Overview

Comprehensive Description

Biology

Uncommon in most areas, but may be locally common in certain places. Usually attached to gorgonians or seagrasses but may occur in floating Sargassum or swimming freely in midwater (Ref. 9710). Ovoviviparous (Ref. 205). The male carries the eggs in a brood pouch which is found under the tail (Ref. 205). Has been reared in captivity (Ref. 35409). Length type refers to Height (= from top of coronet to the tip of straightened tail).
  • Lourie, S.A., A.C.J. Vincent and H.J. Hall 1999 Seahorses: an identification guide to the world's species and their conservation. Project Seahorse, London. 214 p. (Ref. 30915)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Western Atlantic: North Carolina in USA, Bermuda and Bahamas to Rio deJaneiro, Brazil.
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic: North Carolina in USA, Bermuda (Ref. 9710) and Bahamas to Santa Catarina, Brazil (Ref. 57756). International trade is monitored through a licensing system (CITES II, since 5.15.04) and a minimum size of 10 cm applies.
  • Robins, C.R. and G.C. Ray 1986 A field guide to Atlantic coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 354 p. (Ref. 7251)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 1619
  • Lourie, S.A., A.C.J. Vincent and H.J. Hall 1999 Seahorses: an identification guide to the world's species and their conservation. Project Seahorse, London. 214 p. (Ref. 30915)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 150 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

17.5 cm OT (male/unsexed; (Ref. 30915))
  • Lourie, S.A., A.C.J. Vincent and H.J. Hall 1999 Seahorses: an identification guide to the world's species and their conservation. Project Seahorse, London. 214 p. (Ref. 30915)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description: (based on 39 specimens): Adult height: 9.5-17.5cm. Rings: 11+35 (31-39). Snout length: 2.2 (2.0-2.5) in head length. Dorsal fin rays: 17 (16-19) covering 2+1 rings. Pectoral fin rays: 16 (15-17). Coronet: low-medium, rounded, may be quite large and convoluted (like a crumpled piece of paper). Spines: none to low rounded tubercles. Other distinctive characters: broad, almost double cheek and eye spines; long, thick snout; narrow body; usually no skin appendages.Color pattern: often profusely spotted with brown, with numerous tiny white dots (especially on tail); may have paler ‘saddles’ across dorsolateral surfaces.
  • Lourie, S.A., A.C.J. Vincent and H.J. Hall 1999 Seahorses: an identification guide to the world's species and their conservation. Project Seahorse, London. 214 p. (Ref. 30915)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Hippocampus reidi
Catalog Number: USNM 84527
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Photograph
Year Collected: 1885
Locality: Savannah To Cape Charles: Off Cape Hatteras, North Carolina, United States, Atlantic
Vessel: Albatross
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Holotype for Hippocampus reidi
Catalog Number: USNM 86590
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): W. Donovan
Locality: St. George, Grenada, B.W.I., Windward Islands, Grenada, Lesser Antilles, Caribbean Sea, Atlantic
  • Holotype: Ginsburg, I. 1933. Journal of the Washington Academy of Sciences. 23 (12): 560.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Hippocampus reidi
Catalog Number: USNM 223673
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): Donovan
Locality: St. George, Grenada, B.W.I., Windward Islands, Saint George Parish, Grenada, Lesser Antilles, Caribbean Sea, Atlantic
  • Paratype: Ginsburg, I. 1933. Journal of the Washington Academy of Sciences. 23 (12): 560.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Vari (1982) reports H. reidi at depths as great as 55 m. Small individuals tend to be found in shallower water than large animals (Dauwe 1993). It has been found on gorgonian corals, seagrass, mangroves and Sargassum (Lieske and Myers 1994). Hippocampus reidi are pair-bonded in the wild (B. Dauwe and M. Nijhoff in litt. to Lourie et al. 1999).

This species may be particularly susceptible to decline. All seahorse species have vital parental care, and many species studied to date have high site fidelity (Perante et al. 2002, Vincent et al., in review), highly structured social behaviour (Vincent and Sadler 1995), and relatively sparse distributions (Lourie et al. 1999). The importance of life history parameters in determining response to exploitation has been demonstrated for a number of species (Jennings et al. 1998).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

benthic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; non-migratory; brackish; marine; depth range 0 - 55 m (Ref. 30915)
  • Lourie, S.A., A.C.J. Vincent and H.J. Hall 1999 Seahorses: an identification guide to the world's species and their conservation. Project Seahorse, London. 214 p. (Ref. 30915)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 18 specimens in 1 taxon.
Water temperature and chemistry ranges based on 6 samples.

Environmental ranges
  Depth range (m): 0.9 - 2543
  Temperature range (°C): 3.048 - 27.537
  Nitrate (umol/L): 0.447 - 18.047
  Salinity (PPS): 33.284 - 37.091
  Oxygen (ml/l): 4.613 - 6.333
  Phosphate (umol/l): 0.118 - 1.196
  Silicate (umol/l): 1.954 - 17.647

Graphical representation

Depth range (m): 0.9 - 2543

Temperature range (°C): 3.048 - 27.537

Nitrate (umol/L): 0.447 - 18.047

Salinity (PPS): 33.284 - 37.091

Oxygen (ml/l): 4.613 - 6.333

Phosphate (umol/l): 0.118 - 1.196

Silicate (umol/l): 1.954 - 17.647
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 55m.
Recorded at 55 meters.

Habitat: reef-associated. Uncommon in most areas, but may be locally common in certain places. Usually attached to gorgonians or seagrasses but may occur in floating @Sargassum@ or swimming freely in midwater (Ref. 9710).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Also found among sponges (Ref. 52034).
  • Foster, S.J. and A.C.J. Vincent 2004 Life history and ecology of seahorses: implications for conservation and management. J. Fish Biol. 65:1-61. (Ref. 52034)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Breeding season more than 8 months in laboratory; egg diameter 1.2 mm; gestation period 2 weeks, depending on water temperature; young approximately 7 mm at birth; pair-bonded in wild (Ref. 30915).
  • Breder, C.M. and D.E. Rosen 1966 Modes of reproduction in fishes. T.F.H. Publications, Neptune City, New Jersey. 941 p. (Ref. 205)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Hippocampus reidi

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATACTTAGTATTTGGTGCTTGAGCCGGTATAGTCGGCACTGCACTCAGCCTTTTAATTCGAGCAGAACTAAGTCAACCAGGAGCTTTACTAGGGGATGATCAAATCTATAATGTTATCGTAACTGCTCATGCTTTTGTAATAATTTTCTTTATGGTTATGCCTATTATAATCGGGGGTTTTGGTAATTGACTGGTTCCCTTAATAATTGGAGCCCCTGATATAGCCTTTCCTCGAATAAATAATATGAGTTTTTGATTATTACCGCCTTCTTTTCTTCTCCTCCTTGCTTCCTCAGGAGTAGAAGCTGGAGCAGGAACAGGTTGGACTGTCTACCCTCCACTAGCAGGCAATTTAGCCCATGCTGGGGCCTCTGTAGACTTGACAATCTTTTCTCTTCATTTAGCAGGTGTTTCATCAATTCTAGGGGCTATTAACTTTATTACTACTATTATCAACATAAAACCCCCATCAATTTCACAATATCAAACACCATTATTTGTATGAGCAGTTTTAGTAACCGCAGTTCTACTTTTACTATCATTACCTGTACTAGCAGCCGGGATCACTATGCTTCTTACAGACCGAAACTTAAATACAACATTCTTTGACCCTTCTGGAGGGGGAGATCCTATCCTTTACCAACACTTATTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Hippocampus reidi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2003
  • Needs updating

Assessor/s
Project Seahorse

Reviewer/s
Marsden, A.D., Foster, S.J. & Vincent, A.C.J. (Syngnathid Red List Authority)

Contributor/s

Justification
There are no published data about population trends or total numbers of mature animals for this species. There is very little available information about its extent of occurrence or its area of occupancy. There have been no quantitative analyses examining the probability of extinction of this species. As a result, the assessors have insufficient data to properly assess the species against any of the IUCN criteria.

Hippocampus reidi previously was listed in 1996 as VU A2cd under the 1994 criteria. This assessment was based on suspected past declines in occupancy, occurrence and habitat, as well as on potential levels of exploitation. In reassessing the species under the new criteria and with greater taxonomic understanding we find that no appropriate data on biology and ecology, habitat, abundance or distribution are available for this species. Further research is needed. Assessed as Data Deficient under the new criteria.

History
  • 1996
    Vulnerable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
During Project Seahorse trade surveys conducted between 2000–2001, fishers in Brazil, Guatemala, Honduras, Mexico, Nicaragua and Panama reported decreases in the catch of seahorses both in trawls (as bycatch) and by divers (J. Baum and I. Rosa, unpublished data), but the portion of these declines attributable to H. reidi is unknown.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Hippocampus reidi are collected and traded in the Americas as aquarium fishes, folk medicine, curiosities and for religious purposes (Rosa et al. 2002). The volume of this trade is unknown, as there is confusion between this species and a similar one, H. erectus. Without appropriate management this trade might represent a threat to the species. H. reidi are also taken as bycatch in shrimp trawl fisheries in the U.S., Mexico and Central America (Rosa et al. 2002). A study of bycatch in Florida found that most seahorses in bycatch were H. erectus; this suggests that H. reidi may not be as susceptible to trawling as H. erectus, possibly because of habitat differences.

Hippocampus reidi is considered threatened in the United States by the American Fisheries Society (AFS) (Musick et al. 2000). They cite the species' rarity and degradation of its seagrass habitats in South Florida as reasons for this listing. While this status may apply on a national level, we did not find information that would justify such a listing for the species as a whole.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Data deficient (DD)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The entire genus Hippocampus was listed in Appendix II of CITES in November 2002. Implementation of this listing will begin May 2004. The export of syngnathids from Mexico is effectively banned. Permits or licenses are required to export dried syngnathids from Honduras and Nicaragua, and to export live syngnathids from Panama, Brazil, Costa Rica, Guatemala and Nicaragua. Further research on this species biology, ecology, habitat, abundance and distribution is needed.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; price category: unknown; price reliability:
  • Vincent, A.C.J. 1996 The international trade in seahorses. TRAFFIC International, Cambridge, UK. 163 p. (Ref. 12238)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Slender seahorse

The slender seahorse or longsnout seahorse (not to be confused with the Long-snouted seahorse), Hippocampus reidi, is a species of fish in the Syngnathidae family.[1]

Description[edit]

The slender seahorse typically grows to be approximately 6.8 inches long (17.5 centimeters). Males and females are easily distinguished due to their bright colors. Males are usually orange, while the females are yellow. However, both males and females may have brown or white spots placed sporadically upon their body. These spots may also change into a pink or white color during the courtship period.[2]

Habitat and Distribution[edit]

The slender seahorse has been found at depths of 55 meters. Smaller individuals inhabit shallower waters. The slender seahorse has an affinity for coral reefs[2] and seagrass beds and can be found on gorgonian coral, seagrass, mangroves, and Sargassum. It is native to many countries, including the Bahamas, Barbados, Belize, Bermuda, Brazil, Colombia, Cuba, Grenada, Haiti, Jamaica, Panama, United States (Florida and North Carolina), and Venezuela.[3] It inhabits subtropical regions, ranging from 29 degrees north to 25 degrees south and 133 degrees west to 40 degrees east.[1]

References[edit]

  1. ^ a b Froese, R.; Pauly, D. (6 October 2010). "FishBase". 
  2. ^ a b "Slender seahorse". Monterey Bay Aquarium. 
  3. ^ Project Seahorse. 2003. Hippocampus reidi. 2012 IUCN Red List of Threatened Species. Downloaded on 3 June 2013.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!