin rays.Juveniles and adults of the species differ significantly and for a long time were considered separate species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology

Adults occur near bottom; juveniles in shallow water or offshore near the surface (Ref. 50277). Feeds on jellyfish (Ref. 50277), fishes and squids (Ref. 2850), as well as octopuses (Ref. 4525).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

Juvenile ragfish differ remarkably from adults.Juveniles are light brown in colour and sprinkled with dark spots. They have a rounded caudal fin and pelvic fins below the pectoral fins.During development the colour changes to a dark chocolate brown, the pelvics disappear and the caudal fin changes to a forked appearance.It is believed that juvenile ragfish feed on medusa and jellyfish. Stomach contents of adult ragfish revealed additionally cephalopods, salps, and small fishes such as eel pouts (Zoarcidae).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

British Columbia, Canadian Exclusive Economic Zone [Pacific part], Coastal Waters of Southeast Alaska and British Columbia, FAO fishing area 67, North East Pacific, North Pacific
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North Pacific: Japan to southeastern Alaska and to Point Loma, southern California, USA.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution habitat

The ragfish’ home is the North Pacific - north of Baja California, northwards to the Bering Sea, and eastwards to Japan.Juveniles are found on the surface, taking shelter under jellyfish, while adults are found in the bathypelagic, down to 1400 metres, and always close to the bottom.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North Pacific: Bering Sea to southern California, Okhotsk Sea, and Pacific coast of southern Honshu, Japan.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 52 - 55; Analspines: 0; Analsoft rays: 34 - 40
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 2130 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

213 cm TL (male/unsexed; (Ref. 2850))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Pectorals rounded, pedunculate (Ref. 6885). Generally of a chocolate color (Ref. 6885). Young more robust, with an expanded and rounded caudal fin, 5 pelvic rays, and a brown and yellow irregularly blotched with faint purple color, dusky on fins (Ref. 6885).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type for Icosteus aenigmaticus
Catalog Number: USNM 39340
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): C. Willoughby
Year Collected: 1887
Locality: Quinaielt Indian Agency, Damon, Wash. Terr., Washington, United States, Pacific
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type for Icosteus aenigmaticus
Catalog Number: USNM 27398
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan
Year Collected: 1880
Locality: Pt. Reyes, California, California, United States, Pacific
  • Type: Lockington, W. N. 1880. Proceedings of the United States National Museum. 3 (123): 63.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

bathypelagic; marine; depth range 0 - 1420 m (Ref. 50550), usually 18 - 732 m (Ref. 2850)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known from seamounts and knolls
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 5 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2 samples.

Environmental ranges
  Depth range (m): 456.585 - 50000
  Temperature range (°C): 3.480 - 3.603
  Nitrate (umol/L): 34.816 - 43.838
  Salinity (PPS): 33.972 - 34.393
  Oxygen (ml/l): 0.370 - 1.669
  Phosphate (umol/l): 2.817 - 3.347
  Silicate (umol/l): 99.499 - 125.314

Graphical representation

Depth range (m): 456.585 - 50000

Temperature range (°C): 3.480 - 3.603

Nitrate (umol/L): 34.816 - 43.838

Salinity (PPS): 33.972 - 34.393

Oxygen (ml/l): 0.370 - 1.669

Phosphate (umol/l): 2.817 - 3.347

Silicate (umol/l): 99.499 - 125.314
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 18 - 732m.
From 18 to 732 meters.

Habitat: benthopelagic. Found offshore. Feeds on fishes and squids. Eaten by sperm whales. Spawns in the summer and winter (Ref. 6885). A 136 cm SL female probably produces about 435, 000 light amber coloured eggs (Ref. 6885).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Behaviour

Juvenile ragfish are often sighted in association with jellyfish, which they use for shelter in the open ocean. The adults are probably strong swimming ‘cruisers’, searching for food close to the bottom.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Icosteus aenigmaticus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATATCTAGTATTTGGTGCATGAGCCGGTATAGTGGGTACAGCCTTAAGCCTACTCATCCGAGCTGAACTAAGCCAACCAGGCGCCCTTCTTGGGGACGACCAGATCTACAATGTAATTGTTACGGCACATGCCTTCGTAATAATTTTCTTTATAGTAATACCAATTATGATCGGGGGGTTTGGAAACTGACTCATTCCTCTAATAATTGGAGCCCCAGACATAGCATTCCCTCGAATAAATAACATAAGCTTTTGACTCCTCCCACCCTCCTTCCTTCTGCTCCTGGCCTCTTCCGGGGTTGAAGCCGGCGCTGGAACTGGCTGAACAGTATACCCACCCCTATCCGGGAATCTAGCCCACGCCGGAGCATCTGTTGACTTAACCATTTTTTCCCTACACTTAGCAGGAGTCTCCTCAATCCTTGGGGCCATTAACTTCATTACAACAATTATTAATATAAAACCTGCAGCCATCTCCCAATATCAAACACCCCTATTTGTGTGATCCGTCCTAATTACAGCCGTACTTCTTCTACTATCTCTGCCAGTCCTCGCTGCTGGTATTACTATGCTTCTTACAGACCGAAACCTAAATACAACCTTTTTTGACCCTGCAGGAGGGGGAGATCCAATCCTTTACCAACACTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Icosteus aenigmaticus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The ragfish is not thought to be threatened – it is not an important food fish and is rarely caught as bycatch. This is also the reason why only scarce data are available.Ragfish can probably outswim trawl nets towed at 2 to 3 knots, and therefore are unlikely to be an endangered
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Ragfish

The ragfish, Icosteus aenigmaticus, is an odd ray-finned fish of the northern Pacific Ocean; although a perciform, its skeleton is mostly cartilage, and the larvae have pelvic fins that disappear as they mature. It is the sole member of the family Icosteidae, and some authorities place it into its own order Icosteiformes. It was first described by W. N. Lockington in 1880.

The ragfish body is scaleless and limp, both because of the cartilaginous skeleton, as well as its flabby muscles. None of the fins have any spines. The dorsal and anal fins extend much of the length of the body, while the pelvic fins are absent. The coloration is generally a dark brown, and maximum known length is two meters.

Ragfishes are found in deeper waters out to sea, and are said to eat other fish, squid, and octopus, although recent catches show no squid beaks but large amounts of jellyfish.

The larvae make a remarkable transformation as they mature; the caudal fin shrinks, and the pelvic fins disappear.

It was considered formerly that adult ragfishes were different species, known then as Acrotus willoughbyi.[1]

References

  1. ^ http://www.photolib.noaa.gov/htmls/figb0639.htm
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!