You are viewing this Species as classified by:

Overview

Brief Summary

Biology

Seahorses are fairly unusual amongst fish for being monogamous, mating exclusively with the same partner throughout their life, or until their partner dies. 'Greeting dances' are performed each morning by the pair to confirm and strengthen their bond (4). Unusually, it is the male, and not the female, that becomes pregnant in seahorses (7). Males have an incubation, or brood, pocket on the lower side of their tail, into which female lined seahorses spray between 250 and 650 eggs during courtship, depending on the size of the individual. Egg development within the brood pocket lasts around 20 to 21 days. After hatching, the embryos continue to be carried in the pouch until they are capable of fairly active swimming (4). Young look like miniature adult seahorses, are independent from birth, and receive no further parental care (7). Adult size is attained in eight to ten months (4). Seahorses are carnivorous species that are unable to move rapidly enough to chase their prey. Thus, they use their elongated snout to suck in small crustaceans, such as baby brine shrimp, and may feed for up to ten hours each day (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

With their upright position, prehensile tail, and horse-like head set at right angles to the body, seahorses are some of the most unusual looking of all fishes (4). Instead of having scales, as most other fish do, seahorses have a layer of skin stretched over a bony armour that is arranged into a series of rings (5) (6). Swimming is powered by the rapidly oscillating dorsal fin, and they steer using the fins on either side of the body (the pectoral fins) (5). The lined seahorse is a large seahorse with a deep chest (4) (6). Colouration varies from ash-grey, orange, brown, yellow and red to black, and brown individuals are usually paler on their front (5) (6). The body is often marked with a characteristic pattern of pearly white lines following the contour of the neck, for which the species is named, as well as tiny white dots on the tail and a darker or paler 'saddle' across the back (5) (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Biology

Generally in coastal waters; often around man-made structures (Ref. 26938). Usually attached to gorgonians or seagrasses but may occur in floating Sargassum or swimming freely in midwater (Ref. 9710). Those that live in Sargassum usually have bony protuberances and fleshy tabs that may serve as camouflage. Has been reared in captivity (Ref. 35420, 35422). Move into deeper waters during winter (Ref. 36630). Feeds by sucking in small organisms, using its long face as a pipette (Ref. 26938). Ovoviviparous (Ref. 205). The male carries the eggs in a brood pouch which is found under the tail (Ref. 205). Length type refers to Height (= from top of coronet to the tip of straightened tail).
  • Lourie, S.A., A.C.J. Vincent and H.J. Hall 1999 Seahorses: an identification guide to the world's species and their conservation. Project Seahorse, London. 214 p. (Ref. 30915)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The lined seahorse, Hippocampus erectus is a large deep-bodied seahorse (Lourie et al. 1999) with a variable body color. Individuals can be olive-brown, ash gray, orange, red, black or yellow (Lourie et al. 2004, Robins & Ray 1986). Many have white lines following the contour of the neck, contrasting saddles across the dorsal surface and tiny white dots on the tail. Some specimens, especially those living amongst brown Sargassum algae, bare fleshy tabs and protuberances that serve as camouflage (Robins & Ray 1986). The coronet on the top of the head forms a low, triangular wedge with sharp edges. The 1st, 3rd, 5th, 7th and 11th trunk rings may be raised and enlarged. Cheek spines may be single or double, and the snout is usually less than one-half the head length. One tail and two trunk rings support the dorsal fin. Fin rays and other meristic counts are as follows: trunk rings = 11; tail rings = 34-39; dorsal fin rays = 16-20; pectoral fin rays = 14-18 (Lourie et al. 2004).
  • Robins, CR & GC Ray. 1986. A field guide to Atlantic coast fishes of North America. Houghton Mifflin Co. New York. USA. 354 pp.
  • Powell, AB, Thayer, G, Lacroix, M & R Cheshire. 2007. Juvenile and small resident fishes of Florida Bay, a critical habitat in the Everglades National Park, Florida. NOAA Professional Paper NMFS 6: 105-108. National Marine Fisheries Service. Seattle, WA. USA.
  • Adams, C, Larkin, S & D Lee. 2001. Volume and value of marine ornamentals collected in Florida, 1990-1998. Aquar. Sci. Conserv. 3: 25-36.Azzarello, MY. 1991. Some questions concerning the Syngnathidae brood pouch. Bull. Mar. Sci. 49: 741-747.
  • Baum, JK, Meeuwig, JJ & ACJ Vincent. 2003. Bycatch of lined seahorses (Hippocampus erectus) in a Gulf of Mexico shrimp trawl fishery. Fish. Bull. 101: 721-731.
  • Bergert, BA & PC Wainwright. 1997. Morphology and kinematics of prey capture in the syngnathid fishes Hippocampus erectus and Syngnathus floridae. Mar. Biol. 127: 563-570.
  • Blasiola, GCJ. 1979. Glugea heraldi n. sp. (Microsporida, Glugeidae) from the seahorse Hippocampus erectus Perry. J. Fish Diseases. 2: 493-500.
  • Blazer, S & RE Wolke. 1979. An Exophiala-like fungus as the cause of a systemic mycosis of marine fish. J. Fish Diseases. 2: 145-152.
  • Branch, GM. 1966. Contributions to the functional morphology of fishes.The feeding mechanism of Syngnathus acus Linnaeus. Zoologica African. 2: 69-89.
  • Breder, CM, Jr. 1948. Field book of marine fishes of the Atlantic coast from Labrador of Texas. Putman, NY. USA. 332 pp.
  • Cheung, PJ, Nigrelli, RF & GD Ruggieri. 1980. Studies of the morphology of Uronema marinum Dujardin (Ciliatea: Uronematidae) with a description of the histopathology of the infection in marine fishes. J. Fish Diseases. 3: 295-303.
  • CITES. 2004. Seahorses and other members of the family Syngnathidae (decision 12.54) Report of the Working Group. AC20 Doc. 17. Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES). Twentieth meeting of the Animals Committee Johannesburg (South Africa). 29 March-2 April 2004.
  • Colson, DJ, Patek, SN, Brainerd, EL & SM Lewis. 1998. Sound production during feeding in Hippocampus seahorses (Syngnathidae). Env. Biol. Fish. 51: 221-229.
  • Correa, M, Chung, KS & R Manrique. 1989. Cultivo experimental del caballito de mar, Hippocampus erectus. Bol. Inst. Ocean. Venezuela Univ. Oriente. 28: 191-196.
  • Fish, MP. 1953. The production of underwater sound by the northern seahorse, Hippocampus hudsonius. Copeia. 1953: 98-99.
  • Fish, MP. 1954. The character and significance of sound production among fishes of the western North Atlantic. Bull. Bingham Oceanogr. Coll. 14: 1-109.
  • Fish, MP, Kelsey, AS, Jr. & WH Mowbray. 1952. Studies on the production of underwater sounds by North Atlantic coastal fishes. J. Mar. Res. 11: 180-193.
  • Fish, MP & WH Mowbray. 1970. Sounds of western North Atlantic fishes. Johns Hopkins Press. Baltimore, MD. USA. 207 pp.
  • Foster, SJ & ACJ Vincent. 2004. Life history and ecology of seahorses: implications for conservation and management. J. Fish Biol. 65: 1-61.
  • Foster, SJ, Marsden, AD & ACJ Vincent. 2003. Hippocampus erectus. IUCN 2004. 2004 IUCN Red List of Threatened Species.Gill, T. 1905. The life history of sea horses (hippocampids). Proc. US Nat. Mus. 28: 805-814.
  • Hardy, JD. 1978. Development of fishes of the Mid-Atlantic Bight: an atlas of egg, larval and juvenile stages - Volume II. Anguillidae through Syngnathidae. US Fish & Wildlife Service, Office of Biological Sciences. Washington, DC. USA.
  • Herald, ES & M Rakowicz. 1951. Stable requirements for raising sea horses. Aquarium J. 22: 234-242.
  • IUCN (International Union for Conservation of Nature and Natural Resources). 2002. 2002 IUCN red list of threatened species. IUCN, Gland, Switzerland & Cambridge, UK. (www.redlist.org).
  • James, PL & KL Heck, Jr. 1994. The effects of habitat complexity and light intensity on ambush predation within a simulated seagrass habitat. J. Exp. Mar. Biol. Ecol. 176: 187-200.
  • James, P & C Woods. 2001. Rearing seahorses: does temperature matter? Aquac. Update. 28: 9-10.
  • Job, SD, Do, HH, Meeuwig, JJ & HJ Hall. 2002. Culturing the oceanic seahorse, Hippocampus kuda. Aquaculture. 214: 333-341.
  • Jones, SE. 2007. Variations in feeding kinematics of western Atlantic seahorses. Master's Thesis. Florida Institute of Technology. Melbourne, FL. USA. 140 pp.
  • Kvarnemo, C, Moore, GL, Jones, AG, Nelson, WS & JC Avise. 2000. Monogamous pair bonds and mate switching in the western Australian seahorse Hippocampus subelongatus. J. Evol. Biol. 13: 882-888.
  • Larkin, SL & RL Degner. 2001. The US wholesale market for marine ornamentals. Aquar. Sci. Conserv. 3: 13-24.
  • Lin, Q, Lin, J & D Zhang. 2008. Breeding and juvenile culture of the lined seahorse, Hippocampus erectus Perry, 1810. Aquaculture. 277: 287-292.
  • Lauder, GV. 1985. Aquatic feeding in lower vertebrates. 210-229. In: Hildebrand, M, Bramble, DM, Liem, KF & DB Wake, eds. Functional vertebrate morphology. Harvard University Press. Cambridge.
  • Lin, Q, Lu, JY & YL Gao. 2006. The effect of temperature on gonad, embryonic development and survival rate of juvenile seahorses, Hippocampus kuda Bleeker. Aquaculture. 254: 701-713.
  • Lin, Q, Gao, YL, Sheng, JQ, Chen, QX, Zhang, B & JY Lu. 2007. The effect of food and the sum of effective temperature on the embryonic development of the seahorse, Hippocampus kuda Bleeker. Aquaculture. 262: 481-492.
  • Linton, JR & BL Soloff. 1964. The physiology of the brood pouch of the male sea horse Hippocampus erectus. Bull. Mar. Sci. Gulf Carib. 14: 45-61.
  • Lockyear, J, Kaiser, H, & T Hecht. 1997. Studies on the captive breeding of the Knysna seahorse, Hippocampus capensis. Aquat. Sci. Conserv. 1: 129-136.
  • Lourie, SA, Foster, SJ, Cooper, EWT & ACJ Vincent. 2004. A guide to the identification of seahorses. Project Seahorse & TRAFFIC North America. University of British Columbia and World Wildlife Fund. Washington, DC. USA.
  • Lourie, SA, Vincent, AC & HJ Hall. 1999. Seahorse: An identification guide to the world's species and their conservation. Project Seahorse. London, UK.
  • Lu, JY, Wu, JY & DW Yang. 2001. Growth rate of Hippocampus kuda Bleeker under intensive culture. J. Fish. China. 26: 61-66.
  • Martinez, A, Gardner, T & D Littlehale. 2005. Lined seahorse, Hippocampus erectus. In: Koldewey, H, ed. Syngnathid husbandry in public aquariums. Project Seahorse and Zoological Society of London. Vancouver, BC. Canada.
  • Matlock, GC. 1992. Life history aspects of seahorses, Hippocampus, in Texas. Texas J. Sci. 44: 213-222.
  • Monteiro-Neto, C, de Andrade Cunha, FE, Nottingham, MC, Araújo, ME, Rosa, IL & GML Barros. 2003. Analysis of the marine ornamental fish trade at Ceará State, northeast Brazil. Biodiv. Conserv. 12: 1287-1295.
  • Muller, M. 1987. Optimization principles applied to the mechanism of neurocranium elevation and mouth bottom depression in bony fishes (Halecostomi). J. Theor. Biol. 126: 343-368.
  • Muller, M & JWM Osse. 1984. Hydrodynamics of suction feeding in fish. Trans. Zool. Soc. Lond. 37: 51-135.
  • Murdy, EO, Birdsong, RS & JA Musik. 1997. Fishes of Chesapeake Bay. Smithsonian Institution Press. Washington, DC. USA. 324 pp.
  • Osse, JWM & M Muller. 1980. A model of suction feeding in teleostean fishes with some implications for ventilation. In: Ali, MA, ed. Environmental physiology of fishes. NATO-ASI Series A. Life Sciences. Plenum Publishing. New York, NY. USA. 335-352.
  • Perante, NC, Pajaro, MG, Meeuwig, JJ & ACJ Vincent. 2002. Biology of Hippocampus comes in the central Philippines. J. Fish Biol. 60: 821-837.
  • Reid, GK, Jr. 1954. An ecological study of the Gulf of Mexico fishes in the vicinity of Cedar Key, Florida. Bull. Mar. Sci. 4: 1-94.
  • Scarratt, AM. 1995. Techniques for raising lined seahorses (Hippocampus erectus). Aquar. Front. 3: 24-29.
  • Sheng, JQ, Lin, Q, Chen, QX, Gao, YL, Shen, L & JY Lu. 2006. Effects of food, temperature and light intensity on the feeding behavior of three-spot juveniles, Hippocampus trimaculatus Leach. Aquaculture. 256: 596-607.
  • Sogard, SM, Powell, GVN & JG Holmquist. 1987. Epibenthic fish communities of Florida Bay banks: relations with physical parameters and seagrass cover. Mar. Ecol. Prog. Ser. 40: 25-39.
  • Strawn, K. 1958. Life history of the pigmy seahorse, Hippocampus zostrae Jordan and Gilbert, at Cedar Key, Florida. Copeia 1: 16-22.
  • Teixeira, RL & JA Musik. 2000. Reproduction and food habits of the lined seahorse, Hippocampus erectus (Teleostei: Syngnathidae) of Chesapeake Bay, Virginia. Rev. Bras. Biol. 61: 79-90.
  • Urick, RJ. 1983. Principles of underwater sound, 3rd edition. McGraw Hill. New York, NY. USA. 423 pp.
  • Vari, RP. 1982. Fishes of the western North Atlantic, subfamily Hippocampus campinae. The seahorses. 173-189. Sears Foundation for Marine Research Memoir 1. Yale Univ. New Haven, CT. USA.
  • Vincent, ACJ. 1990. Reproductive ecology of seahorses. PhD Dissertation. Cambridge University, UK.Vincent, ACJ. 1995. A role for daily greetings in maintaining seahorse pair bonds. Anim. Behav. 49: 258-260.
  • Vincent, ACJ. 1996. The international trade in seahorses. TRAFFIC International. Cambridge, UK. 164 pp.Vincent, ACJ & RS Clifton-Hadley. 1989. Parasitic infection of the seahorse (Hippocampus erectus) - A case report. J. Wildlife. Diseases. 25: 404-406.
  • Vincent, ACJ, Evans, KL & AD Marsden. 2003. Home range behavior of the monogamous Australian seahorse, Hippocampus whitei. Env. Biol. Fishes. 72: 1-12.
  • Vincent, ACJ & LM Sadler. 1995. Faithful pair bonds in wild seahorses, Hippocampus whitei. Anim. Behav. 50: 1557-1569.
  • Wong, JM & JAH Benzie. 2003. The effects of temperature, Artemia enrichment, stocking density and light on the growth of juvenile seahorses, Hippocampus whitei (Bleeker, 1855), from Australia. Aquaculture. 228: 107-121.
  • Woods, CMC. 2003a. Growth and survival of juvenile seahorse Hippocampus abdominalis reared on live, frozen and artificial foods. Aquaculture. 220: 287-298.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Hippocampus erectus is found from Cape Cod (and rarely Nova Scotia), Canada to Argentina and into the Gulf of Mexico. (Aquatic Bookshop)

Biogeographic Regions: atlantic ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Hippocampus erectus occurs from the southern tip of Nova Scotia in Canada, along the east coast of the USA, and south to Mexico, the Caribbean, and Venezuela. Small specimens from Brazil appear to be genetically distinct from the north Atlantic specimens and may prove to be a separate species (S. Casey, in litt. in Lourie et al. 1999). Further research is needed.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Nova Scotia (rare), southward to Bermuda, the Bahamas, shores of the Gulf of Mexico, Cuba, Haiti, Lesser Antilles, Caribbean coast of Panama, and Columbia, and the Atlantic coast of South America to Uruguay.
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Southwestern Atlantic: Brazil.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic: Nova Scotia, Canada and northern Gulf of Mexico to Panama and Venezuela. A southern form that may prove to be a separate species is known from Rio de Janeiro, Brazil and questionably from Suriname. International trade is monitored through a licensing system (CITES II, since 5.15.04) and a minimum size of 10 cm applies.
  • Lourie, S.A., A.C.J. Vincent and H.J. Hall 1999 Seahorses: an identification guide to the world's species and their conservation. Project Seahorse, London. 214 p. (Ref. 30915)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The lined seahorse is distributed throughout the India River Lagoon in nearly every sheltered habitat. However, most populations are found in seagrass beds.
  • Robins, CR & GC Ray. 1986. A field guide to Atlantic coast fishes of North America. Houghton Mifflin Co. New York. USA. 354 pp.
  • Powell, AB, Thayer, G, Lacroix, M & R Cheshire. 2007. Juvenile and small resident fishes of Florida Bay, a critical habitat in the Everglades National Park, Florida. NOAA Professional Paper NMFS 6: 105-108. National Marine Fisheries Service. Seattle, WA. USA.
  • Adams, C, Larkin, S & D Lee. 2001. Volume and value of marine ornamentals collected in Florida, 1990-1998. Aquar. Sci. Conserv. 3: 25-36.Azzarello, MY. 1991. Some questions concerning the Syngnathidae brood pouch. Bull. Mar. Sci. 49: 741-747.
  • Baum, JK, Meeuwig, JJ & ACJ Vincent. 2003. Bycatch of lined seahorses (Hippocampus erectus) in a Gulf of Mexico shrimp trawl fishery. Fish. Bull. 101: 721-731.
  • Bergert, BA & PC Wainwright. 1997. Morphology and kinematics of prey capture in the syngnathid fishes Hippocampus erectus and Syngnathus floridae. Mar. Biol. 127: 563-570.
  • Blasiola, GCJ. 1979. Glugea heraldi n. sp. (Microsporida, Glugeidae) from the seahorse Hippocampus erectus Perry. J. Fish Diseases. 2: 493-500.
  • Blazer, S & RE Wolke. 1979. An Exophiala-like fungus as the cause of a systemic mycosis of marine fish. J. Fish Diseases. 2: 145-152.
  • Branch, GM. 1966. Contributions to the functional morphology of fishes.The feeding mechanism of Syngnathus acus Linnaeus. Zoologica African. 2: 69-89.
  • Breder, CM, Jr. 1948. Field book of marine fishes of the Atlantic coast from Labrador of Texas. Putman, NY. USA. 332 pp.
  • Cheung, PJ, Nigrelli, RF & GD Ruggieri. 1980. Studies of the morphology of Uronema marinum Dujardin (Ciliatea: Uronematidae) with a description of the histopathology of the infection in marine fishes. J. Fish Diseases. 3: 295-303.
  • CITES. 2004. Seahorses and other members of the family Syngnathidae (decision 12.54) Report of the Working Group. AC20 Doc. 17. Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES). Twentieth meeting of the Animals Committee Johannesburg (South Africa). 29 March-2 April 2004.
  • Colson, DJ, Patek, SN, Brainerd, EL & SM Lewis. 1998. Sound production during feeding in Hippocampus seahorses (Syngnathidae). Env. Biol. Fish. 51: 221-229.
  • Correa, M, Chung, KS & R Manrique. 1989. Cultivo experimental del caballito de mar, Hippocampus erectus. Bol. Inst. Ocean. Venezuela Univ. Oriente. 28: 191-196.
  • Fish, MP. 1953. The production of underwater sound by the northern seahorse, Hippocampus hudsonius. Copeia. 1953: 98-99.
  • Fish, MP. 1954. The character and significance of sound production among fishes of the western North Atlantic. Bull. Bingham Oceanogr. Coll. 14: 1-109.
  • Fish, MP, Kelsey, AS, Jr. & WH Mowbray. 1952. Studies on the production of underwater sounds by North Atlantic coastal fishes. J. Mar. Res. 11: 180-193.
  • Fish, MP & WH Mowbray. 1970. Sounds of western North Atlantic fishes. Johns Hopkins Press. Baltimore, MD. USA. 207 pp.
  • Foster, SJ & ACJ Vincent. 2004. Life history and ecology of seahorses: implications for conservation and management. J. Fish Biol. 65: 1-61.
  • Foster, SJ, Marsden, AD & ACJ Vincent. 2003. Hippocampus erectus. IUCN 2004. 2004 IUCN Red List of Threatened Species.Gill, T. 1905. The life history of sea horses (hippocampids). Proc. US Nat. Mus. 28: 805-814.
  • Hardy, JD. 1978. Development of fishes of the Mid-Atlantic Bight: an atlas of egg, larval and juvenile stages - Volume II. Anguillidae through Syngnathidae. US Fish & Wildlife Service, Office of Biological Sciences. Washington, DC. USA.
  • Herald, ES & M Rakowicz. 1951. Stable requirements for raising sea horses. Aquarium J. 22: 234-242.
  • IUCN (International Union for Conservation of Nature and Natural Resources). 2002. 2002 IUCN red list of threatened species. IUCN, Gland, Switzerland & Cambridge, UK. (www.redlist.org).
  • James, PL & KL Heck, Jr. 1994. The effects of habitat complexity and light intensity on ambush predation within a simulated seagrass habitat. J. Exp. Mar. Biol. Ecol. 176: 187-200.
  • James, P & C Woods. 2001. Rearing seahorses: does temperature matter? Aquac. Update. 28: 9-10.
  • Job, SD, Do, HH, Meeuwig, JJ & HJ Hall. 2002. Culturing the oceanic seahorse, Hippocampus kuda. Aquaculture. 214: 333-341.
  • Jones, SE. 2007. Variations in feeding kinematics of western Atlantic seahorses. Master's Thesis. Florida Institute of Technology. Melbourne, FL. USA. 140 pp.
  • Kvarnemo, C, Moore, GL, Jones, AG, Nelson, WS & JC Avise. 2000. Monogamous pair bonds and mate switching in the western Australian seahorse Hippocampus subelongatus. J. Evol. Biol. 13: 882-888.
  • Larkin, SL & RL Degner. 2001. The US wholesale market for marine ornamentals. Aquar. Sci. Conserv. 3: 13-24.
  • Lin, Q, Lin, J & D Zhang. 2008. Breeding and juvenile culture of the lined seahorse, Hippocampus erectus Perry, 1810. Aquaculture. 277: 287-292.
  • Lauder, GV. 1985. Aquatic feeding in lower vertebrates. 210-229. In: Hildebrand, M, Bramble, DM, Liem, KF & DB Wake, eds. Functional vertebrate morphology. Harvard University Press. Cambridge.
  • Lin, Q, Lu, JY & YL Gao. 2006. The effect of temperature on gonad, embryonic development and survival rate of juvenile seahorses, Hippocampus kuda Bleeker. Aquaculture. 254: 701-713.
  • Lin, Q, Gao, YL, Sheng, JQ, Chen, QX, Zhang, B & JY Lu. 2007. The effect of food and the sum of effective temperature on the embryonic development of the seahorse, Hippocampus kuda Bleeker. Aquaculture. 262: 481-492.
  • Linton, JR & BL Soloff. 1964. The physiology of the brood pouch of the male sea horse Hippocampus erectus. Bull. Mar. Sci. Gulf Carib. 14: 45-61.
  • Lockyear, J, Kaiser, H, & T Hecht. 1997. Studies on the captive breeding of the Knysna seahorse, Hippocampus capensis. Aquat. Sci. Conserv. 1: 129-136.
  • Lourie, SA, Foster, SJ, Cooper, EWT & ACJ Vincent. 2004. A guide to the identification of seahorses. Project Seahorse & TRAFFIC North America. University of British Columbia and World Wildlife Fund. Washington, DC. USA.
  • Lourie, SA, Vincent, AC & HJ Hall. 1999. Seahorse: An identification guide to the world's species and their conservation. Project Seahorse. London, UK.
  • Lu, JY, Wu, JY & DW Yang. 2001. Growth rate of Hippocampus kuda Bleeker under intensive culture. J. Fish. China. 26: 61-66.
  • Martinez, A, Gardner, T & D Littlehale. 2005. Lined seahorse, Hippocampus erectus. In: Koldewey, H, ed. Syngnathid husbandry in public aquariums. Project Seahorse and Zoological Society of London. Vancouver, BC. Canada.
  • Matlock, GC. 1992. Life history aspects of seahorses, Hippocampus, in Texas. Texas J. Sci. 44: 213-222.
  • Monteiro-Neto, C, de Andrade Cunha, FE, Nottingham, MC, Araújo, ME, Rosa, IL & GML Barros. 2003. Analysis of the marine ornamental fish trade at Ceará State, northeast Brazil. Biodiv. Conserv. 12: 1287-1295.
  • Muller, M. 1987. Optimization principles applied to the mechanism of neurocranium elevation and mouth bottom depression in bony fishes (Halecostomi). J. Theor. Biol. 126: 343-368.
  • Muller, M & JWM Osse. 1984. Hydrodynamics of suction feeding in fish. Trans. Zool. Soc. Lond. 37: 51-135.
  • Murdy, EO, Birdsong, RS & JA Musik. 1997. Fishes of Chesapeake Bay. Smithsonian Institution Press. Washington, DC. USA. 324 pp.
  • Osse, JWM & M Muller. 1980. A model of suction feeding in teleostean fishes with some implications for ventilation. In: Ali, MA, ed. Environmental physiology of fishes. NATO-ASI Series A. Life Sciences. Plenum Publishing. New York, NY. USA. 335-352.
  • Perante, NC, Pajaro, MG, Meeuwig, JJ & ACJ Vincent. 2002. Biology of Hippocampus comes in the central Philippines. J. Fish Biol. 60: 821-837.
  • Reid, GK, Jr. 1954. An ecological study of the Gulf of Mexico fishes in the vicinity of Cedar Key, Florida. Bull. Mar. Sci. 4: 1-94.
  • Scarratt, AM. 1995. Techniques for raising lined seahorses (Hippocampus erectus). Aquar. Front. 3: 24-29.
  • Sheng, JQ, Lin, Q, Chen, QX, Gao, YL, Shen, L & JY Lu. 2006. Effects of food, temperature and light intensity on the feeding behavior of three-spot juveniles, Hippocampus trimaculatus Leach. Aquaculture. 256: 596-607.
  • Sogard, SM, Powell, GVN & JG Holmquist. 1987. Epibenthic fish communities of Florida Bay banks: relations with physical parameters and seagrass cover. Mar. Ecol. Prog. Ser. 40: 25-39.
  • Strawn, K. 1958. Life history of the pigmy seahorse, Hippocampus zostrae Jordan and Gilbert, at Cedar Key, Florida. Copeia 1: 16-22.
  • Teixeira, RL & JA Musik. 2000. Reproduction and food habits of the lined seahorse, Hippocampus erectus (Teleostei: Syngnathidae) of Chesapeake Bay, Virginia. Rev. Bras. Biol. 61: 79-90.
  • Urick, RJ. 1983. Principles of underwater sound, 3rd edition. McGraw Hill. New York, NY. USA. 423 pp.
  • Vari, RP. 1982. Fishes of the western North Atlantic, subfamily Hippocampus campinae. The seahorses. 173-189. Sears Foundation for Marine Research Memoir 1. Yale Univ. New Haven, CT. USA.
  • Vincent, ACJ. 1990. Reproductive ecology of seahorses. PhD Dissertation. Cambridge University, UK.Vincent, ACJ. 1995. A role for daily greetings in maintaining seahorse pair bonds. Anim. Behav. 49: 258-260.
  • Vincent, ACJ. 1996. The international trade in seahorses. TRAFFIC International. Cambridge, UK. 164 pp.Vincent, ACJ & RS Clifton-Hadley. 1989. Parasitic infection of the seahorse (Hippocampus erectus) - A case report. J. Wildlife. Diseases. 25: 404-406.
  • Vincent, ACJ, Evans, KL & AD Marsden. 2003. Home range behavior of the monogamous Australian seahorse, Hippocampus whitei. Env. Biol. Fishes. 72: 1-12.
  • Vincent, ACJ & LM Sadler. 1995. Faithful pair bonds in wild seahorses, Hippocampus whitei. Anim. Behav. 50: 1557-1569.
  • Wong, JM & JAH Benzie. 2003. The effects of temperature, Artemia enrichment, stocking density and light on the growth of juvenile seahorses, Hippocampus whitei (Bleeker, 1855), from Australia. Aquaculture. 228: 107-121.
  • Woods, CMC. 2003a. Growth and survival of juvenile seahorse Hippocampus abdominalis reared on live, frozen and artificial foods. Aquaculture. 220: 287-298.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic: Nova Scotia, Canada and northern Gulf of Mexico to Panama and Venezuela. A southern form is known from Rio de Janeiro, Brazil.
  • Bigelow, H.B. and Schroeder, W.C., 1953; Lieske, E. and R. Myers, 1994; Lourie, S.A., A.C.J. Vincent and H.J. Hall, 1999; Moe, A.M. Jr., 1992; Schumann, B., 1969; Smith, C.L., 1997; Wicklund, R.I., S.J. Wilk and L. Ogren, 1969.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

The lined seahorse occurs in the Western Atlantic from the southern tip of Nova Scotia in Canada, along the east coast of the USA, and south to the Gulf of Mexico, the Caribbean and Venezuela (1) (2). Additionally, a southern form that appears to be genetically distinct from the north Atlantic specimens and may prove to be a separate species is known from Rio de Janeiro, Brazil, and possibly Suriname (1) (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

The seahorse, including several species in the genus Hippocampus, is one of the most unusual in appearance of all fishes. Its upright position, horse-like head set at right angles to the body, and jointed armor make it resemble a knight in a chess set. The seahorse has a prehensile tail, which it uses to hold onto seaweed and coral. The scales have been replaced by rings of about 50 rectangular bony plates, encasing the body in a semi-rigid skeleton. The eyes can swivel independently or converge to achieve binocular vision. The most distinguishing feature between the male and the female seahorse is the kangaroo-like pouch that the male has on its ventral side, used for reproduction. (Grolier, 1996)

Hippocampus erectus is a large species of seahorse, growing up to 5 inches long. H. erectus is easily separated from other species of seahorse by a pattern of dark lines on a lighter background in its coloring. H. erectus also has 18 to 21 dorsal-fin rays. (Bohlke and Chaplin, 1968, pg. 183)

Other Physical Features: bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Dorsal spines (total): 0; Dorsal soft rays (total): 1620
  • Lourie, S.A., A.C.J. Vincent and H.J. Hall 1999 Seahorses: an identification guide to the world's species and their conservation. Project Seahorse, London. 214 p. (Ref. 30915)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 203 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

19.0 cm OT (male/unsexed; (Ref. 30915)); max. reported age: 1 years (Ref. 1285)
  • Lourie, S.A., A.C.J. Vincent and H.J. Hall 1999 Seahorses: an identification guide to the world's species and their conservation. Project Seahorse, London. 214 p. (Ref. 30915)
  • Herald, R. and M. Rakowicz 1951 Stable requirements for raising sea horses. Aquarium J. 22:234-242. (Ref. 1285)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The maximum age of H. erectus is unknown, but the average lifespan is only about four years (Lourie et al. 1999). The maximum reported size is 19 cm (Lourie et al. 1999), although most specimens are smaller (Robins & Ray 1986). In captivity, H. erectus maintained a linear growth of 0.55 mm per day for a period of 100 days (Scarratt 1996). Specimens larger than 20 mm have been reported to grow an average of 0.11 mm per day (Matlock 1992).
  • Robins, CR & GC Ray. 1986. A field guide to Atlantic coast fishes of North America. Houghton Mifflin Co. New York. USA. 354 pp.
  • Powell, AB, Thayer, G, Lacroix, M & R Cheshire. 2007. Juvenile and small resident fishes of Florida Bay, a critical habitat in the Everglades National Park, Florida. NOAA Professional Paper NMFS 6: 105-108. National Marine Fisheries Service. Seattle, WA. USA.
  • Adams, C, Larkin, S & D Lee. 2001. Volume and value of marine ornamentals collected in Florida, 1990-1998. Aquar. Sci. Conserv. 3: 25-36.Azzarello, MY. 1991. Some questions concerning the Syngnathidae brood pouch. Bull. Mar. Sci. 49: 741-747.
  • Baum, JK, Meeuwig, JJ & ACJ Vincent. 2003. Bycatch of lined seahorses (Hippocampus erectus) in a Gulf of Mexico shrimp trawl fishery. Fish. Bull. 101: 721-731.
  • Bergert, BA & PC Wainwright. 1997. Morphology and kinematics of prey capture in the syngnathid fishes Hippocampus erectus and Syngnathus floridae. Mar. Biol. 127: 563-570.
  • Blasiola, GCJ. 1979. Glugea heraldi n. sp. (Microsporida, Glugeidae) from the seahorse Hippocampus erectus Perry. J. Fish Diseases. 2: 493-500.
  • Blazer, S & RE Wolke. 1979. An Exophiala-like fungus as the cause of a systemic mycosis of marine fish. J. Fish Diseases. 2: 145-152.
  • Branch, GM. 1966. Contributions to the functional morphology of fishes.The feeding mechanism of Syngnathus acus Linnaeus. Zoologica African. 2: 69-89.
  • Breder, CM, Jr. 1948. Field book of marine fishes of the Atlantic coast from Labrador of Texas. Putman, NY. USA. 332 pp.
  • Cheung, PJ, Nigrelli, RF & GD Ruggieri. 1980. Studies of the morphology of Uronema marinum Dujardin (Ciliatea: Uronematidae) with a description of the histopathology of the infection in marine fishes. J. Fish Diseases. 3: 295-303.
  • CITES. 2004. Seahorses and other members of the family Syngnathidae (decision 12.54) Report of the Working Group. AC20 Doc. 17. Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES). Twentieth meeting of the Animals Committee Johannesburg (South Africa). 29 March-2 April 2004.
  • Colson, DJ, Patek, SN, Brainerd, EL & SM Lewis. 1998. Sound production during feeding in Hippocampus seahorses (Syngnathidae). Env. Biol. Fish. 51: 221-229.
  • Correa, M, Chung, KS & R Manrique. 1989. Cultivo experimental del caballito de mar, Hippocampus erectus. Bol. Inst. Ocean. Venezuela Univ. Oriente. 28: 191-196.
  • Fish, MP. 1953. The production of underwater sound by the northern seahorse, Hippocampus hudsonius. Copeia. 1953: 98-99.
  • Fish, MP. 1954. The character and significance of sound production among fishes of the western North Atlantic. Bull. Bingham Oceanogr. Coll. 14: 1-109.
  • Fish, MP, Kelsey, AS, Jr. & WH Mowbray. 1952. Studies on the production of underwater sounds by North Atlantic coastal fishes. J. Mar. Res. 11: 180-193.
  • Fish, MP & WH Mowbray. 1970. Sounds of western North Atlantic fishes. Johns Hopkins Press. Baltimore, MD. USA. 207 pp.
  • Foster, SJ & ACJ Vincent. 2004. Life history and ecology of seahorses: implications for conservation and management. J. Fish Biol. 65: 1-61.
  • Foster, SJ, Marsden, AD & ACJ Vincent. 2003. Hippocampus erectus. IUCN 2004. 2004 IUCN Red List of Threatened Species.Gill, T. 1905. The life history of sea horses (hippocampids). Proc. US Nat. Mus. 28: 805-814.
  • Hardy, JD. 1978. Development of fishes of the Mid-Atlantic Bight: an atlas of egg, larval and juvenile stages - Volume II. Anguillidae through Syngnathidae. US Fish & Wildlife Service, Office of Biological Sciences. Washington, DC. USA.
  • Herald, ES & M Rakowicz. 1951. Stable requirements for raising sea horses. Aquarium J. 22: 234-242.
  • IUCN (International Union for Conservation of Nature and Natural Resources). 2002. 2002 IUCN red list of threatened species. IUCN, Gland, Switzerland & Cambridge, UK. (www.redlist.org).
  • James, PL & KL Heck, Jr. 1994. The effects of habitat complexity and light intensity on ambush predation within a simulated seagrass habitat. J. Exp. Mar. Biol. Ecol. 176: 187-200.
  • James, P & C Woods. 2001. Rearing seahorses: does temperature matter? Aquac. Update. 28: 9-10.
  • Job, SD, Do, HH, Meeuwig, JJ & HJ Hall. 2002. Culturing the oceanic seahorse, Hippocampus kuda. Aquaculture. 214: 333-341.
  • Jones, SE. 2007. Variations in feeding kinematics of western Atlantic seahorses. Master's Thesis. Florida Institute of Technology. Melbourne, FL. USA. 140 pp.
  • Kvarnemo, C, Moore, GL, Jones, AG, Nelson, WS & JC Avise. 2000. Monogamous pair bonds and mate switching in the western Australian seahorse Hippocampus subelongatus. J. Evol. Biol. 13: 882-888.
  • Larkin, SL & RL Degner. 2001. The US wholesale market for marine ornamentals. Aquar. Sci. Conserv. 3: 13-24.
  • Lin, Q, Lin, J & D Zhang. 2008. Breeding and juvenile culture of the lined seahorse, Hippocampus erectus Perry, 1810. Aquaculture. 277: 287-292.
  • Lauder, GV. 1985. Aquatic feeding in lower vertebrates. 210-229. In: Hildebrand, M, Bramble, DM, Liem, KF & DB Wake, eds. Functional vertebrate morphology. Harvard University Press. Cambridge.
  • Lin, Q, Lu, JY & YL Gao. 2006. The effect of temperature on gonad, embryonic development and survival rate of juvenile seahorses, Hippocampus kuda Bleeker. Aquaculture. 254: 701-713.
  • Lin, Q, Gao, YL, Sheng, JQ, Chen, QX, Zhang, B & JY Lu. 2007. The effect of food and the sum of effective temperature on the embryonic development of the seahorse, Hippocampus kuda Bleeker. Aquaculture. 262: 481-492.
  • Linton, JR & BL Soloff. 1964. The physiology of the brood pouch of the male sea horse Hippocampus erectus. Bull. Mar. Sci. Gulf Carib. 14: 45-61.
  • Lockyear, J, Kaiser, H, & T Hecht. 1997. Studies on the captive breeding of the Knysna seahorse, Hippocampus capensis. Aquat. Sci. Conserv. 1: 129-136.
  • Lourie, SA, Foster, SJ, Cooper, EWT & ACJ Vincent. 2004. A guide to the identification of seahorses. Project Seahorse & TRAFFIC North America. University of British Columbia and World Wildlife Fund. Washington, DC. USA.
  • Lourie, SA, Vincent, AC & HJ Hall. 1999. Seahorse: An identification guide to the world's species and their conservation. Project Seahorse. London, UK.
  • Lu, JY, Wu, JY & DW Yang. 2001. Growth rate of Hippocampus kuda Bleeker under intensive culture. J. Fish. China. 26: 61-66.
  • Martinez, A, Gardner, T & D Littlehale. 2005. Lined seahorse, Hippocampus erectus. In: Koldewey, H, ed. Syngnathid husbandry in public aquariums. Project Seahorse and Zoological Society of London. Vancouver, BC. Canada.
  • Matlock, GC. 1992. Life history aspects of seahorses, Hippocampus, in Texas. Texas J. Sci. 44: 213-222.
  • Monteiro-Neto, C, de Andrade Cunha, FE, Nottingham, MC, Araújo, ME, Rosa, IL & GML Barros. 2003. Analysis of the marine ornamental fish trade at Ceará State, northeast Brazil. Biodiv. Conserv. 12: 1287-1295.
  • Muller, M. 1987. Optimization principles applied to the mechanism of neurocranium elevation and mouth bottom depression in bony fishes (Halecostomi). J. Theor. Biol. 126: 343-368.
  • Muller, M & JWM Osse. 1984. Hydrodynamics of suction feeding in fish. Trans. Zool. Soc. Lond. 37: 51-135.
  • Murdy, EO, Birdsong, RS & JA Musik. 1997. Fishes of Chesapeake Bay. Smithsonian Institution Press. Washington, DC. USA. 324 pp.
  • Osse, JWM & M Muller. 1980. A model of suction feeding in teleostean fishes with some implications for ventilation. In: Ali, MA, ed. Environmental physiology of fishes. NATO-ASI Series A. Life Sciences. Plenum Publishing. New York, NY. USA. 335-352.
  • Perante, NC, Pajaro, MG, Meeuwig, JJ & ACJ Vincent. 2002. Biology of Hippocampus comes in the central Philippines. J. Fish Biol. 60: 821-837.
  • Reid, GK, Jr. 1954. An ecological study of the Gulf of Mexico fishes in the vicinity of Cedar Key, Florida. Bull. Mar. Sci. 4: 1-94.
  • Scarratt, AM. 1995. Techniques for raising lined seahorses (Hippocampus erectus). Aquar. Front. 3: 24-29.
  • Sheng, JQ, Lin, Q, Chen, QX, Gao, YL, Shen, L & JY Lu. 2006. Effects of food, temperature and light intensity on the feeding behavior of three-spot juveniles, Hippocampus trimaculatus Leach. Aquaculture. 256: 596-607.
  • Sogard, SM, Powell, GVN & JG Holmquist. 1987. Epibenthic fish communities of Florida Bay banks: relations with physical parameters and seagrass cover. Mar. Ecol. Prog. Ser. 40: 25-39.
  • Strawn, K. 1958. Life history of the pigmy seahorse, Hippocampus zostrae Jordan and Gilbert, at Cedar Key, Florida. Copeia 1: 16-22.
  • Teixeira, RL & JA Musik. 2000. Reproduction and food habits of the lined seahorse, Hippocampus erectus (Teleostei: Syngnathidae) of Chesapeake Bay, Virginia. Rev. Bras. Biol. 61: 79-90.
  • Urick, RJ. 1983. Principles of underwater sound, 3rd edition. McGraw Hill. New York, NY. USA. 423 pp.
  • Vari, RP. 1982. Fishes of the western North Atlantic, subfamily Hippocampus campinae. The seahorses. 173-189. Sears Foundation for Marine Research Memoir 1. Yale Univ. New Haven, CT. USA.
  • Vincent, ACJ. 1990. Reproductive ecology of seahorses. PhD Dissertation. Cambridge University, UK.Vincent, ACJ. 1995. A role for daily greetings in maintaining seahorse pair bonds. Anim. Behav. 49: 258-260.
  • Vincent, ACJ. 1996. The international trade in seahorses. TRAFFIC International. Cambridge, UK. 164 pp.Vincent, ACJ & RS Clifton-Hadley. 1989. Parasitic infection of the seahorse (Hippocampus erectus) - A case report. J. Wildlife. Diseases. 25: 404-406.
  • Vincent, ACJ, Evans, KL & AD Marsden. 2003. Home range behavior of the monogamous Australian seahorse, Hippocampus whitei. Env. Biol. Fishes. 72: 1-12.
  • Vincent, ACJ & LM Sadler. 1995. Faithful pair bonds in wild seahorses, Hippocampus whitei. Anim. Behav. 50: 1557-1569.
  • Wong, JM & JAH Benzie. 2003. The effects of temperature, Artemia enrichment, stocking density and light on the growth of juvenile seahorses, Hippocampus whitei (Bleeker, 1855), from Australia. Aquaculture. 228: 107-121.
  • Woods, CMC. 2003a. Growth and survival of juvenile seahorse Hippocampus abdominalis reared on live, frozen and artificial foods. Aquaculture. 220: 287-298.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

to 20.3 cm TL (male/unsexed); 18.5 cm OT (female).
  • Bigelow, H.B. and Schroeder, W.C., 1953; Lieske, E. and R. Myers, 1994; Lourie, S.A., A.C.J. Vincent and H.J. Hall, 1999; Moe, A.M. Jr., 1992; Schumann, B., 1969; Smith, C.L., 1997; Wicklund, R.I., S.J. Wilk and L. Ogren, 1969.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description: (based on 51 specimens): Adult height: 5.5-18.5cm. Rings: 11 + 36 (34-39). Snout length: 2.6 (2.2-3.2) in head length. Dorsal fin rays: 18-19 (16-20) covering 2+1 rings. Pectoral fin rays: 15-16 (14-18). Coronet: variable, low, triangular wedge, or ridge-like or raised with sharp edges, or with relatively sharp spines. Spines: variable from none, to well-developed with blunt or sharp tips. Other distinctive characters: usually first, third, fifth, seventh and eleventh trunk rings enlarged (in most other species it is the first, fourth, seventh and eleventh); snout usually less than half head length; deep-bodied; cheek spine single or double. Color pattern: base color variable – ash grey, orange, brown, yellow, red or black; brown individuals tend to be paler on ventral side; often with a characteristic pattern of white lines following contour of neck; tiny white dots on tail; may have darker or paler ‘saddles’ across dorsal surface often in line with the more enlarged body rings.
  • Lourie, S.A., A.C.J. Vincent and H.J. Hall 1999 Seahorses: an identification guide to the world's species and their conservation. Project Seahorse, London. 214 p. (Ref. 30915)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Hippocampus erectus
Catalog Number: USNM 30876
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Photograph
Collector(s): D. Jordan & S. Stearns
Year Collected: 1882
Locality: Pensacola, Escambia County, Florida, United States, Gulf of Mexico, Atlantic
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Look Alikes

Two additional seahorse species occur in the IRL and surrounding coastal waters: the longsnout seahorse, H. reidi; and the dwarf seahorse, H. zosterae. The snout of H. reidi is longer than H. erectus, and the body usually has many dark spots evenly scattered over a brown background. Meristic counts are: 16-19 dorsal fin rays; 31 to 39 tail rings; and 15-17 pectoral fin rays. The dwarf seahorse is usually tan and unpatterned, with a dark stripe along the outer edge of the dorsal fin. Adults reach a maximum size of 5 cm, significantly smaller than adult H. erectus. Meristic counts are: 31-32 tail rings; 12 dorsal fin rays; 11-12 pectoral fin rays; and 9-10 trunk rings (Lourie et al. 2004, Robins & Ray 1986). Regional Occurrence & Habitat Preference: The range of H. erectus extends from Nova Scotia to Argentina and throughout the Gulf of Mexico (Robins & Ray 1986). The species is also suspected to inhabit several other Caribbean territories and nations (Lourie et al. 2004). Individuals are found in algal and coral reefs, floating Sargassum clumps, mangroves, seagrasses, soft bottom areas and around sponges to a depth of 73 meters (Foster & Vincent 2004, Vari 1982).
  • Robins, CR & GC Ray. 1986. A field guide to Atlantic coast fishes of North America. Houghton Mifflin Co. New York. USA. 354 pp.
  • Powell, AB, Thayer, G, Lacroix, M & R Cheshire. 2007. Juvenile and small resident fishes of Florida Bay, a critical habitat in the Everglades National Park, Florida. NOAA Professional Paper NMFS 6: 105-108. National Marine Fisheries Service. Seattle, WA. USA.
  • Adams, C, Larkin, S & D Lee. 2001. Volume and value of marine ornamentals collected in Florida, 1990-1998. Aquar. Sci. Conserv. 3: 25-36.Azzarello, MY. 1991. Some questions concerning the Syngnathidae brood pouch. Bull. Mar. Sci. 49: 741-747.
  • Baum, JK, Meeuwig, JJ & ACJ Vincent. 2003. Bycatch of lined seahorses (Hippocampus erectus) in a Gulf of Mexico shrimp trawl fishery. Fish. Bull. 101: 721-731.
  • Bergert, BA & PC Wainwright. 1997. Morphology and kinematics of prey capture in the syngnathid fishes Hippocampus erectus and Syngnathus floridae. Mar. Biol. 127: 563-570.
  • Blasiola, GCJ. 1979. Glugea heraldi n. sp. (Microsporida, Glugeidae) from the seahorse Hippocampus erectus Perry. J. Fish Diseases. 2: 493-500.
  • Blazer, S & RE Wolke. 1979. An Exophiala-like fungus as the cause of a systemic mycosis of marine fish. J. Fish Diseases. 2: 145-152.
  • Branch, GM. 1966. Contributions to the functional morphology of fishes.The feeding mechanism of Syngnathus acus Linnaeus. Zoologica African. 2: 69-89.
  • Breder, CM, Jr. 1948. Field book of marine fishes of the Atlantic coast from Labrador of Texas. Putman, NY. USA. 332 pp.
  • Cheung, PJ, Nigrelli, RF & GD Ruggieri. 1980. Studies of the morphology of Uronema marinum Dujardin (Ciliatea: Uronematidae) with a description of the histopathology of the infection in marine fishes. J. Fish Diseases. 3: 295-303.
  • CITES. 2004. Seahorses and other members of the family Syngnathidae (decision 12.54) Report of the Working Group. AC20 Doc. 17. Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES). Twentieth meeting of the Animals Committee Johannesburg (South Africa). 29 March-2 April 2004.
  • Colson, DJ, Patek, SN, Brainerd, EL & SM Lewis. 1998. Sound production during feeding in Hippocampus seahorses (Syngnathidae). Env. Biol. Fish. 51: 221-229.
  • Correa, M, Chung, KS & R Manrique. 1989. Cultivo experimental del caballito de mar, Hippocampus erectus. Bol. Inst. Ocean. Venezuela Univ. Oriente. 28: 191-196.
  • Fish, MP. 1953. The production of underwater sound by the northern seahorse, Hippocampus hudsonius. Copeia. 1953: 98-99.
  • Fish, MP. 1954. The character and significance of sound production among fishes of the western North Atlantic. Bull. Bingham Oceanogr. Coll. 14: 1-109.
  • Fish, MP, Kelsey, AS, Jr. & WH Mowbray. 1952. Studies on the production of underwater sounds by North Atlantic coastal fishes. J. Mar. Res. 11: 180-193.
  • Fish, MP & WH Mowbray. 1970. Sounds of western North Atlantic fishes. Johns Hopkins Press. Baltimore, MD. USA. 207 pp.
  • Foster, SJ & ACJ Vincent. 2004. Life history and ecology of seahorses: implications for conservation and management. J. Fish Biol. 65: 1-61.
  • Foster, SJ, Marsden, AD & ACJ Vincent. 2003. Hippocampus erectus. IUCN 2004. 2004 IUCN Red List of Threatened Species.Gill, T. 1905. The life history of sea horses (hippocampids). Proc. US Nat. Mus. 28: 805-814.
  • Hardy, JD. 1978. Development of fishes of the Mid-Atlantic Bight: an atlas of egg, larval and juvenile stages - Volume II. Anguillidae through Syngnathidae. US Fish & Wildlife Service, Office of Biological Sciences. Washington, DC. USA.
  • Herald, ES & M Rakowicz. 1951. Stable requirements for raising sea horses. Aquarium J. 22: 234-242.
  • IUCN (International Union for Conservation of Nature and Natural Resources). 2002. 2002 IUCN red list of threatened species. IUCN, Gland, Switzerland & Cambridge, UK. (www.redlist.org).
  • James, PL & KL Heck, Jr. 1994. The effects of habitat complexity and light intensity on ambush predation within a simulated seagrass habitat. J. Exp. Mar. Biol. Ecol. 176: 187-200.
  • James, P & C Woods. 2001. Rearing seahorses: does temperature matter? Aquac. Update. 28: 9-10.
  • Job, SD, Do, HH, Meeuwig, JJ & HJ Hall. 2002. Culturing the oceanic seahorse, Hippocampus kuda. Aquaculture. 214: 333-341.
  • Jones, SE. 2007. Variations in feeding kinematics of western Atlantic seahorses. Master's Thesis. Florida Institute of Technology. Melbourne, FL. USA. 140 pp.
  • Kvarnemo, C, Moore, GL, Jones, AG, Nelson, WS & JC Avise. 2000. Monogamous pair bonds and mate switching in the western Australian seahorse Hippocampus subelongatus. J. Evol. Biol. 13: 882-888.
  • Larkin, SL & RL Degner. 2001. The US wholesale market for marine ornamentals. Aquar. Sci. Conserv. 3: 13-24.
  • Lin, Q, Lin, J & D Zhang. 2008. Breeding and juvenile culture of the lined seahorse, Hippocampus erectus Perry, 1810. Aquaculture. 277: 287-292.
  • Lauder, GV. 1985. Aquatic feeding in lower vertebrates. 210-229. In: Hildebrand, M, Bramble, DM, Liem, KF & DB Wake, eds. Functional vertebrate morphology. Harvard University Press. Cambridge.
  • Lin, Q, Lu, JY & YL Gao. 2006. The effect of temperature on gonad, embryonic development and survival rate of juvenile seahorses, Hippocampus kuda Bleeker. Aquaculture. 254: 701-713.
  • Lin, Q, Gao, YL, Sheng, JQ, Chen, QX, Zhang, B & JY Lu. 2007. The effect of food and the sum of effective temperature on the embryonic development of the seahorse, Hippocampus kuda Bleeker. Aquaculture. 262: 481-492.
  • Linton, JR & BL Soloff. 1964. The physiology of the brood pouch of the male sea horse Hippocampus erectus. Bull. Mar. Sci. Gulf Carib. 14: 45-61.
  • Lockyear, J, Kaiser, H, & T Hecht. 1997. Studies on the captive breeding of the Knysna seahorse, Hippocampus capensis. Aquat. Sci. Conserv. 1: 129-136.
  • Lourie, SA, Foster, SJ, Cooper, EWT & ACJ Vincent. 2004. A guide to the identification of seahorses. Project Seahorse & TRAFFIC North America. University of British Columbia and World Wildlife Fund. Washington, DC. USA.
  • Lourie, SA, Vincent, AC & HJ Hall. 1999. Seahorse: An identification guide to the world's species and their conservation. Project Seahorse. London, UK.
  • Lu, JY, Wu, JY & DW Yang. 2001. Growth rate of Hippocampus kuda Bleeker under intensive culture. J. Fish. China. 26: 61-66.
  • Martinez, A, Gardner, T & D Littlehale. 2005. Lined seahorse, Hippocampus erectus. In: Koldewey, H, ed. Syngnathid husbandry in public aquariums. Project Seahorse and Zoological Society of London. Vancouver, BC. Canada.
  • Matlock, GC. 1992. Life history aspects of seahorses, Hippocampus, in Texas. Texas J. Sci. 44: 213-222.
  • Monteiro-Neto, C, de Andrade Cunha, FE, Nottingham, MC, Araújo, ME, Rosa, IL & GML Barros. 2003. Analysis of the marine ornamental fish trade at Ceará State, northeast Brazil. Biodiv. Conserv. 12: 1287-1295.
  • Muller, M. 1987. Optimization principles applied to the mechanism of neurocranium elevation and mouth bottom depression in bony fishes (Halecostomi). J. Theor. Biol. 126: 343-368.
  • Muller, M & JWM Osse. 1984. Hydrodynamics of suction feeding in fish. Trans. Zool. Soc. Lond. 37: 51-135.
  • Murdy, EO, Birdsong, RS & JA Musik. 1997. Fishes of Chesapeake Bay. Smithsonian Institution Press. Washington, DC. USA. 324 pp.
  • Osse, JWM & M Muller. 1980. A model of suction feeding in teleostean fishes with some implications for ventilation. In: Ali, MA, ed. Environmental physiology of fishes. NATO-ASI Series A. Life Sciences. Plenum Publishing. New York, NY. USA. 335-352.
  • Perante, NC, Pajaro, MG, Meeuwig, JJ & ACJ Vincent. 2002. Biology of Hippocampus comes in the central Philippines. J. Fish Biol. 60: 821-837.
  • Reid, GK, Jr. 1954. An ecological study of the Gulf of Mexico fishes in the vicinity of Cedar Key, Florida. Bull. Mar. Sci. 4: 1-94.
  • Scarratt, AM. 1995. Techniques for raising lined seahorses (Hippocampus erectus). Aquar. Front. 3: 24-29.
  • Sheng, JQ, Lin, Q, Chen, QX, Gao, YL, Shen, L & JY Lu. 2006. Effects of food, temperature and light intensity on the feeding behavior of three-spot juveniles, Hippocampus trimaculatus Leach. Aquaculture. 256: 596-607.
  • Sogard, SM, Powell, GVN & JG Holmquist. 1987. Epibenthic fish communities of Florida Bay banks: relations with physical parameters and seagrass cover. Mar. Ecol. Prog. Ser. 40: 25-39.
  • Strawn, K. 1958. Life history of the pigmy seahorse, Hippocampus zostrae Jordan and Gilbert, at Cedar Key, Florida. Copeia 1: 16-22.
  • Teixeira, RL & JA Musik. 2000. Reproduction and food habits of the lined seahorse, Hippocampus erectus (Teleostei: Syngnathidae) of Chesapeake Bay, Virginia. Rev. Bras. Biol. 61: 79-90.
  • Urick, RJ. 1983. Principles of underwater sound, 3rd edition. McGraw Hill. New York, NY. USA. 423 pp.
  • Vari, RP. 1982. Fishes of the western North Atlantic, subfamily Hippocampus campinae. The seahorses. 173-189. Sears Foundation for Marine Research Memoir 1. Yale Univ. New Haven, CT. USA.
  • Vincent, ACJ. 1990. Reproductive ecology of seahorses. PhD Dissertation. Cambridge University, UK.Vincent, ACJ. 1995. A role for daily greetings in maintaining seahorse pair bonds. Anim. Behav. 49: 258-260.
  • Vincent, ACJ. 1996. The international trade in seahorses. TRAFFIC International. Cambridge, UK. 164 pp.Vincent, ACJ & RS Clifton-Hadley. 1989. Parasitic infection of the seahorse (Hippocampus erectus) - A case report. J. Wildlife. Diseases. 25: 404-406.
  • Vincent, ACJ, Evans, KL & AD Marsden. 2003. Home range behavior of the monogamous Australian seahorse, Hippocampus whitei. Env. Biol. Fishes. 72: 1-12.
  • Vincent, ACJ & LM Sadler. 1995. Faithful pair bonds in wild seahorses, Hippocampus whitei. Anim. Behav. 50: 1557-1569.
  • Wong, JM & JAH Benzie. 2003. The effects of temperature, Artemia enrichment, stocking density and light on the growth of juvenile seahorses, Hippocampus whitei (Bleeker, 1855), from Australia. Aquaculture. 228: 107-121.
  • Woods, CMC. 2003a. Growth and survival of juvenile seahorse Hippocampus abdominalis reared on live, frozen and artificial foods. Aquaculture. 220: 287-298.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Hippocampus erectus is strictly marine in habitat, and is found in seaweed and on coral reefs at depths of .5 - 30 m. (Aquatic Bookshop)

Aquatic Biomes: reef ; coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Hippocampus erectus occur in water up to 73 m, and are associated with aquatic vegetation such as mangroves, seagrass, sponges, and floating Sargassum, as well as sponges (Lieske and Myers 1994, and McAllister 1990 in Lourie et al. 1999, Fish and Mowbray 1970). Hippocampus erectus can be found at the surface and bottom of both shallow water and deeper areas of channels in bays, along beaches, in or near salt marshes, and over oyster beds and weed-covered banks (Hardy 1978).

This species may be particularly susceptible to decline. The limited information on habitat suggests they inhabit shallow sea-grass beds (Lourie et al. 1999) that are susceptible to human degradation, as well as making them susceptible to being caught as bycatch. All seahorse species have vital parental care, and many species studied to date have high site fidelity (Perante et al. 2002, Vincent et al., in review), highly structured social behaviour (Vincent and Sadler 1995), and relatively sparse distributions (Lourie et al. 1999). The importance of life history parameters in determining response to exploitation has been demonstrated for a number of species (Jennings et al. 1998).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

nektonic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Generally in coastal waters; often around man-made structures.
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; non-migratory; marine; depth range 1 - 73 m (Ref. 30915)
  • Lourie, S.A., A.C.J. Vincent and H.J. Hall 1999 Seahorses: an identification guide to the world's species and their conservation. Project Seahorse, London. 214 p. (Ref. 30915)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 389 specimens in 1 taxon.
Water temperature and chemistry ranges based on 187 samples.

Environmental ranges
  Depth range (m): 0 - 2107
  Temperature range (°C): 3.468 - 25.997
  Nitrate (umol/L): 0.286 - 21.357
  Salinity (PPS): 32.507 - 36.446
  Oxygen (ml/l): 3.453 - 6.494
  Phosphate (umol/l): 0.088 - 1.439
  Silicate (umol/l): 0.756 - 15.466

Graphical representation

Depth range (m): 0 - 2107

Temperature range (°C): 3.468 - 25.997

Nitrate (umol/L): 0.286 - 21.357

Salinity (PPS): 32.507 - 36.446

Oxygen (ml/l): 3.453 - 6.494

Phosphate (umol/l): 0.088 - 1.439

Silicate (umol/l): 0.756 - 15.466
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 1 - 73m.
From 1 to 73 meters.

Habitat: reef-associated. Rare in most areas, but may be locally common in certain places. Usually attached to gorgonians or seagrasses but may occur in floating @Sargassum@ or swimming freely in midwater (Ref. 9710). Those that live in @Sargassum@ usually have bony protuberances and fleshy tabs that may serve as camouflage.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reef-associated; marine; depth range 1 - 73 m. In coastal waters but moves into deeper waters during winter. Often attached to gorgonians or sea grasses but may occur in floating Sargassum or may be free swimming. Those that live in Sargassum have bony protuberances and fleshy tabs. Has been reared in captivity.
  • Bigelow, H.B. and Schroeder, W.C., 1953; Lieske, E. and R. Myers, 1994; Lourie, S.A., A.C.J. Vincent and H.J. Hall, 1999; Moe, A.M. Jr., 1992; Schumann, B., 1969; Smith, C.L., 1997; Wicklund, R.I., S.J. Wilk and L. Ogren, 1969.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Adults are known from the surface and bottom waters of both shallow and deep areas of channels, bays, salt marshes and near-shore coastal waters, up to depths of 73 m (1) (6). This species is associated with, and often found clinging to, aquatic vegetation such as mangroves, seagrasses, sponges, soft corals and floating Sargassum, and has been found over oyster beds and weed-covered banks (1) (6). Newborn juveniles tend to swim near the water's surface (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

The seahorse, like all of the species of the family Syngnathidae, require living food. They are unable to move rapidly enough to chase their prey. Instead, the seahorse uses its elongated snout to suck in small crustaceans. Seahorses have an almost pinpoint accuracy within the 1 inch range. Young Hippocampus erectus may feed for as long as ten hours of each day and consume up to 3600 baby brine shrimp during that time. (Herald, 1961, pg. 147; Moyle and Cech,1982, pg. 294)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lives in shallow water to 73 m; in seagrass, sponge and floating Sargassum (Ref. 30915). Host anemone species: Heteractis crispa, H. magnifica, Stichodactyla gigantea.
  • Lourie, S.A., A.C.J. Vincent and H.J. Hall 1999 Seahorses: an identification guide to the world's species and their conservation. Project Seahorse, London. 214 p. (Ref. 30915)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Seahorses are predatory fishes, preying on a variety of small crustaceans, mollusks and various zooplankton. Prey items are captured via a unique suction feeding behavior. Once food is located, a sudden upswing of the head draws it into the mouth, followed by pipette-like suction transport into the buccal cavity (Bergert & Wainwright 1997). The entire prey capture process for each strike is quite rapid, with the total feeding and recovery time lasting less than one second (Bergert & Wainwright 1997). The origin of the clicking sounds produced during the feeding process in seahorses is controversial. Some studies suggest that cavitation occurs during prey capture, producing sound from the collapse of vapor bubbles in the water, which is caused by rapid pressure changes in the buccal cavity (James & Heck 1994). Other experiments support the hypothesis that the sound actually originates from the articulation or contact of two bones in the head, the supraoccipital and the coronet (Colson et al. 1998; Fish et al. 1952; Fish 1953, 1954; Fish & Mowbray 1970).Gut content analysis for individuals in Chesapeake Bay shows a varied diet for H. erectus (Teixeira & Musik 2001). The most common prey items appear to be amphipods, especially Ampithoe longimana, Gammarus mucronatus, Stenothoe minuta and Caprella penantis. Other foods included: copepods; polychaetes; gastropods; and grass shrimp in the family Palaemonidae. In captivity, juveniles and adults have been reared on a variety of foods, including: live and frozen nauplius and adult stages of the brine shrimp, Artemia spp.; live and frozen Mysis shrimp; grass shrimp; copepods; gammarid and caprellid amphipods; fry of the killifish, Poecilia sp.; and frozen krill, Euphausia pacifica (Lin et al. 2008, Martinez et al. 2005). Predators: Information on specific predators of the lined seahorse is scarce, but the camouflage behavior of this species among seagrass blades, algae and mangrove roots reduces predation risk. However, mobility in H. erectus is limited and larger fishes likely prey on adults and juveniles. In addition, captive parental males have been documented to cannibalize small numbers of their own fry following release into the water column (Lin et al. 2008). Parasites: The lined seahorse is vulnerable to several parasitic infections, especially in captive adults and aquacultured juveniles. Documented parasites include: microsporidians, including Glugea heraldi (Blasiola 1979, Vincent & Clifton-Hadley 1989); a myxosporidian of the genus Sphaeromyxa (Vincent & Clifton-Hadley 1989); fungi (Blazer & Wolke 1979); ciliates, including Uronema marinum (Cheung et al. 1980); and nematodes (Vincent & Clifton-Hadley 1989). Activity Time: Like most other syngnathids, H. erectus is diurnal, actively feeding and engaging in other behaviors during the day.
  • Robins, CR & GC Ray. 1986. A field guide to Atlantic coast fishes of North America. Houghton Mifflin Co. New York. USA. 354 pp.
  • Powell, AB, Thayer, G, Lacroix, M & R Cheshire. 2007. Juvenile and small resident fishes of Florida Bay, a critical habitat in the Everglades National Park, Florida. NOAA Professional Paper NMFS 6: 105-108. National Marine Fisheries Service. Seattle, WA. USA.
  • Adams, C, Larkin, S & D Lee. 2001. Volume and value of marine ornamentals collected in Florida, 1990-1998. Aquar. Sci. Conserv. 3: 25-36.Azzarello, MY. 1991. Some questions concerning the Syngnathidae brood pouch. Bull. Mar. Sci. 49: 741-747.
  • Baum, JK, Meeuwig, JJ & ACJ Vincent. 2003. Bycatch of lined seahorses (Hippocampus erectus) in a Gulf of Mexico shrimp trawl fishery. Fish. Bull. 101: 721-731.
  • Bergert, BA & PC Wainwright. 1997. Morphology and kinematics of prey capture in the syngnathid fishes Hippocampus erectus and Syngnathus floridae. Mar. Biol. 127: 563-570.
  • Blasiola, GCJ. 1979. Glugea heraldi n. sp. (Microsporida, Glugeidae) from the seahorse Hippocampus erectus Perry. J. Fish Diseases. 2: 493-500.
  • Blazer, S & RE Wolke. 1979. An Exophiala-like fungus as the cause of a systemic mycosis of marine fish. J. Fish Diseases. 2: 145-152.
  • Branch, GM. 1966. Contributions to the functional morphology of fishes.The feeding mechanism of Syngnathus acus Linnaeus. Zoologica African. 2: 69-89.
  • Breder, CM, Jr. 1948. Field book of marine fishes of the Atlantic coast from Labrador of Texas. Putman, NY. USA. 332 pp.
  • Cheung, PJ, Nigrelli, RF & GD Ruggieri. 1980. Studies of the morphology of Uronema marinum Dujardin (Ciliatea: Uronematidae) with a description of the histopathology of the infection in marine fishes. J. Fish Diseases. 3: 295-303.
  • CITES. 2004. Seahorses and other members of the family Syngnathidae (decision 12.54) Report of the Working Group. AC20 Doc. 17. Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES). Twentieth meeting of the Animals Committee Johannesburg (South Africa). 29 March-2 April 2004.
  • Colson, DJ, Patek, SN, Brainerd, EL & SM Lewis. 1998. Sound production during feeding in Hippocampus seahorses (Syngnathidae). Env. Biol. Fish. 51: 221-229.
  • Correa, M, Chung, KS & R Manrique. 1989. Cultivo experimental del caballito de mar, Hippocampus erectus. Bol. Inst. Ocean. Venezuela Univ. Oriente. 28: 191-196.
  • Fish, MP. 1953. The production of underwater sound by the northern seahorse, Hippocampus hudsonius. Copeia. 1953: 98-99.
  • Fish, MP. 1954. The character and significance of sound production among fishes of the western North Atlantic. Bull. Bingham Oceanogr. Coll. 14: 1-109.
  • Fish, MP, Kelsey, AS, Jr. & WH Mowbray. 1952. Studies on the production of underwater sounds by North Atlantic coastal fishes. J. Mar. Res. 11: 180-193.
  • Fish, MP & WH Mowbray. 1970. Sounds of western North Atlantic fishes. Johns Hopkins Press. Baltimore, MD. USA. 207 pp.
  • Foster, SJ & ACJ Vincent. 2004. Life history and ecology of seahorses: implications for conservation and management. J. Fish Biol. 65: 1-61.
  • Foster, SJ, Marsden, AD & ACJ Vincent. 2003. Hippocampus erectus. IUCN 2004. 2004 IUCN Red List of Threatened Species.Gill, T. 1905. The life history of sea horses (hippocampids). Proc. US Nat. Mus. 28: 805-814.
  • Hardy, JD. 1978. Development of fishes of the Mid-Atlantic Bight: an atlas of egg, larval and juvenile stages - Volume II. Anguillidae through Syngnathidae. US Fish & Wildlife Service, Office of Biological Sciences. Washington, DC. USA.
  • Herald, ES & M Rakowicz. 1951. Stable requirements for raising sea horses. Aquarium J. 22: 234-242.
  • IUCN (International Union for Conservation of Nature and Natural Resources). 2002. 2002 IUCN red list of threatened species. IUCN, Gland, Switzerland & Cambridge, UK. (www.redlist.org).
  • James, PL & KL Heck, Jr. 1994. The effects of habitat complexity and light intensity on ambush predation within a simulated seagrass habitat. J. Exp. Mar. Biol. Ecol. 176: 187-200.
  • James, P & C Woods. 2001. Rearing seahorses: does temperature matter? Aquac. Update. 28: 9-10.
  • Job, SD, Do, HH, Meeuwig, JJ & HJ Hall. 2002. Culturing the oceanic seahorse, Hippocampus kuda. Aquaculture. 214: 333-341.
  • Jones, SE. 2007. Variations in feeding kinematics of western Atlantic seahorses. Master's Thesis. Florida Institute of Technology. Melbourne, FL. USA. 140 pp.
  • Kvarnemo, C, Moore, GL, Jones, AG, Nelson, WS & JC Avise. 2000. Monogamous pair bonds and mate switching in the western Australian seahorse Hippocampus subelongatus. J. Evol. Biol. 13: 882-888.
  • Larkin, SL & RL Degner. 2001. The US wholesale market for marine ornamentals. Aquar. Sci. Conserv. 3: 13-24.
  • Lin, Q, Lin, J & D Zhang. 2008. Breeding and juvenile culture of the lined seahorse, Hippocampus erectus Perry, 1810. Aquaculture. 277: 287-292.
  • Lauder, GV. 1985. Aquatic feeding in lower vertebrates. 210-229. In: Hildebrand, M, Bramble, DM, Liem, KF & DB Wake, eds. Functional vertebrate morphology. Harvard University Press. Cambridge.
  • Lin, Q, Lu, JY & YL Gao. 2006. The effect of temperature on gonad, embryonic development and survival rate of juvenile seahorses, Hippocampus kuda Bleeker. Aquaculture. 254: 701-713.
  • Lin, Q, Gao, YL, Sheng, JQ, Chen, QX, Zhang, B & JY Lu. 2007. The effect of food and the sum of effective temperature on the embryonic development of the seahorse, Hippocampus kuda Bleeker. Aquaculture. 262: 481-492.
  • Linton, JR & BL Soloff. 1964. The physiology of the brood pouch of the male sea horse Hippocampus erectus. Bull. Mar. Sci. Gulf Carib. 14: 45-61.
  • Lockyear, J, Kaiser, H, & T Hecht. 1997. Studies on the captive breeding of the Knysna seahorse, Hippocampus capensis. Aquat. Sci. Conserv. 1: 129-136.
  • Lourie, SA, Foster, SJ, Cooper, EWT & ACJ Vincent. 2004. A guide to the identification of seahorses. Project Seahorse & TRAFFIC North America. University of British Columbia and World Wildlife Fund. Washington, DC. USA.
  • Lourie, SA, Vincent, AC & HJ Hall. 1999. Seahorse: An identification guide to the world's species and their conservation. Project Seahorse. London, UK.
  • Lu, JY, Wu, JY & DW Yang. 2001. Growth rate of Hippocampus kuda Bleeker under intensive culture. J. Fish. China. 26: 61-66.
  • Martinez, A, Gardner, T & D Littlehale. 2005. Lined seahorse, Hippocampus erectus. In: Koldewey, H, ed. Syngnathid husbandry in public aquariums. Project Seahorse and Zoological Society of London. Vancouver, BC. Canada.
  • Matlock, GC. 1992. Life history aspects of seahorses, Hippocampus, in Texas. Texas J. Sci. 44: 213-222.
  • Monteiro-Neto, C, de Andrade Cunha, FE, Nottingham, MC, Araújo, ME, Rosa, IL & GML Barros. 2003. Analysis of the marine ornamental fish trade at Ceará State, northeast Brazil. Biodiv. Conserv. 12: 1287-1295.
  • Muller, M. 1987. Optimization principles applied to the mechanism of neurocranium elevation and mouth bottom depression in bony fishes (Halecostomi). J. Theor. Biol. 126: 343-368.
  • Muller, M & JWM Osse. 1984. Hydrodynamics of suction feeding in fish. Trans. Zool. Soc. Lond. 37: 51-135.
  • Murdy, EO, Birdsong, RS & JA Musik. 1997. Fishes of Chesapeake Bay. Smithsonian Institution Press. Washington, DC. USA. 324 pp.
  • Osse, JWM & M Muller. 1980. A model of suction feeding in teleostean fishes with some implications for ventilation. In: Ali, MA, ed. Environmental physiology of fishes. NATO-ASI Series A. Life Sciences. Plenum Publishing. New York, NY. USA. 335-352.
  • Perante, NC, Pajaro, MG, Meeuwig, JJ & ACJ Vincent. 2002. Biology of Hippocampus comes in the central Philippines. J. Fish Biol. 60: 821-837.
  • Reid, GK, Jr. 1954. An ecological study of the Gulf of Mexico fishes in the vicinity of Cedar Key, Florida. Bull. Mar. Sci. 4: 1-94.
  • Scarratt, AM. 1995. Techniques for raising lined seahorses (Hippocampus erectus). Aquar. Front. 3: 24-29.
  • Sheng, JQ, Lin, Q, Chen, QX, Gao, YL, Shen, L & JY Lu. 2006. Effects of food, temperature and light intensity on the feeding behavior of three-spot juveniles, Hippocampus trimaculatus Leach. Aquaculture. 256: 596-607.
  • Sogard, SM, Powell, GVN & JG Holmquist. 1987. Epibenthic fish communities of Florida Bay banks: relations with physical parameters and seagrass cover. Mar. Ecol. Prog. Ser. 40: 25-39.
  • Strawn, K. 1958. Life history of the pigmy seahorse, Hippocampus zostrae Jordan and Gilbert, at Cedar Key, Florida. Copeia 1: 16-22.
  • Teixeira, RL & JA Musik. 2000. Reproduction and food habits of the lined seahorse, Hippocampus erectus (Teleostei: Syngnathidae) of Chesapeake Bay, Virginia. Rev. Bras. Biol. 61: 79-90.
  • Urick, RJ. 1983. Principles of underwater sound, 3rd edition. McGraw Hill. New York, NY. USA. 423 pp.
  • Vari, RP. 1982. Fishes of the western North Atlantic, subfamily Hippocampus campinae. The seahorses. 173-189. Sears Foundation for Marine Research Memoir 1. Yale Univ. New Haven, CT. USA.
  • Vincent, ACJ. 1990. Reproductive ecology of seahorses. PhD Dissertation. Cambridge University, UK.Vincent, ACJ. 1995. A role for daily greetings in maintaining seahorse pair bonds. Anim. Behav. 49: 258-260.
  • Vincent, ACJ. 1996. The international trade in seahorses. TRAFFIC International. Cambridge, UK. 164 pp.Vincent, ACJ & RS Clifton-Hadley. 1989. Parasitic infection of the seahorse (Hippocampus erectus) - A case report. J. Wildlife. Diseases. 25: 404-406.
  • Vincent, ACJ, Evans, KL & AD Marsden. 2003. Home range behavior of the monogamous Australian seahorse, Hippocampus whitei. Env. Biol. Fishes. 72: 1-12.
  • Vincent, ACJ & LM Sadler. 1995. Faithful pair bonds in wild seahorses, Hippocampus whitei. Anim. Behav. 50: 1557-1569.
  • Wong, JM & JAH Benzie. 2003. The effects of temperature, Artemia enrichment, stocking density and light on the growth of juvenile seahorses, Hippocampus whitei (Bleeker, 1855), from Australia. Aquaculture. 228: 107-121.
  • Woods, CMC. 2003a. Growth and survival of juvenile seahorse Hippocampus abdominalis reared on live, frozen and artificial foods. Aquaculture. 220: 287-298.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Feeds by sucking in small organisms.
  • Bigelow, H.B. and Schroeder, W.C., 1953; Lieske, E. and R. Myers, 1994; Lourie, S.A., A.C.J. Vincent and H.J. Hall, 1999; Moe, A.M. Jr., 1992; Schumann, B., 1969; Smith, C.L., 1997; Wicklund, R.I., S.J. Wilk and L. Ogren, 1969.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

The lined seahorse has no known obligate associations. However, as inhabitants of a variety of coastal ecosystems, these seahorses are associated with several organisms common to mangroves, seagrass beds and other habitats. For extensive lists of other species found throughout the ecosystems in which H. erectus occurs, please refer to the "Habitats of the IRL" link at the left of this page.
  • Robins, CR & GC Ray. 1986. A field guide to Atlantic coast fishes of North America. Houghton Mifflin Co. New York. USA. 354 pp.
  • Powell, AB, Thayer, G, Lacroix, M & R Cheshire. 2007. Juvenile and small resident fishes of Florida Bay, a critical habitat in the Everglades National Park, Florida. NOAA Professional Paper NMFS 6: 105-108. National Marine Fisheries Service. Seattle, WA. USA.
  • Adams, C, Larkin, S & D Lee. 2001. Volume and value of marine ornamentals collected in Florida, 1990-1998. Aquar. Sci. Conserv. 3: 25-36.Azzarello, MY. 1991. Some questions concerning the Syngnathidae brood pouch. Bull. Mar. Sci. 49: 741-747.
  • Baum, JK, Meeuwig, JJ & ACJ Vincent. 2003. Bycatch of lined seahorses (Hippocampus erectus) in a Gulf of Mexico shrimp trawl fishery. Fish. Bull. 101: 721-731.
  • Bergert, BA & PC Wainwright. 1997. Morphology and kinematics of prey capture in the syngnathid fishes Hippocampus erectus and Syngnathus floridae. Mar. Biol. 127: 563-570.
  • Blasiola, GCJ. 1979. Glugea heraldi n. sp. (Microsporida, Glugeidae) from the seahorse Hippocampus erectus Perry. J. Fish Diseases. 2: 493-500.
  • Blazer, S & RE Wolke. 1979. An Exophiala-like fungus as the cause of a systemic mycosis of marine fish. J. Fish Diseases. 2: 145-152.
  • Branch, GM. 1966. Contributions to the functional morphology of fishes.The feeding mechanism of Syngnathus acus Linnaeus. Zoologica African. 2: 69-89.
  • Breder, CM, Jr. 1948. Field book of marine fishes of the Atlantic coast from Labrador of Texas. Putman, NY. USA. 332 pp.
  • Cheung, PJ, Nigrelli, RF & GD Ruggieri. 1980. Studies of the morphology of Uronema marinum Dujardin (Ciliatea: Uronematidae) with a description of the histopathology of the infection in marine fishes. J. Fish Diseases. 3: 295-303.
  • CITES. 2004. Seahorses and other members of the family Syngnathidae (decision 12.54) Report of the Working Group. AC20 Doc. 17. Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES). Twentieth meeting of the Animals Committee Johannesburg (South Africa). 29 March-2 April 2004.
  • Colson, DJ, Patek, SN, Brainerd, EL & SM Lewis. 1998. Sound production during feeding in Hippocampus seahorses (Syngnathidae). Env. Biol. Fish. 51: 221-229.
  • Correa, M, Chung, KS & R Manrique. 1989. Cultivo experimental del caballito de mar, Hippocampus erectus. Bol. Inst. Ocean. Venezuela Univ. Oriente. 28: 191-196.
  • Fish, MP. 1953. The production of underwater sound by the northern seahorse, Hippocampus hudsonius. Copeia. 1953: 98-99.
  • Fish, MP. 1954. The character and significance of sound production among fishes of the western North Atlantic. Bull. Bingham Oceanogr. Coll. 14: 1-109.
  • Fish, MP, Kelsey, AS, Jr. & WH Mowbray. 1952. Studies on the production of underwater sounds by North Atlantic coastal fishes. J. Mar. Res. 11: 180-193.
  • Fish, MP & WH Mowbray. 1970. Sounds of western North Atlantic fishes. Johns Hopkins Press. Baltimore, MD. USA. 207 pp.
  • Foster, SJ & ACJ Vincent. 2004. Life history and ecology of seahorses: implications for conservation and management. J. Fish Biol. 65: 1-61.
  • Foster, SJ, Marsden, AD & ACJ Vincent. 2003. Hippocampus erectus. IUCN 2004. 2004 IUCN Red List of Threatened Species.Gill, T. 1905. The life history of sea horses (hippocampids). Proc. US Nat. Mus. 28: 805-814.
  • Hardy, JD. 1978. Development of fishes of the Mid-Atlantic Bight: an atlas of egg, larval and juvenile stages - Volume II. Anguillidae through Syngnathidae. US Fish & Wildlife Service, Office of Biological Sciences. Washington, DC. USA.
  • Herald, ES & M Rakowicz. 1951. Stable requirements for raising sea horses. Aquarium J. 22: 234-242.
  • IUCN (International Union for Conservation of Nature and Natural Resources). 2002. 2002 IUCN red list of threatened species. IUCN, Gland, Switzerland & Cambridge, UK. (www.redlist.org).
  • James, PL & KL Heck, Jr. 1994. The effects of habitat complexity and light intensity on ambush predation within a simulated seagrass habitat. J. Exp. Mar. Biol. Ecol. 176: 187-200.
  • James, P & C Woods. 2001. Rearing seahorses: does temperature matter? Aquac. Update. 28: 9-10.
  • Job, SD, Do, HH, Meeuwig, JJ & HJ Hall. 2002. Culturing the oceanic seahorse, Hippocampus kuda. Aquaculture. 214: 333-341.
  • Jones, SE. 2007. Variations in feeding kinematics of western Atlantic seahorses. Master's Thesis. Florida Institute of Technology. Melbourne, FL. USA. 140 pp.
  • Kvarnemo, C, Moore, GL, Jones, AG, Nelson, WS & JC Avise. 2000. Monogamous pair bonds and mate switching in the western Australian seahorse Hippocampus subelongatus. J. Evol. Biol. 13: 882-888.
  • Larkin, SL & RL Degner. 2001. The US wholesale market for marine ornamentals. Aquar. Sci. Conserv. 3: 13-24.
  • Lin, Q, Lin, J & D Zhang. 2008. Breeding and juvenile culture of the lined seahorse, Hippocampus erectus Perry, 1810. Aquaculture. 277: 287-292.
  • Lauder, GV. 1985. Aquatic feeding in lower vertebrates. 210-229. In: Hildebrand, M, Bramble, DM, Liem, KF & DB Wake, eds. Functional vertebrate morphology. Harvard University Press. Cambridge.
  • Lin, Q, Lu, JY & YL Gao. 2006. The effect of temperature on gonad, embryonic development and survival rate of juvenile seahorses, Hippocampus kuda Bleeker. Aquaculture. 254: 701-713.
  • Lin, Q, Gao, YL, Sheng, JQ, Chen, QX, Zhang, B & JY Lu. 2007. The effect of food and the sum of effective temperature on the embryonic development of the seahorse, Hippocampus kuda Bleeker. Aquaculture. 262: 481-492.
  • Linton, JR & BL Soloff. 1964. The physiology of the brood pouch of the male sea horse Hippocampus erectus. Bull. Mar. Sci. Gulf Carib. 14: 45-61.
  • Lockyear, J, Kaiser, H, & T Hecht. 1997. Studies on the captive breeding of the Knysna seahorse, Hippocampus capensis. Aquat. Sci. Conserv. 1: 129-136.
  • Lourie, SA, Foster, SJ, Cooper, EWT & ACJ Vincent. 2004. A guide to the identification of seahorses. Project Seahorse & TRAFFIC North America. University of British Columbia and World Wildlife Fund. Washington, DC. USA.
  • Lourie, SA, Vincent, AC & HJ Hall. 1999. Seahorse: An identification guide to the world's species and their conservation. Project Seahorse. London, UK.
  • Lu, JY, Wu, JY & DW Yang. 2001. Growth rate of Hippocampus kuda Bleeker under intensive culture. J. Fish. China. 26: 61-66.
  • Martinez, A, Gardner, T & D Littlehale. 2005. Lined seahorse, Hippocampus erectus. In: Koldewey, H, ed. Syngnathid husbandry in public aquariums. Project Seahorse and Zoological Society of London. Vancouver, BC. Canada.
  • Matlock, GC. 1992. Life history aspects of seahorses, Hippocampus, in Texas. Texas J. Sci. 44: 213-222.
  • Monteiro-Neto, C, de Andrade Cunha, FE, Nottingham, MC, Araújo, ME, Rosa, IL & GML Barros. 2003. Analysis of the marine ornamental fish trade at Ceará State, northeast Brazil. Biodiv. Conserv. 12: 1287-1295.
  • Muller, M. 1987. Optimization principles applied to the mechanism of neurocranium elevation and mouth bottom depression in bony fishes (Halecostomi). J. Theor. Biol. 126: 343-368.
  • Muller, M & JWM Osse. 1984. Hydrodynamics of suction feeding in fish. Trans. Zool. Soc. Lond. 37: 51-135.
  • Murdy, EO, Birdsong, RS & JA Musik. 1997. Fishes of Chesapeake Bay. Smithsonian Institution Press. Washington, DC. USA. 324 pp.
  • Osse, JWM & M Muller. 1980. A model of suction feeding in teleostean fishes with some implications for ventilation. In: Ali, MA, ed. Environmental physiology of fishes. NATO-ASI Series A. Life Sciences. Plenum Publishing. New York, NY. USA. 335-352.
  • Perante, NC, Pajaro, MG, Meeuwig, JJ & ACJ Vincent. 2002. Biology of Hippocampus comes in the central Philippines. J. Fish Biol. 60: 821-837.
  • Reid, GK, Jr. 1954. An ecological study of the Gulf of Mexico fishes in the vicinity of Cedar Key, Florida. Bull. Mar. Sci. 4: 1-94.
  • Scarratt, AM. 1995. Techniques for raising lined seahorses (Hippocampus erectus). Aquar. Front. 3: 24-29.
  • Sheng, JQ, Lin, Q, Chen, QX, Gao, YL, Shen, L & JY Lu. 2006. Effects of food, temperature and light intensity on the feeding behavior of three-spot juveniles, Hippocampus trimaculatus Leach. Aquaculture. 256: 596-607.
  • Sogard, SM, Powell, GVN & JG Holmquist. 1987. Epibenthic fish communities of Florida Bay banks: relations with physical parameters and seagrass cover. Mar. Ecol. Prog. Ser. 40: 25-39.
  • Strawn, K. 1958. Life history of the pigmy seahorse, Hippocampus zostrae Jordan and Gilbert, at Cedar Key, Florida. Copeia 1: 16-22.
  • Teixeira, RL & JA Musik. 2000. Reproduction and food habits of the lined seahorse, Hippocampus erectus (Teleostei: Syngnathidae) of Chesapeake Bay, Virginia. Rev. Bras. Biol. 61: 79-90.
  • Urick, RJ. 1983. Principles of underwater sound, 3rd edition. McGraw Hill. New York, NY. USA. 423 pp.
  • Vari, RP. 1982. Fishes of the western North Atlantic, subfamily Hippocampus campinae. The seahorses. 173-189. Sears Foundation for Marine Research Memoir 1. Yale Univ. New Haven, CT. USA.
  • Vincent, ACJ. 1990. Reproductive ecology of seahorses. PhD Dissertation. Cambridge University, UK.Vincent, ACJ. 1995. A role for daily greetings in maintaining seahorse pair bonds. Anim. Behav. 49: 258-260.
  • Vincent, ACJ. 1996. The international trade in seahorses. TRAFFIC International. Cambridge, UK. 164 pp.Vincent, ACJ & RS Clifton-Hadley. 1989. Parasitic infection of the seahorse (Hippocampus erectus) - A case report. J. Wildlife. Diseases. 25: 404-406.
  • Vincent, ACJ, Evans, KL & AD Marsden. 2003. Home range behavior of the monogamous Australian seahorse, Hippocampus whitei. Env. Biol. Fishes. 72: 1-12.
  • Vincent, ACJ & LM Sadler. 1995. Faithful pair bonds in wild seahorses, Hippocampus whitei. Anim. Behav. 50: 1557-1569.
  • Wong, JM & JAH Benzie. 2003. The effects of temperature, Artemia enrichment, stocking density and light on the growth of juvenile seahorses, Hippocampus whitei (Bleeker, 1855), from Australia. Aquaculture. 228: 107-121.
  • Woods, CMC. 2003a. Growth and survival of juvenile seahorse Hippocampus abdominalis reared on live, frozen and artificial foods. Aquaculture. 220: 287-298.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

The abundance of the lined seahorse is variable, depending on habitat, season, sex and other factors. Abundance estimates for populations of H. erectus in Florida Bay exceeded 9.9 individuals 1000 m-2 in some locations, and was highest in July (Powell et al. 2007). Shrimp trawls off Hernando Beach, Florida in the Gulf of Mexico have collected 72,000 seahorses annually as bycatch (Baum et al. 2003). Populations in Chesapeake Bay show a greater abundance of females (Teixeira & Musik 2001), a pattern likely repeated in other regions as a result of life history patterns and mating behaviors. Courtship &
  • Robins, CR & GC Ray. 1986. A field guide to Atlantic coast fishes of North America. Houghton Mifflin Co. New York. USA. 354 pp.
  • Powell, AB, Thayer, G, Lacroix, M & R Cheshire. 2007. Juvenile and small resident fishes of Florida Bay, a critical habitat in the Everglades National Park, Florida. NOAA Professional Paper NMFS 6: 105-108. National Marine Fisheries Service. Seattle, WA. USA.
  • Adams, C, Larkin, S & D Lee. 2001. Volume and value of marine ornamentals collected in Florida, 1990-1998. Aquar. Sci. Conserv. 3: 25-36.Azzarello, MY. 1991. Some questions concerning the Syngnathidae brood pouch. Bull. Mar. Sci. 49: 741-747.
  • Baum, JK, Meeuwig, JJ & ACJ Vincent. 2003. Bycatch of lined seahorses (Hippocampus erectus) in a Gulf of Mexico shrimp trawl fishery. Fish. Bull. 101: 721-731.
  • Bergert, BA & PC Wainwright. 1997. Morphology and kinematics of prey capture in the syngnathid fishes Hippocampus erectus and Syngnathus floridae. Mar. Biol. 127: 563-570.
  • Blasiola, GCJ. 1979. Glugea heraldi n. sp. (Microsporida, Glugeidae) from the seahorse Hippocampus erectus Perry. J. Fish Diseases. 2: 493-500.
  • Blazer, S & RE Wolke. 1979. An Exophiala-like fungus as the cause of a systemic mycosis of marine fish. J. Fish Diseases. 2: 145-152.
  • Branch, GM. 1966. Contributions to the functional morphology of fishes.The feeding mechanism of Syngnathus acus Linnaeus. Zoologica African. 2: 69-89.
  • Breder, CM, Jr. 1948. Field book of marine fishes of the Atlantic coast from Labrador of Texas. Putman, NY. USA. 332 pp.
  • Cheung, PJ, Nigrelli, RF & GD Ruggieri. 1980. Studies of the morphology of Uronema marinum Dujardin (Ciliatea: Uronematidae) with a description of the histopathology of the infection in marine fishes. J. Fish Diseases. 3: 295-303.
  • CITES. 2004. Seahorses and other members of the family Syngnathidae (decision 12.54) Report of the Working Group. AC20 Doc. 17. Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES). Twentieth meeting of the Animals Committee Johannesburg (South Africa). 29 March-2 April 2004.
  • Colson, DJ, Patek, SN, Brainerd, EL & SM Lewis. 1998. Sound production during feeding in Hippocampus seahorses (Syngnathidae). Env. Biol. Fish. 51: 221-229.
  • Correa, M, Chung, KS & R Manrique. 1989. Cultivo experimental del caballito de mar, Hippocampus erectus. Bol. Inst. Ocean. Venezuela Univ. Oriente. 28: 191-196.
  • Fish, MP. 1953. The production of underwater sound by the northern seahorse, Hippocampus hudsonius. Copeia. 1953: 98-99.
  • Fish, MP. 1954. The character and significance of sound production among fishes of the western North Atlantic. Bull. Bingham Oceanogr. Coll. 14: 1-109.
  • Fish, MP, Kelsey, AS, Jr. & WH Mowbray. 1952. Studies on the production of underwater sounds by North Atlantic coastal fishes. J. Mar. Res. 11: 180-193.
  • Fish, MP & WH Mowbray. 1970. Sounds of western North Atlantic fishes. Johns Hopkins Press. Baltimore, MD. USA. 207 pp.
  • Foster, SJ & ACJ Vincent. 2004. Life history and ecology of seahorses: implications for conservation and management. J. Fish Biol. 65: 1-61.
  • Foster, SJ, Marsden, AD & ACJ Vincent. 2003. Hippocampus erectus. IUCN 2004. 2004 IUCN Red List of Threatened Species.Gill, T. 1905. The life history of sea horses (hippocampids). Proc. US Nat. Mus. 28: 805-814.
  • Hardy, JD. 1978. Development of fishes of the Mid-Atlantic Bight: an atlas of egg, larval and juvenile stages - Volume II. Anguillidae through Syngnathidae. US Fish & Wildlife Service, Office of Biological Sciences. Washington, DC. USA.
  • Herald, ES & M Rakowicz. 1951. Stable requirements for raising sea horses. Aquarium J. 22: 234-242.
  • IUCN (International Union for Conservation of Nature and Natural Resources). 2002. 2002 IUCN red list of threatened species. IUCN, Gland, Switzerland & Cambridge, UK. (www.redlist.org).
  • James, PL & KL Heck, Jr. 1994. The effects of habitat complexity and light intensity on ambush predation within a simulated seagrass habitat. J. Exp. Mar. Biol. Ecol. 176: 187-200.
  • James, P & C Woods. 2001. Rearing seahorses: does temperature matter? Aquac. Update. 28: 9-10.
  • Job, SD, Do, HH, Meeuwig, JJ & HJ Hall. 2002. Culturing the oceanic seahorse, Hippocampus kuda. Aquaculture. 214: 333-341.
  • Jones, SE. 2007. Variations in feeding kinematics of western Atlantic seahorses. Master's Thesis. Florida Institute of Technology. Melbourne, FL. USA. 140 pp.
  • Kvarnemo, C, Moore, GL, Jones, AG, Nelson, WS & JC Avise. 2000. Monogamous pair bonds and mate switching in the western Australian seahorse Hippocampus subelongatus. J. Evol. Biol. 13: 882-888.
  • Larkin, SL & RL Degner. 2001. The US wholesale market for marine ornamentals. Aquar. Sci. Conserv. 3: 13-24.
  • Lin, Q, Lin, J & D Zhang. 2008. Breeding and juvenile culture of the lined seahorse, Hippocampus erectus Perry, 1810. Aquaculture. 277: 287-292.
  • Lauder, GV. 1985. Aquatic feeding in lower vertebrates. 210-229. In: Hildebrand, M, Bramble, DM, Liem, KF & DB Wake, eds. Functional vertebrate morphology. Harvard University Press. Cambridge.
  • Lin, Q, Lu, JY & YL Gao. 2006. The effect of temperature on gonad, embryonic development and survival rate of juvenile seahorses, Hippocampus kuda Bleeker. Aquaculture. 254: 701-713.
  • Lin, Q, Gao, YL, Sheng, JQ, Chen, QX, Zhang, B & JY Lu. 2007. The effect of food and the sum of effective temperature on the embryonic development of the seahorse, Hippocampus kuda Bleeker. Aquaculture. 262: 481-492.
  • Linton, JR & BL Soloff. 1964. The physiology of the brood pouch of the male sea horse Hippocampus erectus. Bull. Mar. Sci. Gulf Carib. 14: 45-61.
  • Lockyear, J, Kaiser, H, & T Hecht. 1997. Studies on the captive breeding of the Knysna seahorse, Hippocampus capensis. Aquat. Sci. Conserv. 1: 129-136.
  • Lourie, SA, Foster, SJ, Cooper, EWT & ACJ Vincent. 2004. A guide to the identification of seahorses. Project Seahorse & TRAFFIC North America. University of British Columbia and World Wildlife Fund. Washington, DC. USA.
  • Lourie, SA, Vincent, AC & HJ Hall. 1999. Seahorse: An identification guide to the world's species and their conservation. Project Seahorse. London, UK.
  • Lu, JY, Wu, JY & DW Yang. 2001. Growth rate of Hippocampus kuda Bleeker under intensive culture. J. Fish. China. 26: 61-66.
  • Martinez, A, Gardner, T & D Littlehale. 2005. Lined seahorse, Hippocampus erectus. In: Koldewey, H, ed. Syngnathid husbandry in public aquariums. Project Seahorse and Zoological Society of London. Vancouver, BC. Canada.
  • Matlock, GC. 1992. Life history aspects of seahorses, Hippocampus, in Texas. Texas J. Sci. 44: 213-222.
  • Monteiro-Neto, C, de Andrade Cunha, FE, Nottingham, MC, Araújo, ME, Rosa, IL & GML Barros. 2003. Analysis of the marine ornamental fish trade at Ceará State, northeast Brazil. Biodiv. Conserv. 12: 1287-1295.
  • Muller, M. 1987. Optimization principles applied to the mechanism of neurocranium elevation and mouth bottom depression in bony fishes (Halecostomi). J. Theor. Biol. 126: 343-368.
  • Muller, M & JWM Osse. 1984. Hydrodynamics of suction feeding in fish. Trans. Zool. Soc. Lond. 37: 51-135.
  • Murdy, EO, Birdsong, RS & JA Musik. 1997. Fishes of Chesapeake Bay. Smithsonian Institution Press. Washington, DC. USA. 324 pp.
  • Osse, JWM & M Muller. 1980. A model of suction feeding in teleostean fishes with some implications for ventilation. In: Ali, MA, ed. Environmental physiology of fishes. NATO-ASI Series A. Life Sciences. Plenum Publishing. New York, NY. USA. 335-352.
  • Perante, NC, Pajaro, MG, Meeuwig, JJ & ACJ Vincent. 2002. Biology of Hippocampus comes in the central Philippines. J. Fish Biol. 60: 821-837.
  • Reid, GK, Jr. 1954. An ecological study of the Gulf of Mexico fishes in the vicinity of Cedar Key, Florida. Bull. Mar. Sci. 4: 1-94.
  • Scarratt, AM. 1995. Techniques for raising lined seahorses (Hippocampus erectus). Aquar. Front. 3: 24-29.
  • Sheng, JQ, Lin, Q, Chen, QX, Gao, YL, Shen, L & JY Lu. 2006. Effects of food, temperature and light intensity on the feeding behavior of three-spot juveniles, Hippocampus trimaculatus Leach. Aquaculture. 256: 596-607.
  • Sogard, SM, Powell, GVN & JG Holmquist. 1987. Epibenthic fish communities of Florida Bay banks: relations with physical parameters and seagrass cover. Mar. Ecol. Prog. Ser. 40: 25-39.
  • Strawn, K. 1958. Life history of the pigmy seahorse, Hippocampus zostrae Jordan and Gilbert, at Cedar Key, Florida. Copeia 1: 16-22.
  • Teixeira, RL & JA Musik. 2000. Reproduction and food habits of the lined seahorse, Hippocampus erectus (Teleostei: Syngnathidae) of Chesapeake Bay, Virginia. Rev. Bras. Biol. 61: 79-90.
  • Urick, RJ. 1983. Principles of underwater sound, 3rd edition. McGraw Hill. New York, NY. USA. 423 pp.
  • Vari, RP. 1982. Fishes of the western North Atlantic, subfamily Hippocampus campinae. The seahorses. 173-189. Sears Foundation for Marine Research Memoir 1. Yale Univ. New Haven, CT. USA.
  • Vincent, ACJ. 1990. Reproductive ecology of seahorses. PhD Dissertation. Cambridge University, UK.Vincent, ACJ. 1995. A role for daily greetings in maintaining seahorse pair bonds. Anim. Behav. 49: 258-260.
  • Vincent, ACJ. 1996. The international trade in seahorses. TRAFFIC International. Cambridge, UK. 164 pp.Vincent, ACJ & RS Clifton-Hadley. 1989. Parasitic infection of the seahorse (Hippocampus erectus) - A case report. J. Wildlife. Diseases. 25: 404-406.
  • Vincent, ACJ, Evans, KL & AD Marsden. 2003. Home range behavior of the monogamous Australian seahorse, Hippocampus whitei. Env. Biol. Fishes. 72: 1-12.
  • Vincent, ACJ & LM Sadler. 1995. Faithful pair bonds in wild seahorses, Hippocampus whitei. Anim. Behav. 50: 1557-1569.
  • Wong, JM & JAH Benzie. 2003. The effects of temperature, Artemia enrichment, stocking density and light on the growth of juvenile seahorses, Hippocampus whitei (Bleeker, 1855), from Australia. Aquaculture. 228: 107-121.
  • Woods, CMC. 2003a. Growth and survival of juvenile seahorse Hippocampus abdominalis reared on live, frozen and artificial foods. Aquaculture. 220: 287-298.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Perception Channels: tactile ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diet

Feeds by sucking in small organisms, using its long face as a pipette
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Incubates eggs in an external marsupium. Gestation period 20-21 days but varies with water temperature (Ref. 30915).
  • Balon, E.K. 1990 Epigenesis of an epigeneticist: the development of some alternative concepts on the early ontogeny and evolution of fishes. Guelph Ichthyol. Rev. 1:1-48. (Ref. 7471)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Average lifespan

Status: captivity:
4.7 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 4.7 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Seahorses reproduce sexually through internal fertilization and spawn during every season. With Hippocampus erectus, as with all seahorses, it is the male that cares for the young. Male seahorses have an incubation pocket, similar to the pouch of a marsupial mammal, on the lower side of the tail, with an opening that can be closed off. During courtship, female H. erectus spray between 250 and 650 eggs into the male brood pocket, depending on the size of the individual. Development in the brood pocket lasts between 20 and 21 days. After hatching, the free embryos are carried in the pouch until they are capable of fairly active swimming. When it is time for the incubated young to be born, the prospective father holds fast to a plant stem or some other object by his prehensile tail. He bends rapidly, sharply, backward and forward; the pouch opens and a baby seahorse pops out. With brief intervals between births, the jerking motions are repeated until the pouch is emptied. Each infant seahorse emerges head first and is a swimming, independent miniature of the adult. Newborn H. erectus are about 5/8 of an inch in length, and within 8-10 months reach their maximum size of 5 inches in length. (Moyle and Cech, 1982, pg. 120; Schultz, 1948, pg. 114; National University of Singapore)

One of the complications of seahorse birth is that some of the unhatched seahorses may die within the pouch before birth, and this soon results in the formation of gas. The male then virtually becomes a balloon and is quickly buoyed to the surface, where he is immediately be picked off by some hungry fish. (Herald, 1961, pg. 148)

Average age at sexual or reproductive maturity (male)

Sex: male:
273 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
273 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Seahorses are sexually dimorphic, with differing structural characteristics. The most obvious of these is the presence of a brood pouch at the base of the abdomen in males. Males also have a proportionally longer tail than females (Lourie et al. 2004). The minimum recorded size for sexually mature individuals is 5.6 cm (Baum et al. 2003), and males have been reported to develop brood pouches at 5 to 7 months of age (Scarratt 1995). Most seahorse species are sexually and socially monogamous, mating with a single partner for an entire season or lifetime (Baum et al. 2003). Before sexual reproduction, mated pairs undergo a complex courtship process lasting a few days. Both partners may display color changes, becoming pale to whitish during the process (Lin et al. 2008, Martinez et al. 2005). The male inflates his pouch and begins to pursue the female to signal that he is ready to mate. A series of movements follows, including head pointing and the entwining of tails (Lin et al. 2008). Mating behavior culminates in copulation, as the female transfers her eggs to the brood pouch of the male. The male then seals the pouch and fertilizes the eggs. After the male gives birth, courtship may resume immediately.Embryology & Development: Clutch sizes in females may exceed 1000 (Teixeira & Musik 2001), and the reported brood size in males ranges from 97 to 1,552 eggs. The average diameter of eggs is 1.5 mm (Vincent 1990), approximately 2-33% of which were found to be sterile (Teixeira & Musik 2001). The brood pouch of the male acts as a marsupium, protecting the developing embryos and providing them with oxygen through a capillary network. The pouch also serves as an adaptation chamber, altering sodium and calcium concentrations as development progresses until they are similar to the surrounding seawater prior to birth (Linton & Soloff 1964). The average gestation period for H. erectus is 20-21 days (Herald & Rakowicz 1951), and the male gives birth to fry approximately 11 mm in length (eg. Herald & Rakowicz 1951) over the course of about 3 days (eg. Lin et al. 2008). Breeding spans from May to October for populations in the Chesapeake Bay (Teixeira & Musik 2001), with the largest densities of individuals occurring in July for south Florida populations (Powell et al. 2007).
  • Robins, CR & GC Ray. 1986. A field guide to Atlantic coast fishes of North America. Houghton Mifflin Co. New York. USA. 354 pp.
  • Powell, AB, Thayer, G, Lacroix, M & R Cheshire. 2007. Juvenile and small resident fishes of Florida Bay, a critical habitat in the Everglades National Park, Florida. NOAA Professional Paper NMFS 6: 105-108. National Marine Fisheries Service. Seattle, WA. USA.
  • Adams, C, Larkin, S & D Lee. 2001. Volume and value of marine ornamentals collected in Florida, 1990-1998. Aquar. Sci. Conserv. 3: 25-36.Azzarello, MY. 1991. Some questions concerning the Syngnathidae brood pouch. Bull. Mar. Sci. 49: 741-747.
  • Baum, JK, Meeuwig, JJ & ACJ Vincent. 2003. Bycatch of lined seahorses (Hippocampus erectus) in a Gulf of Mexico shrimp trawl fishery. Fish. Bull. 101: 721-731.
  • Bergert, BA & PC Wainwright. 1997. Morphology and kinematics of prey capture in the syngnathid fishes Hippocampus erectus and Syngnathus floridae. Mar. Biol. 127: 563-570.
  • Blasiola, GCJ. 1979. Glugea heraldi n. sp. (Microsporida, Glugeidae) from the seahorse Hippocampus erectus Perry. J. Fish Diseases. 2: 493-500.
  • Blazer, S & RE Wolke. 1979. An Exophiala-like fungus as the cause of a systemic mycosis of marine fish. J. Fish Diseases. 2: 145-152.
  • Branch, GM. 1966. Contributions to the functional morphology of fishes.The feeding mechanism of Syngnathus acus Linnaeus. Zoologica African. 2: 69-89.
  • Breder, CM, Jr. 1948. Field book of marine fishes of the Atlantic coast from Labrador of Texas. Putman, NY. USA. 332 pp.
  • Cheung, PJ, Nigrelli, RF & GD Ruggieri. 1980. Studies of the morphology of Uronema marinum Dujardin (Ciliatea: Uronematidae) with a description of the histopathology of the infection in marine fishes. J. Fish Diseases. 3: 295-303.
  • CITES. 2004. Seahorses and other members of the family Syngnathidae (decision 12.54) Report of the Working Group. AC20 Doc. 17. Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES). Twentieth meeting of the Animals Committee Johannesburg (South Africa). 29 March-2 April 2004.
  • Colson, DJ, Patek, SN, Brainerd, EL & SM Lewis. 1998. Sound production during feeding in Hippocampus seahorses (Syngnathidae). Env. Biol. Fish. 51: 221-229.
  • Correa, M, Chung, KS & R Manrique. 1989. Cultivo experimental del caballito de mar, Hippocampus erectus. Bol. Inst. Ocean. Venezuela Univ. Oriente. 28: 191-196.
  • Fish, MP. 1953. The production of underwater sound by the northern seahorse, Hippocampus hudsonius. Copeia. 1953: 98-99.
  • Fish, MP. 1954. The character and significance of sound production among fishes of the western North Atlantic. Bull. Bingham Oceanogr. Coll. 14: 1-109.
  • Fish, MP, Kelsey, AS, Jr. & WH Mowbray. 1952. Studies on the production of underwater sounds by North Atlantic coastal fishes. J. Mar. Res. 11: 180-193.
  • Fish, MP & WH Mowbray. 1970. Sounds of western North Atlantic fishes. Johns Hopkins Press. Baltimore, MD. USA. 207 pp.
  • Foster, SJ & ACJ Vincent. 2004. Life history and ecology of seahorses: implications for conservation and management. J. Fish Biol. 65: 1-61.
  • Foster, SJ, Marsden, AD & ACJ Vincent. 2003. Hippocampus erectus. IUCN 2004. 2004 IUCN Red List of Threatened Species.Gill, T. 1905. The life history of sea horses (hippocampids). Proc. US Nat. Mus. 28: 805-814.
  • Hardy, JD. 1978. Development of fishes of the Mid-Atlantic Bight: an atlas of egg, larval and juvenile stages - Volume II. Anguillidae through Syngnathidae. US Fish & Wildlife Service, Office of Biological Sciences. Washington, DC. USA.
  • Herald, ES & M Rakowicz. 1951. Stable requirements for raising sea horses. Aquarium J. 22: 234-242.
  • IUCN (International Union for Conservation of Nature and Natural Resources). 2002. 2002 IUCN red list of threatened species. IUCN, Gland, Switzerland & Cambridge, UK. (www.redlist.org).
  • James, PL & KL Heck, Jr. 1994. The effects of habitat complexity and light intensity on ambush predation within a simulated seagrass habitat. J. Exp. Mar. Biol. Ecol. 176: 187-200.
  • James, P & C Woods. 2001. Rearing seahorses: does temperature matter? Aquac. Update. 28: 9-10.
  • Job, SD, Do, HH, Meeuwig, JJ & HJ Hall. 2002. Culturing the oceanic seahorse, Hippocampus kuda. Aquaculture. 214: 333-341.
  • Jones, SE. 2007. Variations in feeding kinematics of western Atlantic seahorses. Master's Thesis. Florida Institute of Technology. Melbourne, FL. USA. 140 pp.
  • Kvarnemo, C, Moore, GL, Jones, AG, Nelson, WS & JC Avise. 2000. Monogamous pair bonds and mate switching in the western Australian seahorse Hippocampus subelongatus. J. Evol. Biol. 13: 882-888.
  • Larkin, SL & RL Degner. 2001. The US wholesale market for marine ornamentals. Aquar. Sci. Conserv. 3: 13-24.
  • Lin, Q, Lin, J & D Zhang. 2008. Breeding and juvenile culture of the lined seahorse, Hippocampus erectus Perry, 1810. Aquaculture. 277: 287-292.
  • Lauder, GV. 1985. Aquatic feeding in lower vertebrates. 210-229. In: Hildebrand, M, Bramble, DM, Liem, KF & DB Wake, eds. Functional vertebrate morphology. Harvard University Press. Cambridge.
  • Lin, Q, Lu, JY & YL Gao. 2006. The effect of temperature on gonad, embryonic development and survival rate of juvenile seahorses, Hippocampus kuda Bleeker. Aquaculture. 254: 701-713.
  • Lin, Q, Gao, YL, Sheng, JQ, Chen, QX, Zhang, B & JY Lu. 2007. The effect of food and the sum of effective temperature on the embryonic development of the seahorse, Hippocampus kuda Bleeker. Aquaculture. 262: 481-492.
  • Linton, JR & BL Soloff. 1964. The physiology of the brood pouch of the male sea horse Hippocampus erectus. Bull. Mar. Sci. Gulf Carib. 14: 45-61.
  • Lockyear, J, Kaiser, H, & T Hecht. 1997. Studies on the captive breeding of the Knysna seahorse, Hippocampus capensis. Aquat. Sci. Conserv. 1: 129-136.
  • Lourie, SA, Foster, SJ, Cooper, EWT & ACJ Vincent. 2004. A guide to the identification of seahorses. Project Seahorse & TRAFFIC North America. University of British Columbia and World Wildlife Fund. Washington, DC. USA.
  • Lourie, SA, Vincent, AC & HJ Hall. 1999. Seahorse: An identification guide to the world's species and their conservation. Project Seahorse. London, UK.
  • Lu, JY, Wu, JY & DW Yang. 2001. Growth rate of Hippocampus kuda Bleeker under intensive culture. J. Fish. China. 26: 61-66.
  • Martinez, A, Gardner, T & D Littlehale. 2005. Lined seahorse, Hippocampus erectus. In: Koldewey, H, ed. Syngnathid husbandry in public aquariums. Project Seahorse and Zoological Society of London. Vancouver, BC. Canada.
  • Matlock, GC. 1992. Life history aspects of seahorses, Hippocampus, in Texas. Texas J. Sci. 44: 213-222.
  • Monteiro-Neto, C, de Andrade Cunha, FE, Nottingham, MC, Araújo, ME, Rosa, IL & GML Barros. 2003. Analysis of the marine ornamental fish trade at Ceará State, northeast Brazil. Biodiv. Conserv. 12: 1287-1295.
  • Muller, M. 1987. Optimization principles applied to the mechanism of neurocranium elevation and mouth bottom depression in bony fishes (Halecostomi). J. Theor. Biol. 126: 343-368.
  • Muller, M & JWM Osse. 1984. Hydrodynamics of suction feeding in fish. Trans. Zool. Soc. Lond. 37: 51-135.
  • Murdy, EO, Birdsong, RS & JA Musik. 1997. Fishes of Chesapeake Bay. Smithsonian Institution Press. Washington, DC. USA. 324 pp.
  • Osse, JWM & M Muller. 1980. A model of suction feeding in teleostean fishes with some implications for ventilation. In: Ali, MA, ed. Environmental physiology of fishes. NATO-ASI Series A. Life Sciences. Plenum Publishing. New York, NY. USA. 335-352.
  • Perante, NC, Pajaro, MG, Meeuwig, JJ & ACJ Vincent. 2002. Biology of Hippocampus comes in the central Philippines. J. Fish Biol. 60: 821-837.
  • Reid, GK, Jr. 1954. An ecological study of the Gulf of Mexico fishes in the vicinity of Cedar Key, Florida. Bull. Mar. Sci. 4: 1-94.
  • Scarratt, AM. 1995. Techniques for raising lined seahorses (Hippocampus erectus). Aquar. Front. 3: 24-29.
  • Sheng, JQ, Lin, Q, Chen, QX, Gao, YL, Shen, L & JY Lu. 2006. Effects of food, temperature and light intensity on the feeding behavior of three-spot juveniles, Hippocampus trimaculatus Leach. Aquaculture. 256: 596-607.
  • Sogard, SM, Powell, GVN & JG Holmquist. 1987. Epibenthic fish communities of Florida Bay banks: relations with physical parameters and seagrass cover. Mar. Ecol. Prog. Ser. 40: 25-39.
  • Strawn, K. 1958. Life history of the pigmy seahorse, Hippocampus zostrae Jordan and Gilbert, at Cedar Key, Florida. Copeia 1: 16-22.
  • Teixeira, RL & JA Musik. 2000. Reproduction and food habits of the lined seahorse, Hippocampus erectus (Teleostei: Syngnathidae) of Chesapeake Bay, Virginia. Rev. Bras. Biol. 61: 79-90.
  • Urick, RJ. 1983. Principles of underwater sound, 3rd edition. McGraw Hill. New York, NY. USA. 423 pp.
  • Vari, RP. 1982. Fishes of the western North Atlantic, subfamily Hippocampus campinae. The seahorses. 173-189. Sears Foundation for Marine Research Memoir 1. Yale Univ. New Haven, CT. USA.
  • Vincent, ACJ. 1990. Reproductive ecology of seahorses. PhD Dissertation. Cambridge University, UK.Vincent, ACJ. 1995. A role for daily greetings in maintaining seahorse pair bonds. Anim. Behav. 49: 258-260.
  • Vincent, ACJ. 1996. The international trade in seahorses. TRAFFIC International. Cambridge, UK. 164 pp.Vincent, ACJ & RS Clifton-Hadley. 1989. Parasitic infection of the seahorse (Hippocampus erectus) - A case report. J. Wildlife. Diseases. 25: 404-406.
  • Vincent, ACJ, Evans, KL & AD Marsden. 2003. Home range behavior of the monogamous Australian seahorse, Hippocampus whitei. Env. Biol. Fishes. 72: 1-12.
  • Vincent, ACJ & LM Sadler. 1995. Faithful pair bonds in wild seahorses, Hippocampus whitei. Anim. Behav. 50: 1557-1569.
  • Wong, JM & JAH Benzie. 2003. The effects of temperature, Artemia enrichment, stocking density and light on the growth of juvenile seahorses, Hippocampus whitei (Bleeker, 1855), from Australia. Aquaculture. 228: 107-121.
  • Woods, CMC. 2003a. Growth and survival of juvenile seahorse Hippocampus abdominalis reared on live, frozen and artificial foods. Aquaculture. 220: 287-298.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Breeding is in the summer. The female deposits eggs into the marsupium, the external brood pouch of the male. There are repeated pairings. A male may nurse as many as 150 eggs. After the yolk sac is absorbed, the father squeezes the young out of the broods sac. The young resemble adults a few days after hatching.
  • Bigelow, H.B. and Schroeder, W.C., 1953; Lieske, E. and R. Myers, 1994; Lourie, S.A., A.C.J. Vincent and H.J. Hall, 1999; Moe, A.M. Jr., 1992; Schumann, B., 1969; Smith, C.L., 1997; Wicklund, R.I., S.J. Wilk and L. Ogren, 1969.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Hippocampus erectus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTGTACTTAGTATTTGGTGCTTGAGCCGGAATAGTAGGTACTGCACTCAGCCTCTTAATCCGAGCAGAACTAAGTCAACCAGGAGCTTTACTAGGGGACGATCAGATCTATAATGTTATCGTAACTGCTCATGCTTTTGTAATAATTTTTTTTATAGTCATACCTATTATAATTGGGGGTTTTGGTAACTGATTAATCCCGTTAATAATTGGGGCGCCCGATATGGCCTTCCCTCGAATAAATAACATAAGTTTTTGATTACTCCCACCCTCTTTCCTTCTCCTCCTCGCTTCGTCAGGAGTAGAAGCTGGGGCAGGTACAGGTTGAACTGTCTACCCCCCACTAGCAGGCAATTTGGCACACGCCGGAGCCTCTGTAGACTTAACAATCTTTTCTCTTCACCTAGCGGGGGTCTCATCAATTCTAGGGGCTATTAACTTTATTACAACTATTATTAATATAAAACCCCCGTCAATTTCACAATATCAAACACCATTGTTTGTATGAGCAGTTTTAGTAACCGCAGTTCTACTCCTGTTATCCCTACCTGTTCTGGCAGCCGGTATTACTATACTTCTTACAGATCGAAATTTAAATACAACATTTTTCGATCCTTCCGGAGGGGGGGACCCTATCCTGTATCAACACTTATTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Hippocampus erectus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 13
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Seahorse populations in the wild could vanish if they continue to be exploited for traditional Chinese medicines, the aquarium trade, and as tourist curios. Countless seahorses are also lost every year with the destruction of their coral reef, sea grass, and mangrove habitats. More than 20 million seahorses are collected each year, causing some seahorse populations to crash by 50% over the last five years. These and other results from the first major study of the international trade in seahorses released by TRAFFIC, a global wildlife trade monitoring group, suggest that Hippocampus erectus should be considered threatened. (Coral Forest)

IUCN Red List of Threatened Species: vulnerable

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A4cd

Version
3.1

Year Assessed
2003
  • Needs updating

Assessor/s
Project Seahorse

Reviewer/s
Foster, S.J., Marsden, A.D. & Vincent, A.C.J. (Syngnathid Red List Authority)

Contributor/s

Justification
H. erectus is listed as Vulnerable (VU A4cd) based on inferred declines of at least 30% caused by targeted catch, incidental capture, and habitat degradation. While there is little information on changes in numbers of the species, there is indirect evidence to suggest that declines have taken place and are continuing. This listing is consistent with the precautionary approach of the IUCN.

Hippocampus erectus is traded for use as aquarium fishes, curios and traditional Chinese medicine (TCM) (Vincent and Perry, in prep.). This species is also incidentally caught, as bycatch, in shrimp trawl and other fisheries in Florida (Baum et al. in review), Mexico (J. Baum, unpublished data), Central America (Belize, Honduras, Nicaragua) (J. Baum, unpublished data) and South America (Argentina, Brazil) (I. Rosa and J. Baum, unpublished data). This species is also affected by habitat degradation due to coastal development and pollution. Given that H. erectus is among the most commonly traded seahorse species, particularly for ornamental display, fishers' and traders' evidence of declines in seahorse availability raise concern for this species.

History
  • 1996
    Vulnerable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Vulnerable (VU) on the IUCN Red List 2006 (1), and listed on Appendix II of CITES (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Project Seahorse trade surveys conducted between 2000–2001 indicated that seahorse numbers in the wild appear to have declined in the Western Atlantic (Caribbean and Gulf of Mexico), with fishers reporting decreases in catch of seahorses (proportion of declines that can be attributed to H. erectus is unknown). On the coast of Mexico 21/29 fishers in five locations reported declines in seahorses due to the shrimp trawl fishery. Of the 14 fishers who provided quantified catch estimates, eight estimated declines between 75–90% in the past 10–30 years (J. Baum unpublished data). In Brazil 25/29 fishers surveyed reported declines in seahorse catches due to heavy fishing pressures (I. Rosa, unpublished data). In Honduras 70% of interviewed fishers (n=9) believed there has been a decline in abundance (J. Baum, unpublished data). While we recognize that these surveys and reported population declines do not encompass the global range of H. erectus, we have chosen to take the precautionary approach of assigning VU.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Hippocampus erectus is traded dried as traditional medicine (TM), curios and live for aquariums (Vincent and Perry, in prep.). This is a popular aquarium fish in North America. In Florida alone, thousands of H. erectus are collected each year for the aquarium trade (P. LaFrance, unpublished data). Hippocampus erectus is Brazil’s 6th most important marine ornamental export (Monteiro-Neto et al. 2000). In addition to being sold as TM, H. erectus are sold as curios in Mexico along the Caribbean coast (J. Baum, unpublished data). Hippocampus erectus are often brought up as bycatch by shrimp trawling operations in Florida (Baum et al. 2003), and in Mexico seahorse population declines are attributed to indirect harvesting by the shrimp trawl fishery (J. Baum, unpublished data). In Central America H. erectus are brought up in the shrimp trawls in Belize, Honduras, and Nicaragua, and are exported as TCM, or sold on both coasts as curios (J. Baum, unpublished data). Similarly in South America H. erectus are among the bycatch of shrimp trawls in Mar del Plata, Argentina (L. Magnasco in litt. to A. Vincent 23 May 1999), and in Brazil (I. Rosa and J. Baum, unpublished data).

The preferred habitat of H. erectus is also declining due to coastal development, pollution, and increased sedimentation. For example, in NE Brazil the development of shrimp farms has destroyed much of the coastal mangrove habitats where seahorses live (J. Gomezjuardo in litt. to A. Vincent Sept. 1999).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Vulnerable (VU) (A4cd)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

All 33 species of Hippocampus are listed on Appendix II of the Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES 2004).The lined seahorse is listed as "Vulnerable" by the International Union for Conservation of Nature and Natural Resources (IUCN 2002).Mexican populations of H. erectus are included on the country's endangered species list (Norma Oficial Mexicana NOM-059-SEMARNAT-2001). In addition, Mexico prohibits the intentional capture and trade of wild seahorses, permitting only incidental catches and culturing of captive populations (Lourie et al. 2004).
  • Robins, CR & GC Ray. 1986. A field guide to Atlantic coast fishes of North America. Houghton Mifflin Co. New York. USA. 354 pp.
  • Powell, AB, Thayer, G, Lacroix, M & R Cheshire. 2007. Juvenile and small resident fishes of Florida Bay, a critical habitat in the Everglades National Park, Florida. NOAA Professional Paper NMFS 6: 105-108. National Marine Fisheries Service. Seattle, WA. USA.
  • Adams, C, Larkin, S & D Lee. 2001. Volume and value of marine ornamentals collected in Florida, 1990-1998. Aquar. Sci. Conserv. 3: 25-36.Azzarello, MY. 1991. Some questions concerning the Syngnathidae brood pouch. Bull. Mar. Sci. 49: 741-747.
  • Baum, JK, Meeuwig, JJ & ACJ Vincent. 2003. Bycatch of lined seahorses (Hippocampus erectus) in a Gulf of Mexico shrimp trawl fishery. Fish. Bull. 101: 721-731.
  • Bergert, BA & PC Wainwright. 1997. Morphology and kinematics of prey capture in the syngnathid fishes Hippocampus erectus and Syngnathus floridae. Mar. Biol. 127: 563-570.
  • Blasiola, GCJ. 1979. Glugea heraldi n. sp. (Microsporida, Glugeidae) from the seahorse Hippocampus erectus Perry. J. Fish Diseases. 2: 493-500.
  • Blazer, S & RE Wolke. 1979. An Exophiala-like fungus as the cause of a systemic mycosis of marine fish. J. Fish Diseases. 2: 145-152.
  • Branch, GM. 1966. Contributions to the functional morphology of fishes.The feeding mechanism of Syngnathus acus Linnaeus. Zoologica African. 2: 69-89.
  • Breder, CM, Jr. 1948. Field book of marine fishes of the Atlantic coast from Labrador of Texas. Putman, NY. USA. 332 pp.
  • Cheung, PJ, Nigrelli, RF & GD Ruggieri. 1980. Studies of the morphology of Uronema marinum Dujardin (Ciliatea: Uronematidae) with a description of the histopathology of the infection in marine fishes. J. Fish Diseases. 3: 295-303.
  • CITES. 2004. Seahorses and other members of the family Syngnathidae (decision 12.54) Report of the Working Group. AC20 Doc. 17. Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES). Twentieth meeting of the Animals Committee Johannesburg (South Africa). 29 March-2 April 2004.
  • Colson, DJ, Patek, SN, Brainerd, EL & SM Lewis. 1998. Sound production during feeding in Hippocampus seahorses (Syngnathidae). Env. Biol. Fish. 51: 221-229.
  • Correa, M, Chung, KS & R Manrique. 1989. Cultivo experimental del caballito de mar, Hippocampus erectus. Bol. Inst. Ocean. Venezuela Univ. Oriente. 28: 191-196.
  • Fish, MP. 1953. The production of underwater sound by the northern seahorse, Hippocampus hudsonius. Copeia. 1953: 98-99.
  • Fish, MP. 1954. The character and significance of sound production among fishes of the western North Atlantic. Bull. Bingham Oceanogr. Coll. 14: 1-109.
  • Fish, MP, Kelsey, AS, Jr. & WH Mowbray. 1952. Studies on the production of underwater sounds by North Atlantic coastal fishes. J. Mar. Res. 11: 180-193.
  • Fish, MP & WH Mowbray. 1970. Sounds of western North Atlantic fishes. Johns Hopkins Press. Baltimore, MD. USA. 207 pp.
  • Foster, SJ & ACJ Vincent. 2004. Life history and ecology of seahorses: implications for conservation and management. J. Fish Biol. 65: 1-61.
  • Foster, SJ, Marsden, AD & ACJ Vincent. 2003. Hippocampus erectus. IUCN 2004. 2004 IUCN Red List of Threatened Species.Gill, T. 1905. The life history of sea horses (hippocampids). Proc. US Nat. Mus. 28: 805-814.
  • Hardy, JD. 1978. Development of fishes of the Mid-Atlantic Bight: an atlas of egg, larval and juvenile stages - Volume II. Anguillidae through Syngnathidae. US Fish & Wildlife Service, Office of Biological Sciences. Washington, DC. USA.
  • Herald, ES & M Rakowicz. 1951. Stable requirements for raising sea horses. Aquarium J. 22: 234-242.
  • IUCN (International Union for Conservation of Nature and Natural Resources). 2002. 2002 IUCN red list of threatened species. IUCN, Gland, Switzerland & Cambridge, UK. (www.redlist.org).
  • James, PL & KL Heck, Jr. 1994. The effects of habitat complexity and light intensity on ambush predation within a simulated seagrass habitat. J. Exp. Mar. Biol. Ecol. 176: 187-200.
  • James, P & C Woods. 2001. Rearing seahorses: does temperature matter? Aquac. Update. 28: 9-10.
  • Job, SD, Do, HH, Meeuwig, JJ & HJ Hall. 2002. Culturing the oceanic seahorse, Hippocampus kuda. Aquaculture. 214: 333-341.
  • Jones, SE. 2007. Variations in feeding kinematics of western Atlantic seahorses. Master's Thesis. Florida Institute of Technology. Melbourne, FL. USA. 140 pp.
  • Kvarnemo, C, Moore, GL, Jones, AG, Nelson, WS & JC Avise. 2000. Monogamous pair bonds and mate switching in the western Australian seahorse Hippocampus subelongatus. J. Evol. Biol. 13: 882-888.
  • Larkin, SL & RL Degner. 2001. The US wholesale market for marine ornamentals. Aquar. Sci. Conserv. 3: 13-24.
  • Lin, Q, Lin, J & D Zhang. 2008. Breeding and juvenile culture of the lined seahorse, Hippocampus erectus Perry, 1810. Aquaculture. 277: 287-292.
  • Lauder, GV. 1985. Aquatic feeding in lower vertebrates. 210-229. In: Hildebrand, M, Bramble, DM, Liem, KF & DB Wake, eds. Functional vertebrate morphology. Harvard University Press. Cambridge.
  • Lin, Q, Lu, JY & YL Gao. 2006. The effect of temperature on gonad, embryonic development and survival rate of juvenile seahorses, Hippocampus kuda Bleeker. Aquaculture. 254: 701-713.
  • Lin, Q, Gao, YL, Sheng, JQ, Chen, QX, Zhang, B & JY Lu. 2007. The effect of food and the sum of effective temperature on the embryonic development of the seahorse, Hippocampus kuda Bleeker. Aquaculture. 262: 481-492.
  • Linton, JR & BL Soloff. 1964. The physiology of the brood pouch of the male sea horse Hippocampus erectus. Bull. Mar. Sci. Gulf Carib. 14: 45-61.
  • Lockyear, J, Kaiser, H, & T Hecht. 1997. Studies on the captive breeding of the Knysna seahorse, Hippocampus capensis. Aquat. Sci. Conserv. 1: 129-136.
  • Lourie, SA, Foster, SJ, Cooper, EWT & ACJ Vincent. 2004. A guide to the identification of seahorses. Project Seahorse & TRAFFIC North America. University of British Columbia and World Wildlife Fund. Washington, DC. USA.
  • Lourie, SA, Vincent, AC & HJ Hall. 1999. Seahorse: An identification guide to the world's species and their conservation. Project Seahorse. London, UK.
  • Lu, JY, Wu, JY & DW Yang. 2001. Growth rate of Hippocampus kuda Bleeker under intensive culture. J. Fish. China. 26: 61-66.
  • Martinez, A, Gardner, T & D Littlehale. 2005. Lined seahorse, Hippocampus erectus. In: Koldewey, H, ed. Syngnathid husbandry in public aquariums. Project Seahorse and Zoological Society of London. Vancouver, BC. Canada.
  • Matlock, GC. 1992. Life history aspects of seahorses, Hippocampus, in Texas. Texas J. Sci. 44: 213-222.
  • Monteiro-Neto, C, de Andrade Cunha, FE, Nottingham, MC, Araújo, ME, Rosa, IL & GML Barros. 2003. Analysis of the marine ornamental fish trade at Ceará State, northeast Brazil. Biodiv. Conserv. 12: 1287-1295.
  • Muller, M. 1987. Optimization principles applied to the mechanism of neurocranium elevation and mouth bottom depression in bony fishes (Halecostomi). J. Theor. Biol. 126: 343-368.
  • Muller, M & JWM Osse. 1984. Hydrodynamics of suction feeding in fish. Trans. Zool. Soc. Lond. 37: 51-135.
  • Murdy, EO, Birdsong, RS & JA Musik. 1997. Fishes of Chesapeake Bay. Smithsonian Institution Press. Washington, DC. USA. 324 pp.
  • Osse, JWM & M Muller. 1980. A model of suction feeding in teleostean fishes with some implications for ventilation. In: Ali, MA, ed. Environmental physiology of fishes. NATO-ASI Series A. Life Sciences. Plenum Publishing. New York, NY. USA. 335-352.
  • Perante, NC, Pajaro, MG, Meeuwig, JJ & ACJ Vincent. 2002. Biology of Hippocampus comes in the central Philippines. J. Fish Biol. 60: 821-837.
  • Reid, GK, Jr. 1954. An ecological study of the Gulf of Mexico fishes in the vicinity of Cedar Key, Florida. Bull. Mar. Sci. 4: 1-94.
  • Scarratt, AM. 1995. Techniques for raising lined seahorses (Hippocampus erectus). Aquar. Front. 3: 24-29.
  • Sheng, JQ, Lin, Q, Chen, QX, Gao, YL, Shen, L & JY Lu. 2006. Effects of food, temperature and light intensity on the feeding behavior of three-spot juveniles, Hippocampus trimaculatus Leach. Aquaculture. 256: 596-607.
  • Sogard, SM, Powell, GVN & JG Holmquist. 1987. Epibenthic fish communities of Florida Bay banks: relations with physical parameters and seagrass cover. Mar. Ecol. Prog. Ser. 40: 25-39.
  • Strawn, K. 1958. Life history of the pigmy seahorse, Hippocampus zostrae Jordan and Gilbert, at Cedar Key, Florida. Copeia 1: 16-22.
  • Teixeira, RL & JA Musik. 2000. Reproduction and food habits of the lined seahorse, Hippocampus erectus (Teleostei: Syngnathidae) of Chesapeake Bay, Virginia. Rev. Bras. Biol. 61: 79-90.
  • Urick, RJ. 1983. Principles of underwater sound, 3rd edition. McGraw Hill. New York, NY. USA. 423 pp.
  • Vari, RP. 1982. Fishes of the western North Atlantic, subfamily Hippocampus campinae. The seahorses. 173-189. Sears Foundation for Marine Research Memoir 1. Yale Univ. New Haven, CT. USA.
  • Vincent, ACJ. 1990. Reproductive ecology of seahorses. PhD Dissertation. Cambridge University, UK.Vincent, ACJ. 1995. A role for daily greetings in maintaining seahorse pair bonds. Anim. Behav. 49: 258-260.
  • Vincent, ACJ. 1996. The international trade in seahorses. TRAFFIC International. Cambridge, UK. 164 pp.Vincent, ACJ & RS Clifton-Hadley. 1989. Parasitic infection of the seahorse (Hippocampus erectus) - A case report. J. Wildlife. Diseases. 25: 404-406.
  • Vincent, ACJ, Evans, KL & AD Marsden. 2003. Home range behavior of the monogamous Australian seahorse, Hippocampus whitei. Env. Biol. Fishes. 72: 1-12.
  • Vincent, ACJ & LM Sadler. 1995. Faithful pair bonds in wild seahorses, Hippocampus whitei. Anim. Behav. 50: 1557-1569.
  • Wong, JM & JAH Benzie. 2003. The effects of temperature, Artemia enrichment, stocking density and light on the growth of juvenile seahorses, Hippocampus whitei (Bleeker, 1855), from Australia. Aquaculture. 228: 107-121.
  • Woods, CMC. 2003a. Growth and survival of juvenile seahorse Hippocampus abdominalis reared on live, frozen and artificial foods. Aquaculture. 220: 287-298.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lined seahorses are threatened by targeted catch and incidental capture by fisheries, as well as by habitat degradation (1). There is a huge demand for this species, which is sold live to the aquarium trade, and dried as curios and traditional Chinese medicine (4). As such, this is among the most commonly caught seahorses (1) (4). The lined seahorse is a particularly popular aquarium fish in North America, with thousands collected each year in Florida alone, destined for the aquarium trade. This species is Brazil's 6th most important marine ornamental export, and is also sold dried as curios in Mexico along the Caribbean coast (1). Dried specimens are also traded as traditional Chinese medicine (1), being considered by some as a powerful aphrodisiac, and used to treat an array of ailments from impotence and infertility to asthma, throat infections and lethargy (4). Shrimp and other trawl fisheries are responsible for much of the indirect harvesting of this seahorse through incidental capture as bycatch. Additionally, the lined seahorse has been affected by habitat degradation caused by coastal development, pollution and increased sedimentation. In northeast Brazil, for example, the development of shrimp farms has destroyed much of the coastal mangrove habitats where seahorses live (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The entire genus Hippocampus was listed in Appendix II of CITES in November 2002. Implementation of this listing will begin May 2004. Full monitoring of the trade is underway in the United States, however this is dependent on traders’ declarations. Seahorses are listed under Title 68 (Rules of the Fish and Wildlife Conservation Commission) of the Florida Administrative Codes. The targeted fishery for the aquarium trade in Florida is monitored and regulations are in place, such as a limitation on the number of commercial harvesters, however the non-selective exploitation is not monitored in any state. Hippocampus erectus are considered threatened in the states of Sao Paulo and Rio de Janeiro in Brazil. Their status has not been evaluated in the other states
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

All seahorses are listed on Appendix II of CITES, which permits only individuals over 10 cm to be landed, in order to allow continued reproduction (1) (6). Trade is also fully monitored in the U.S., although relies on the honesty of traders' declarations. Targeted fisheries for the aquarium trade are monitored and regulated in Florida, with limitations on the number of commercial harvesters. However, non-selective exploitation through incidental capture is not monitored in any state (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Worldwide there is a huge demand for seahorses for traditional Chinese medicine and the aquarium trade. Seahorses are considered a powerful aphrodisiac and are used to treat an array of ailments including asthma, impotence, infertility, throat infections and lethargy. Seahorses are also extremely popular in the aquarium trade and as tourist curios. (Coral Forest)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Importance

fisheries: minor commercial; aquarium: commercial; price category: unknown; price reliability:
  • Vincent, A.C.J. 1996 The international trade in seahorses. TRAFFIC International, Cambridge, UK. 163 p. (Ref. 12238)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Lined seahorse

The lined seahorse (Hippocampus erectus), northern seahorse or spotted seahorse is a species of fish that belongs to the Syngnathidae family.[2] H. erectus is a diurnal species with an approximate length of 15 centimeters (5.9 inches) and lifespan of one to four years. The H. erectus species can be found with a myriad of colors, from greys and blacks to reds, greens, and oranges. The lined seahorse lives in the Atlantic Ocean as far north as Canada and as far south as the Caribbean, Mexico, and Venezuela. It swims in an erect position and uses its dorsal and pectoral fins for guidance while swimming.

Lined seahorses feed mainly on minute crustaceans and brine shrimp, which they suck in through their snout. They are able to suck their prey by creating a current of water leading directly into its snout. Since seahorses are weak swimmers, they must ambush their prey by blending into their surroundings, which they do rather easily. The lined seahorse's eyes can move independently of one another, allowing it to effectively scan its surroundings. The species is sexually dimorphic and it is easy to distinguish between a male and female lined seahorse. The males are larger and also have longer tails. The lined seahorse is monogamous and performs ritual dances every morning to reestablish the bond with its mate. In addition, they create clicking sounds while embracing their partner. This action occurs when they initially find their mate. The intensity of their bond is also conveyed in how they handle the death of their partner: If either the male or female should die, the mate does not automatically replace the deceased mate with a new one. Often, it fails to find a new mate in its short lifespan.

An uncommon trait of the lined seahorse is that the male is the caregiver. During intercourse, the female sprays her eggs into the male's brood pouch where the eggs will incubate for 20–21 days. When the juveniles are ready to hatch, the male attaches its tail to a stationary structure and begins to arch its back, back and forth, releasing the juveniles into the water column. The juveniles are approximately 11 mm at birth. They quickly begin to learn and mimic the behavior of its parent. Courtship between the male and female parents begin immediately after birth.

The habitat of the lined seahorse is diminishing due to coastal growth and pollution, which ultimately is the cause of the decreasing population. The lined seahorse is also used as Chinese medicine and is common in the aquarium trade, contributing to its "vulnerable" status.

Description[edit]

This image shows the bony structure of the lined seahorse.

The lined seahorse was first named Hippocampus Erectus by George Perry in 1810.[3] "Hippocampus" translates into "horse or sea monster" in ancient Greek.[4] The lined seahorse is a diurnal species that ranges in length from 12 cm to 17 cm; the maximum length reported for the species is 19 cm. The lined seahorse is sexually dimorphic, meaning there are distinct differences in appearances of males and females; most notably the brood pouch located on the male's abdomen which it utilized in reproduction. Males are also slightly larger in size and have longer prehensile tails than the females. In the wild, the lined seahorse has a lifespan of one to four years; however, in captivity their lifespan usually reaches the full four years. Four years is the maximum age reported for the species.[5] They have a broad color spectrum, ranging from black, grey, brown, and green, to orange, red, and yellow. They tend to be paler on their front side.[4] However, their colors change due to altercations in their environment, diet, anxiety or stress level, and/or mood.[6] The lined seahorse is brawny and upright in appearance. They have an armor-like body composed of approximately fifty bony plates. Together these bony plates form the outer skeleton of the species. It is common for the species to have white lines outlining the neck area—hence its common name, "lined seahorse"—and for tiny white dots to be present on the tail. The prehensile tail consists of numerous rings and the first, third, fifth, seventh, and eleventh may protrude farther outward than the remaining. The prehensile tail following the bony plates is utilized by the seahorse to grasp onto its environment composed of seaweed and coral. The tail curls forward and is seldom aligned. When a lined seahorse is very young (two weeks to four weeks), the tail is extremely limber. The snout length is approximately half the head length of the lined seahorse. The cheek spines, located diagonally down from the eye on either side may be single or double. In total, the lined seahorse has eleven trunk rings, 34–39 tail rings, 16–20 dorsal fin rays, and 14–18 pectoral fin rays. The pectoral fin is level with the eye on each back side of the lined seahorse's head. The dorsal fin is located on the back of the skeleton and is level with the stomach–chest area. Female dorsal fins are slightly larger than the male's and are located lower on the back. The eyes of the lined seahorse can concentrate together, or they can operate independently of one another.[7] The lined seahorse may be considered sexually mature as early as four months; however, it is typically about eight months. The minimum size of a sexually mature lined seahorse is 5.6 cm.[6][8]

Habitat and distribution[edit]

The lined seahorse habitat spans from the northern point of Nova Scotia, Canada,to the southern area of Venezuela in South America. They can be found on the east coast of America in Connecticut, Delaware, Florida, Georgia, Louisiana, Maryland, New Jersey, New York, and North Carolina, as well as in the waters surrounding Mexico and the Caribbean. Species found in Brazil seem to be of a different species; however, more research is needed to determine this proposal. The lined seahorse is native to the following locations: Nova Scotia, Canada, United States, Bermuda, Cuba, Mexico (Veracruz, Yucatán), Haiti, Saint Kitts and Nevis, Belize, Honduras, Nicaragua, Costa Rica, Panama, Guatemala, and Venezuela.

Photograph

The species is found in depths of water up to seventy-three meters. Adults can be found swimming freely in the water column or attached to a stationary object. Juveniles usually swim near the surface.[4] The habitat of the lined seahorse consists of marine vegetation, such as suspended Sargassum, seagrass, sponges, and mangroves. Depending on the season, the species can be found in shallow waters or deep waters along beaches, oyster beds, and banks covered in vegetation, as well as in bays or salt marshes. Lined seahorses can often be found with their tails wrapped around crab pots as well.[9][10] In the winter, the seahorses are more prominent in deeper waters, versus warmer months, where they are usually found in shallow waters attached to vegetation.[11]

The temperature in which the H. erectus dwells varies with the different latitudes. Temperature has an effect on gonad development, brood size, and juvenile development and survival. Many lined seahorses experience temperature fluctuations during the daily tide cycles, the different seasons of each year, and due to precipitation or runoff. Adults have the ability to migrate to deeper waters during cold seasons. A study showed that the highest survival and growth rate of juveniles occurred at 28 to 29 degrees Celsius in captivity. In addition to temperature, there is also a large range of salinity concentration depending on the location that affect the species. The most common salinity is 25 to 35 ppt. In captivity, the species is most commonly kept at 35 ppt.[8] The H. erectus is the only species of seahorse native to the Chesapeake Bay.[10]

Diet[edit]

The lined seahorse utilizes its elongated snout in order to consume its prey, consisting primarily of minute crustaceans, mollusks, and zoo plankton. Unfortunately, some captive parental males have been known to cannibalize small number of its own fry, or juveniles, following its release into natural habitat. In order to ambush its prey, the seahorse employs color changes to camouflage itself with its surrounding environment, locates the prey, and then jerks its head upward, forcing the prey in the right position to be sucked in through its tubular snout. The lined seahorse is highly accurate, especially if its prey is within one inch from its snout. Overall, this process is quick and accurate. A growing lined seahorse may feed continuously for up to ten hours a day, engulfing approximately 3,600 baby brine shrimp.[7][8][11]

Predators and parasites[edit]

Photograph
This sea turtle preys on the H. erectus species.

The predators of the lined seahorse include crabs, rays, various type of sea turtles, skates, seabirds, sharks, tuna, and dolphinfish. Although their camouflage tactics reduce their risk of becoming prey, their poor swimming abilities increase their likelihood of being consumed by their predators, especially large fish.[4][10]

There are many parasites and infections known to affect the lined seahorse, including ciliates (Uronemamarinum), nematodes, fungi, myxosporidian, and microsporidians (Glugea heraldi).[8]

Behavior[edit]

A unique characteristic of the lined seahorse (and other species of seahorse) is their practice of monogamy: the male and female seahorses choose partners that they will continue to mate with for their lifetime.[12] The monogamous characteristics of the lined seahorse include ritual dances with their partner that they perform every morning. These dances establish their permanent relationship as mates. If a male or female lined seahorse should lose their partner for any reason, it takes time before they replace their mate.[7]

Photograph
The fins help guide and propel the seahorse.

Lined seahorses are weak swimmers; they swim in an erect position. In comparison to their fins, the lined seahorse's body is too large, another reason why they are poor swimmers. They do not swim for long periods of time, nor do they travel far distances, unless they are migrating.[10] The lined seahorse propels its body forward with its dorsal and pectoral fins, which they move rapidly back and forth. These fins are also utilized in directing their bodies throughout the water and beat twenty to thirty times per second, making them almost invisible at first glance.[7][10]

In addition to monogamy, the lined seahorse also cues into sound-making in the mating process. The seahorses have a crown-like bony crest called a coronet located on the backside of their head at the edge of the skull. Each coronet is unique to the organism, just as a fingerprint is unique to every human.[10] The coronet resembles a star pattern and is attached rather loosely and has sharp edges.[8] As the seahorse lifts its head, the edge of the skull slides beneath the coronet and out when the seahorse bows its head. As the skull's edge slides beneath and out from the coronet, a clicking sound is produced. Mating seahorses swim slowly together, alternating their clicking sounds, until they embrace one another. Once the male and female seahorse embrace, the sounds from both the male and female unify, becoming indistinguishable from one another. This action creates a louder, consecutive sound, further establishing their bond.[7]

Reproduction[edit]

Photograph
This image shows the prehensile tail utilized in reproduction by the male seahorse.

Like all species of seahorses, the lined seahorse reproduces sexually, laying eggs every season. In addition, the male is the parent that looks after the newborn seahorses. The reproduction process begins at the initiation of the courtship process. Courtship extends for a couple of days and during this process, both the male and female may change to a pale color. The male enlarges his pouch to indicate his desire to pursue the female. Once they are established as monogamous mates though dances and clicking sounds, intercourse takes place.

During intercourse, the female sprays her eggs into the males pouch, which is called a "brood pouch", where they are fertilized and sealed. Females clutch size can be equal to or greater than one thousand and the males' brood size can range from 97 to 1,552 eggs. The number of eggs the female produces varies depending on the size of the seahorse. Six hundred and fifty eggs can be carried by a single male at one time. The eggs are 1.5 mm in diameter. When the eggs are being incubated within the male's pouch, the embryos are provided oxygen via an extensive capillary system. Through this system, the sodium and calcium levels can be altered in order to maintain homeostasis within the pouch environment. When the embryos are approaching birth, the pouch environment is very similar to the seawater. The gestation period lasts for 20–21 days. When the time finally approaches, the male latches his prehensile tail onto a supportive object while he braces back and forth, until the developed seahorses escape from the pouch. The bracing continues until all seahorses have successfully escaped the pouch. However, unhatched seahorses that have died will create a gas within the male's pouch. Soon after, the male seahorse inevitably floats to the surface, only to become easy prey in the marine food chain.[13]

Juveniles are approximately 11 mm at birth for three days and are considered embryos until they are capable of swimming on their own. Juveniles do not reach maximum size until they are 8–10 months of age. It is estimated by scientists that only about two juveniles grow up to be adults out of the hundreds that are hatched.[10] In captivity, the species maintained a vertical growth rate of 0.55 mm a day for 100 days. Male juveniles develop pouches when they are 5–7 months old. The juvenile seahorses quickly develop the characteristic of the adult lined seahorse. After birth, courtship begins once again. Breeding occurs in the months of May through October in the Chesapeake Bay. July is when the lined seahorse population is the greatest in Florida.[7][8][11]

Aquarium life[edit]

The minimum habitat requirements for captive lined seahorses consist of a tank 18 inches vertical in height and 20 to 25 gallons for a pair, 30 to 40 gallons for two pairs. The tank should be kept at a constant temperature between 22 and 25 degrees Celsius (72 and 77 degrees Fahrenheit).[6] The ph value should remain between 8.1 and 8.4 and the specific gravity between 1.020 and 1.025.

Photograph
In this front view of the lined seahorse, the eyes can be seen; they can move independently of one another.

The lined seahorse is an easy going species and will not be a threat to other fish that could possibly be in an aquarium. The seahorse thrives in an environment with objects it can hide around and attach its tail to. The H. erectus species should be fed multiple times throughout the day, rather than less amount of larger meals.[13] In captivity, the lined seahorse is often fed live or frozen nauplius or Mysis shrimp, grass shrimp, adult brine shrimp, gammarids and caprellid amphipods, krill fish fry, and frozen krill.[8]

Obstacles[edit]

The lined seahorse species was listed as vulnerable since 1996 and was listed as vulnerable in the 2003 IUCN assessment, indicating no significant improvements in protective factors.[1] Due to loss or harm to their habitat by pollution and coastal development, accidental catch, or by purposeful catch, the lined seahorse's population is starting to dwindle, by values of at least thirty percent, probably since 1996 when changes in its population size were noted. The H. erectus is a very common species of the aquarium trade, which also affects the population remaining in the wild. The lined seahorse is also used for ornamental decoration and for Chinese medicine. Despite being a popular seahorse for aquarium trade and Chinese medicine, it is only suspected that the species could be a potential candidate for commercial aquaculture. If successful, this could positively affect the population of the lined seahorse.[8][14][15]

References[edit]

  1. ^ a b "Hippocampus erectus". International Union for Conservation of Nature and Natural Resources. 2011. Retrieved 2011-12-08. 
  2. ^ Froese, R.; Pauly, D. "Hippocampus erectus Perry, 1810 Lined Seahorse". FishBase. 
  3. ^ Perry, George; Petit, Richard E. Perry's Arcana. p. 34. 
  4. ^ a b c d Bester, Cathleen. "Lined Seahorse". Florida Museum of Natural History Ichthyology Department. 
  5. ^ Rosamond Gifford Zoo Volunteers (July 23, 2005). "Lined Seahorse". 
  6. ^ a b c "H. erectus". Seahorse Source, Inc. 2005. Retrieved 31 October 2011. 
  7. ^ a b c d e f Gardiner, Nick, University of Michigan. "Hippocampus erectus". Animal Diversity Web. Retrieved 31 October 2011. 
  8. ^ a b c d e f g h Sweat, L.H. "Hippocampus erectus". Smithsonian Marine Station at Fort Pierce 2009. 
  9. ^ "Hippocampus erectus". IUCN Red List of Threatened Species Version 2011 Project Seahorse 2003. 
  10. ^ a b c d e f g Bayville. "Lined Seahorse". 2005 Maryland Public Television. 
  11. ^ a b c "Lined Seahorse". Chesapeake Bay Program (Bay Field Guide). 
  12. ^ Project Seahorse Team". "Introduction to seahorses". Project Seahorse. 
  13. ^ a b "Lined Seahorse". Aquatic Community. 2004. 
  14. ^ Hauter, Stan and Debbie. "Lined Seahorse Profile - Facts, care info, pictures and more on H. erectus". About.com. 
  15. ^ Webster, Pearse; Sedberry, George R. "Lined seahorse". 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!