Overview

Comprehensive Description

Biology

Inhabits shallow coastal waters, including bays and harbors. Occurs in inshore seagrass beds. Prefers flat vegetated bottoms. Rarely found in brackish water. Feeds mainly on small invertebrates.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Western Atlantic: Chesapeake Bay to Florida and northeastern Gulf of Mexico. Not known from the West Indies.
  • Carpenter, K.E. 2003 Sparidae. Porgies. p. 1554-1577. In K.E. Carpenter (ed.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Atlantic. Vol. 3: Bony fishes part 2 (Opistognathidae to Molidae), sea turtles and marine mammals. (Ref. 51715)   http://www.fishbase.org/references/FBRefSummary.php?id=51715&speccode=1231 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Maximum size: 460 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

46.0 cm TL (male/unsexed; (Ref. 7251))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Diplodus holbrookii
Catalog Number: USNM 20979
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): G. Goode
Year Collected: 1878
Locality: Charleston, S.C., South Carolina, United States, Atlantic
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

demersal; brackish; marine; depth range ? - 28 m
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 439 specimens in 1 taxon.
Water temperature and chemistry ranges based on 146 samples.

Environmental ranges
  Depth range (m): 0.925 - 56
  Temperature range (°C): 21.296 - 24.665
  Nitrate (umol/L): 0.409 - 1.979
  Salinity (PPS): 34.478 - 36.255
  Oxygen (ml/l): 4.363 - 5.176
  Phosphate (umol/l): 0.099 - 0.221
  Silicate (umol/l): 0.805 - 1.848

Graphical representation

Depth range (m): 0.925 - 56

Temperature range (°C): 21.296 - 24.665

Nitrate (umol/L): 0.409 - 1.979

Salinity (PPS): 34.478 - 36.255

Oxygen (ml/l): 4.363 - 5.176

Phosphate (umol/l): 0.099 - 0.221

Silicate (umol/l): 0.805 - 1.848
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 28m.
Recorded at 28 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Feeds on plants and benthic invertebrates (Ref. 13805).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Diplodus holbrookii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATCTTGTATTTGGTGCTTGGGCCGGAATAGTARGAACTGCCTTAAGCCTGCTCATTCGAGCCGAACTAAGCCAGCCTGGCGCTCTCCTTGGAGACGACCAGATTTATAATGTAATTGTTACAGCACATGCGTTTGTAATAATTTTCTTTATAGTAATACCAATCATGATTGGAGGCTTCGGAAACTGACTAATCCCACTTATGATCGGTGCCCCTGACATAGCATTCCCCCGAATAAATAACATGAGCTTCTGACTTCTACCCCCCTCATTCCTCCTCCTGCTAGCCTCGTCCGGAGTTGAAGCTGGGGCCGGTACTGGATGAACTGTTTACCCGCCCCTGGCAGGTAACCTCGCTCACGCAGGTGCATCAGTTGACTTAACTATCTTTTCTCTTCACCTGGCCGGAATTTCATCTATTCTTGGTGCCATTAATTTCATTACCACAATTATTAATATGAAACCTCCAGCTATTTCACAATATCAGACGCCATTATTTGTATGGGCCGTCTTAATTACCGCCGTACTTCTTCTCTTATCTCTCCCAGTTCTTGCTGCCGGAATTACAATGCTCCTAACAGATCGAAACCTAAACACCACYTTCTTCGACCCTGCAGGGGGAGGAGACCCGATTCTTTATCAACATCTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Diplodus holbrookii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; price category: high; price reliability: questionable: based on ex-vessel price for species in this genus
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Spottail pinfish

The Spottail pinfish, Diplodus holbrookii, is an ocean-going species of fish in the family Sparidae. It is also known as the Spottail seabream. Along with other members of their family, Spottail pinfish are occasionally eaten and considered by some to be a panfish.[1]

Taxonomy and naming[edit]

T. H. Bean, who described the Spottail pinfish.
John Holbrook, for whom the Spottail pinfish was named .

The Spottail pinfish was described in 1878 by Tarleton Hoffman Bean, an ichthyologist who worked mainly on the Connecticut coast. He originally placed it in the genus Sargus, but it was later moved to Diplodus. Bean named the Spottail pinfish after John Edwards Holbrook, a zoologist who had died 7 years before.

Description[edit]

Spottail pinfish are almost totally gray in color, with a large, black spot on the distal end of the caudal peduncle.[2] This is similar to other members of its genus, Diplodus annularis and Diplodus sargus -though D. sargus has several vertical bars that the Spottail pinfish does not.

Diplodus sargus, a similar species which common to areas where Spottial pinfish are found.

Distribution and habitat[edit]

Spottail pinfish are exclusive to the western Atlantic ocean. They can be found from Chesapeake bay to southern Florida. Spottail pinfish are also known from the northern Gulf of Mexico, but are not known from the West Indies.[3] There are only questionable reports from Cuba.[4]

Spottail pinfish are common to shallow waters (only as deep as 28m) near coasts, such as bays and harbors, though only rarely in brackish areas. They prefer flat, vegetated bottoms such as beds of sea grass,[3] where the feed on a mixture of plants (such as Thalassia)[2] and small invertebrates.[5]

Behavior[edit]

Spottail pinfish school in small numbers, but generally mix with many other species such as the Porkfish, Gray snapper, Bluestriped grunt, Sailor's grunt, and the Bucktooth parrotfish.[2]

Fishing[edit]

Spottail pinfish readily eat several baits such as shrimp (live or artificial), squid, and clams. Usually they are a pest fish when trying to catch a larger fish.

References[edit]

  1. ^ Jordan, David. Barton Evermann. American Food and Game Fishes. New York. Doubleday, Page & Company. 1923. pg. 444
  2. ^ a b c Longley, William H. ed. Samuel F. Hilderbrand. Systemic Catalogue of the Fishes of Tortugas, Florida with Observations on Color, Habits, and Local Distribution. Washington D. C. Carnegie Institution of Washington. 1941. pg. 133
  3. ^ a b Froese, Rainer and Pauly, Daniel, eds. (2009). "Diplodus holbrookii" in FishBase. 09 2009 version.
  4. ^ Claro, R. and L.R. Parenti 2001 The marine ichthyofauna of Cuba. p. 21-57. In: Claro, R., K.C. Lindeman and L.R. Parenti (eds) Ecology of the marine fishes of Cuba. Smithsonian Institution Press, Washington and London. 253p.
  5. ^ Pike, L.A. and D.G. Lindquist 1994 Feeding ecology of spottail pinfish (Diplodus holbrooki) from an artificial and natural reef in Onslow Bay, North Carolina. Bull. Mar. Sci. 55(2-3):363-374.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!