Overview

Comprehensive Description

Biology

Found usually over sand and sandy mud bottoms in coastal waters, especially in areas with large river runoffs. Juveniles often enter estuaries. Feeds mainly on crustaceans, mollusks and fishes.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pogonias cromis, the black drum, is oblong and moderately compressed with an elevated back and nearly straight ventral profile. The head is short with a blunt snout and inferior, horizontal mouth. The chin has 5 pores and 12-13 short barbels set close to the inner edges of the lower jaw. A deep notch separates the spinous dorsal fin with its 11 spines from the soft dorsal fin, which has 19 - 23 rays. The third dorsal spine is the longest. The anal fin has 2 spines and 5-7 rays. The caudal fin is truncate to emarginate. Pectoral fins are approximately the same length as the head. Scales are large and ctenoid. There are 41-45 lateral line scales. The pharyngeal teeth are small and set in broad bands for effective grinding of mollusk and arthropod shells. The vomer, palatines and tongue lack teeth (Johnson 1978). Body color in adults is a silver to black base color, highlighted with a with a coppery or brassy sheen. Fins are dusky to black in color. Young typically have 4-6 vertical black bars along their sides. Coloration may change depending on habitat or age of the fish (Simmons and Breuer 1962). In the Gulf of Mexico, black drum are nearly uniformly silver in color, their vertical crossbars disappearing very early in life. Fishes inhabiting bays and lagoons tend to be darker in color, typically with a bronze dorsal surface and gray-white sides (Simmons and Breuer 1962; Johnson 1978).
  • Beaumariage, D. S. 1969. Returns from the 1965 Schlitz tagging program including a cumulative analysis of previous results. Technical Series 59, Florida State Board of Conservation, St. Petersburg, Florida.
  • Beckman, D.W., A.L. Stanley, J.H. Render and C.A. Wilson, 1990 Age and growth of black drum in Louisiana waters of the Gulf of Mexico. Trans. Am. Fish. Soc. 119(3):537-544.
  • Benson, N. G., ed. 1982. Life history requirements of selected finfish and shellfish of Mississippi Sound and adjacent areas. U.S. Fish Wildl. Serv. Biol. Serv. Program FWS/O35-81/15.
  • Cody, T. J., K. W. Rice, and C. E. Bryan. 1985. Distribution and gonadal development of black drum in Texas Gulf waters. Tex. Pks. Wildl. Dep., Coast Fish. Branch, Manage. Data Ser. No. 72. 16 PP.
  • Etzold, D. J., and J. Y. Christmas, eds. 1979. A Mississippi marine finfish management plan. Mississippi-Alabama Sea Grant Consortium. MASGP-78-146. 36 pp.
  • Fitzhugh, G.R., B.A. Thompson and T.G. Snider III, 1993 Ovarian development, fecundity, and spawning frequency of black drum Pogonias cromis in Louisiana. Fish. Bull., U.S. 91:244-253.
  • Gunter, G. 1956. A revised list of euryhaline fishes of North and Middle America. Am. Midl. Nat. 56(2):345-354.
  • Hoese, H. D. 1965. Spawning of marine fishes in the Port Aransas, Texas area as determined by the distribution of young larvae. Ph.D. Dissertation. University of Texas, Austin. 144 pp.
  • International Game Fish Association, 2001 Database of IGFA angling records until 2001. IGFA, Fort Lauderdale, USA.
  • Joseph, E. B., W. H. Massmann, and J. J. Norcross. 1964. The pelagic eggs and early larval states of the black drum from Chesapeake Bay. Copeia 1964(2):425-434.
  • Johnson, G.D., 1978 Development of fishes of the Mid-Atlantic Bight. An atlas of egg, larval and juvenile stages. Vol. 4. Carangidae through Ephippidae. US Fish Wildl. Serv. Biol. Serv. Prog. FWS/OBS-78/12.
  • Leard, R., and ten co-authors. 1993. The black drum fishery of the Gulf of Mexico, United States: a regional management plan. Gulf States Marine Fisheries Commission, Number 28, Ocean Springs, MS.
  • McIlwain, T. D. 1978. An analysis of recreational angling in Biloxi Bay - 1972-1974. Ph.D. Dissertation. University of Southern Mississippi. Hattiesburg. 156 pp.
  • Miles, 0. W. 1949. A study of the food habits of the fishes of Aransas Bay area. Tex. Game Fish Oyster Comm., Mar. Lab. Annu. Rep. 1948-1949; 126-169.
  • Murphy, M.D.; Adams, D.H.; Tremain, D.M.; Winner, B.L. 1998. Direct validation of ages determined for adult black drum, Pogonias cromis, in east-central Florida with notes on black drum migration. Fish. Bull. (US) 96(2): 382-387.
  • Murphy, M.D.; Taylor, R.G. 1989. Reproduction and growth of black drum, Pogonias cromis, in Northeast Florida. Northeast Gulf Sci. 10(2): 127-137.
  • Murphy, M.D.; Muller, R.G. 1995. stock assessment of black drum Pogonias cromis in Florida. FMRI, In-house Report Series IHR 1995-005.
  • Osburn, H. R., and G. C. Matlock. 1984. Black drum movement in Texas bays. N. Am. J. Fish. Manage. 4:523-530.
  • Peters, K.M.; McMichael, R.H., Jr. 1990. Early life history of the black drum Pogonias cromis (Pisces: Sciaenidae) in Tampa Bay, Florida. Northeast Gulf Sci. 11(1):39-58.
  • Richards, C.E., 1973 Age, growth and distribution of the black drum (Pogonias cromis). Trans. Am. Fish. Soc. 102(3):584-590.
  • Ross, J. F., J. S. Pavela, and M. E. Chittenden, Jr. 1983. Seasonal occurrence of black drum, Pogonias cromis, and red drum, Sciaenops ocellatus, off Texas. Northeast Gulf Sci. 6(1):67-70.
  • Silverman, M. J. 1979. Biological and fisheries data on black drum, Pogonias cromis (Linnaeus). Northeast Fish. Nt. Sandy Hook Lab. Tech. Ser. Rep. 22. 35 Pp.
  • Simmons, E. G., and J. P. Breuer. 1962. A study of redfish, Sciaenops ocellata Linnaeus, and black drum, Pogonias cromis Linnaeus. Publ. Inst. Mar. Univ. Tex. 8:184-211.
  • Sutter, F.C., R.S. Wailer, and T.D. McIlwain. 1986. Species profiles: life histories and environmental requirements of coastal fishes and invertebrates (Gulf of Mexico)--black drum. U.S. Fish Wildl. Serv. Biol. Rep. 82(11.51). U.S. Army Corps of Engineers, TR EL-82-4.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic: Nova Scotia to northern Mexico, including southern Florida; then from southern Brazil to Argentina. Rare in Antilles and southward
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic: Nova Scotia (Ref. 7251) to Florida, Gulf of Mexico, the Antilles (uncommon), and the southern Caribbean coast; also from the Orinoco delta to Argentina.
  • Chao, N.L. 2003 Scianidae. Croakers. p. 1583-1653. In K.E. Carpenter (ed.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Atlantic. Vol. 3: Bony fishes part 2 (Opistognathidae to Molidae), sea turtles and marine mammals. (Ref. 51721)   http://www.fishbase.org/references/FBRefSummary.php?id=51721&speccode=405 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

The Black Drum ranges from the Atlantic coasts of New England all the way to Mexico. The highest number of Black Drum are found in the Gulf of Mexico. The most abundant areas for Black Drum on the Atlantic coast are south of the Chesapeake Bay. On the Gulf Coast, the most abundant areas for this species are on the lower coast of Texas. (Texas Parks and Wildlife 2000)

Biogeographic Regions: nearctic (Native ); atlantic ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

On the Atlantic coast of the United States, Pogonias cromis occurs from southern New England south through Florida and the Gulf of Mexico, to Argentina. It has been documented as far north as the Bay of Fundy, but is much more common south of Chesapeake Bay. Black drum are especially abundant in Florida and along the Gulf coast to Texas. Black drum are common throughout the Indian River Lagoon and have notably large populations in Volusia and Martin Counties (Murphy and Taylor 1995).
  • Beaumariage, D. S. 1969. Returns from the 1965 Schlitz tagging program including a cumulative analysis of previous results. Technical Series 59, Florida State Board of Conservation, St. Petersburg, Florida.
  • Beckman, D.W., A.L. Stanley, J.H. Render and C.A. Wilson, 1990 Age and growth of black drum in Louisiana waters of the Gulf of Mexico. Trans. Am. Fish. Soc. 119(3):537-544.
  • Benson, N. G., ed. 1982. Life history requirements of selected finfish and shellfish of Mississippi Sound and adjacent areas. U.S. Fish Wildl. Serv. Biol. Serv. Program FWS/O35-81/15.
  • Cody, T. J., K. W. Rice, and C. E. Bryan. 1985. Distribution and gonadal development of black drum in Texas Gulf waters. Tex. Pks. Wildl. Dep., Coast Fish. Branch, Manage. Data Ser. No. 72. 16 PP.
  • Etzold, D. J., and J. Y. Christmas, eds. 1979. A Mississippi marine finfish management plan. Mississippi-Alabama Sea Grant Consortium. MASGP-78-146. 36 pp.
  • Fitzhugh, G.R., B.A. Thompson and T.G. Snider III, 1993 Ovarian development, fecundity, and spawning frequency of black drum Pogonias cromis in Louisiana. Fish. Bull., U.S. 91:244-253.
  • Gunter, G. 1956. A revised list of euryhaline fishes of North and Middle America. Am. Midl. Nat. 56(2):345-354.
  • Hoese, H. D. 1965. Spawning of marine fishes in the Port Aransas, Texas area as determined by the distribution of young larvae. Ph.D. Dissertation. University of Texas, Austin. 144 pp.
  • International Game Fish Association, 2001 Database of IGFA angling records until 2001. IGFA, Fort Lauderdale, USA.
  • Joseph, E. B., W. H. Massmann, and J. J. Norcross. 1964. The pelagic eggs and early larval states of the black drum from Chesapeake Bay. Copeia 1964(2):425-434.
  • Johnson, G.D., 1978 Development of fishes of the Mid-Atlantic Bight. An atlas of egg, larval and juvenile stages. Vol. 4. Carangidae through Ephippidae. US Fish Wildl. Serv. Biol. Serv. Prog. FWS/OBS-78/12.
  • Leard, R., and ten co-authors. 1993. The black drum fishery of the Gulf of Mexico, United States: a regional management plan. Gulf States Marine Fisheries Commission, Number 28, Ocean Springs, MS.
  • McIlwain, T. D. 1978. An analysis of recreational angling in Biloxi Bay - 1972-1974. Ph.D. Dissertation. University of Southern Mississippi. Hattiesburg. 156 pp.
  • Miles, 0. W. 1949. A study of the food habits of the fishes of Aransas Bay area. Tex. Game Fish Oyster Comm., Mar. Lab. Annu. Rep. 1948-1949; 126-169.
  • Murphy, M.D.; Adams, D.H.; Tremain, D.M.; Winner, B.L. 1998. Direct validation of ages determined for adult black drum, Pogonias cromis, in east-central Florida with notes on black drum migration. Fish. Bull. (US) 96(2): 382-387.
  • Murphy, M.D.; Taylor, R.G. 1989. Reproduction and growth of black drum, Pogonias cromis, in Northeast Florida. Northeast Gulf Sci. 10(2): 127-137.
  • Murphy, M.D.; Muller, R.G. 1995. stock assessment of black drum Pogonias cromis in Florida. FMRI, In-house Report Series IHR 1995-005.
  • Osburn, H. R., and G. C. Matlock. 1984. Black drum movement in Texas bays. N. Am. J. Fish. Manage. 4:523-530.
  • Peters, K.M.; McMichael, R.H., Jr. 1990. Early life history of the black drum Pogonias cromis (Pisces: Sciaenidae) in Tampa Bay, Florida. Northeast Gulf Sci. 11(1):39-58.
  • Richards, C.E., 1973 Age, growth and distribution of the black drum (Pogonias cromis). Trans. Am. Fish. Soc. 102(3):584-590.
  • Ross, J. F., J. S. Pavela, and M. E. Chittenden, Jr. 1983. Seasonal occurrence of black drum, Pogonias cromis, and red drum, Sciaenops ocellatus, off Texas. Northeast Gulf Sci. 6(1):67-70.
  • Silverman, M. J. 1979. Biological and fisheries data on black drum, Pogonias cromis (Linnaeus). Northeast Fish. Nt. Sandy Hook Lab. Tech. Ser. Rep. 22. 35 Pp.
  • Simmons, E. G., and J. P. Breuer. 1962. A study of redfish, Sciaenops ocellata Linnaeus, and black drum, Pogonias cromis Linnaeus. Publ. Inst. Mar. Univ. Tex. 8:184-211.
  • Sutter, F.C., R.S. Wailer, and T.D. McIlwain. 1986. Species profiles: life histories and environmental requirements of coastal fishes and invertebrates (Gulf of Mexico)--black drum. U.S. Fish Wildl. Serv. Biol. Rep. 82(11.51). U.S. Army Corps of Engineers, TR EL-82-4.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic: Nova Scotia to northern Mexico, including southern Florida; then from southern Brazil to Argentina; rare in Antilles and southward.
  • Bigelow, H.B. and Schroeder, W.C., 1953; Robins, C.R. and G.C. Ray, 1986; Smith, C.L., 1997.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 11; Dorsal soft rays (total): 19 - 22; Analspines: 2; Analsoft rays: 5 - 7
  • Chao, N.L. 2003 Scianidae. Croakers. p. 1583-1653. In K.E. Carpenter (ed.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Atlantic. Vol. 3: Bony fishes part 2 (Opistognathidae to Molidae), sea turtles and marine mammals. (Ref. 51721)   http://www.fishbase.org/references/FBRefSummary.php?id=51721&speccode=405 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Black Drum have oblong bodies with short heads. Their snouts are rather blunt. The scales and dorsal fins of the Black Drum are extremely firm. They also have cobblestone-like teeth. On the bottom of their mouth, Black Drum have between 10-15 barbels (whiskers) that are used for seeking out food. After 2 years, adult Black Drum weigh around 1.3 kilograms, while older Drum can weigh up to 37 kilograms.

The coloration of the Black Drum varies with age and environment. Younger Black Drum generally have vertical black bars running along their body. Black Drum bodies are usually black or dark gray if the Drums are living in sandy or murky water. They appear lighter in fishes that live in the Gulf of Mexico. Older Drum are generally white bellied, but coloration varies greatly within this species. (Virginia Tech Database 1996)

Range mass: 1 to 37 kg.

Other Physical Features: endothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 1700 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

170 cm TL (male/unsexed; (Ref. 7251)); max. published weight: 51.3 kg (Ref. 4699); max. reported age: 43 years (Ref. 7188)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pogonias cromis grows to a maximum size of approximately 170 cm (67 inches) and may weigh as much as 51.3 kg (113.1 pounds) (IGFA 2001). Maximum age is estimated to be 43 years on Florida's Gulf coast, and 58 years on the Atlantic Coast (Murphy and Muller 1995). Growth information for black drum is relatively scarce, but some rate estimates have been produced. Simmons and Breuer (1962) used length-frequency analysis and tag return data to estimate growth rates in black drum, finding that black drum in Texas measured approximately 160 mm (6.3 inches) standard length (SL), at the end of the first year, 310 mm (12.2 inches) at the end of the second year, and 415 mm (16.3 inches) by the end of the third year. Older drum in their study had growth rates of approximately 50 mm (1.97 inches) SL per year. There is no evidence of sex-specific differences in growth rates of black drum (Beckman et al. 1990).
  • Beaumariage, D. S. 1969. Returns from the 1965 Schlitz tagging program including a cumulative analysis of previous results. Technical Series 59, Florida State Board of Conservation, St. Petersburg, Florida.
  • Beckman, D.W., A.L. Stanley, J.H. Render and C.A. Wilson, 1990 Age and growth of black drum in Louisiana waters of the Gulf of Mexico. Trans. Am. Fish. Soc. 119(3):537-544.
  • Benson, N. G., ed. 1982. Life history requirements of selected finfish and shellfish of Mississippi Sound and adjacent areas. U.S. Fish Wildl. Serv. Biol. Serv. Program FWS/O35-81/15.
  • Cody, T. J., K. W. Rice, and C. E. Bryan. 1985. Distribution and gonadal development of black drum in Texas Gulf waters. Tex. Pks. Wildl. Dep., Coast Fish. Branch, Manage. Data Ser. No. 72. 16 PP.
  • Etzold, D. J., and J. Y. Christmas, eds. 1979. A Mississippi marine finfish management plan. Mississippi-Alabama Sea Grant Consortium. MASGP-78-146. 36 pp.
  • Fitzhugh, G.R., B.A. Thompson and T.G. Snider III, 1993 Ovarian development, fecundity, and spawning frequency of black drum Pogonias cromis in Louisiana. Fish. Bull., U.S. 91:244-253.
  • Gunter, G. 1956. A revised list of euryhaline fishes of North and Middle America. Am. Midl. Nat. 56(2):345-354.
  • Hoese, H. D. 1965. Spawning of marine fishes in the Port Aransas, Texas area as determined by the distribution of young larvae. Ph.D. Dissertation. University of Texas, Austin. 144 pp.
  • International Game Fish Association, 2001 Database of IGFA angling records until 2001. IGFA, Fort Lauderdale, USA.
  • Joseph, E. B., W. H. Massmann, and J. J. Norcross. 1964. The pelagic eggs and early larval states of the black drum from Chesapeake Bay. Copeia 1964(2):425-434.
  • Johnson, G.D., 1978 Development of fishes of the Mid-Atlantic Bight. An atlas of egg, larval and juvenile stages. Vol. 4. Carangidae through Ephippidae. US Fish Wildl. Serv. Biol. Serv. Prog. FWS/OBS-78/12.
  • Leard, R., and ten co-authors. 1993. The black drum fishery of the Gulf of Mexico, United States: a regional management plan. Gulf States Marine Fisheries Commission, Number 28, Ocean Springs, MS.
  • McIlwain, T. D. 1978. An analysis of recreational angling in Biloxi Bay - 1972-1974. Ph.D. Dissertation. University of Southern Mississippi. Hattiesburg. 156 pp.
  • Miles, 0. W. 1949. A study of the food habits of the fishes of Aransas Bay area. Tex. Game Fish Oyster Comm., Mar. Lab. Annu. Rep. 1948-1949; 126-169.
  • Murphy, M.D.; Adams, D.H.; Tremain, D.M.; Winner, B.L. 1998. Direct validation of ages determined for adult black drum, Pogonias cromis, in east-central Florida with notes on black drum migration. Fish. Bull. (US) 96(2): 382-387.
  • Murphy, M.D.; Taylor, R.G. 1989. Reproduction and growth of black drum, Pogonias cromis, in Northeast Florida. Northeast Gulf Sci. 10(2): 127-137.
  • Murphy, M.D.; Muller, R.G. 1995. stock assessment of black drum Pogonias cromis in Florida. FMRI, In-house Report Series IHR 1995-005.
  • Osburn, H. R., and G. C. Matlock. 1984. Black drum movement in Texas bays. N. Am. J. Fish. Manage. 4:523-530.
  • Peters, K.M.; McMichael, R.H., Jr. 1990. Early life history of the black drum Pogonias cromis (Pisces: Sciaenidae) in Tampa Bay, Florida. Northeast Gulf Sci. 11(1):39-58.
  • Richards, C.E., 1973 Age, growth and distribution of the black drum (Pogonias cromis). Trans. Am. Fish. Soc. 102(3):584-590.
  • Ross, J. F., J. S. Pavela, and M. E. Chittenden, Jr. 1983. Seasonal occurrence of black drum, Pogonias cromis, and red drum, Sciaenops ocellatus, off Texas. Northeast Gulf Sci. 6(1):67-70.
  • Silverman, M. J. 1979. Biological and fisheries data on black drum, Pogonias cromis (Linnaeus). Northeast Fish. Nt. Sandy Hook Lab. Tech. Ser. Rep. 22. 35 Pp.
  • Simmons, E. G., and J. P. Breuer. 1962. A study of redfish, Sciaenops ocellata Linnaeus, and black drum, Pogonias cromis Linnaeus. Publ. Inst. Mar. Univ. Tex. 8:184-211.
  • Sutter, F.C., R.S. Wailer, and T.D. McIlwain. 1986. Species profiles: life histories and environmental requirements of coastal fishes and invertebrates (Gulf of Mexico)--black drum. U.S. Fish Wildl. Serv. Biol. Rep. 82(11.51). U.S. Army Corps of Engineers, TR EL-82-4.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

to 170.0 cm TL (male/unsexed); max. weight: 51 kg.
  • Bigelow, H.B. and Schroeder, W.C., 1953; Robins, C.R. and G.C. Ray, 1986; Smith, C.L., 1997.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Silvery grey to very dark, young with 4 or 5 black vertical bars on sides, disappearing with growth; pelvic and anal fins usually dark. Chin with 5 pores and 10 to 13 pairs of small barbels along median edges of lower jaws and subopercles, increasing in length posteriorly. Gas bladder with numerous lateral appendages interconnected in a complicated pattern in adult. Sagitta semicircular and moderately thin (Ref 51721).
  • Chao, N.L. 2003 Scianidae. Croakers. p. 1583-1653. In K.E. Carpenter (ed.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Atlantic. Vol. 3: Bony fishes part 2 (Opistognathidae to Molidae), sea turtles and marine mammals. (Ref. 51721)   http://www.fishbase.org/references/FBRefSummary.php?id=51721&speccode=405 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

benthic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Found usually over sand and sandy mud bottoms in coastal waters, especially in areas with large river runoffs.
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

demersal; oceanodromous (Ref. 51243); brackish; marine; depth range 10 - ? m
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Black Drum adults are generally found in areas with sandy or soft bottom. This species also stays in close proximity to oyster beds and clam shell beds.

During the colder months, the Black Drum go from the shallow areas to deeper bays. Extreme drops in water temperature have been known to wipe out many Drum at once. The Drum are most common in water temperatures ranging from 12-32 degrees Celsius. (Virginia Tech Database 1996)

Aquatic Biomes: coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 77 specimens in 1 taxon.
Water temperature and chemistry ranges based on 17 samples.

Environmental ranges
  Depth range (m): 0 - 40
  Temperature range (°C): 11.674 - 25.874
  Nitrate (umol/L): 0.289 - 8.325
  Salinity (PPS): 32.546 - 36.038
  Oxygen (ml/l): 4.671 - 6.000
  Phosphate (umol/l): 0.106 - 1.246
  Silicate (umol/l): 0.756 - 5.700

Graphical representation

Depth range (m): 0 - 40

Temperature range (°C): 11.674 - 25.874

Nitrate (umol/L): 0.289 - 8.325

Salinity (PPS): 32.546 - 36.038

Oxygen (ml/l): 4.671 - 6.000

Phosphate (umol/l): 0.106 - 1.246

Silicate (umol/l): 0.756 - 5.700
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Demersal; brackish; marine; depth range to 10 m. Usually in coastal waters over sand or sandy mud bottoms, especially where river runoff is large. Juveniles often are in estuaries.
  • Bigelow, H.B. and Schroeder, W.C., 1953; Robins, C.R. and G.C. Ray, 1986; Smith, C.L., 1997.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Found usually over sand and sandy mud bottoms in coastal waters, especially in areas with large river runoffs. Juveniles often enter estuaries. Feeds mainly on crustaceans, molluscs and fishes.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Black Drum larvae feed strictly on zooplankton. Young Black Drum feed on soft crustaceans, small fish, and marine annelids. Adult Black Drum feed mainly on crabs, small fish, and shrimp. They can crush hard animals such as crabs due to their tooth specialization. The teeth are designed to crush with their cobblestone-like design. (Virginia Tech Database 1996)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Black drum are primarily bottom feeders, though they have been occasionally observed feeding near the surface on small finfishes such as menhaden (Ackerman 1951). Pearson (1929) reported black drum bottom feeding in a vertical position in waters so shallow, their tails protruded from the water.Larvae feed primarily on zooplankton (Benson 1982). Juveniles feed on annelids, soft crustaceans, amphipods, and small fishes (Simmons and Breuer 1962; Peters and McMichael 1990). In Texas, approximately 33% of the diet in black drum measuring 21 - 50 cm (8.3 - 19.7 inches) or more in length consisted of the surfclam (Mulinia sp.). Larger drum consume mostly mollusks and crabs, while the largest specimens consumed mollusks and shrimp (Simmons and Breuer 1962). Miles (1949) reported that black drum in Texas fed primarily on shrimp, mollusks, and vegetation.Large, captive drum were capable of feeding on more than 2 commercial-sized oysters per kilogram of body weight daily (Cave and Cake 1980). Black drum are known to damage commercial stocks of oysters on seed reefs in lease areas in Gulf of Mexico waters (Benson 1982). Competitors: Black drum likely compete with other drums, especially the red drum for benthic food resources, but because of their strong pharyngeal teeth, probably do not experience much competition for mollusks (Sutter et al. 1986).Predators: Juvenile black drum are preyed upon by a variety of larger fishes such as seatrout and jacks. Larger black drum are likely to be preyed upon by sharks (Murphy and Muller 1995)Habitats: Larvae enter estuaries on tidal currents and utilize seagrasses as nursery habitat. Postlarvae prefer nutrient-rich and somewhat muddy waters of tidal creeks and channels. Juveniles are found more often over muddy bottoms in estuaries. Adults are usually common over sand or sand/mud bottom types in shallow coastal and estuarine waters, especially in high runoff areas, oyster reefs and shell hash (Pearson 1929). Adults sometimes move onto near-shelf waters, but are primarily estuarine-dwelling and show little migratory behavior. Simmons and Breuer (1962) reported that tagged black drum in Texas generally moved less than 5 miles from where they were tagged. Beaumarriage (1969) reported similar results in Florida black drum. Osburn and Matlock (1984) examined movements of black drum in Texas, reporting that black drum less than 3 years of age showed limited movement from bay systems into the Gulf of Mexico. Older fishes were more commonly taken in deeper waters of the Gulf, leading the authors to hypothesize that permanent movement of black drum to deeper gulf waters occurs in fishes older than 4 years of age; with bays and estuaries thus supplying young fishes to spawning stocks of older fishes.
  • Beaumariage, D. S. 1969. Returns from the 1965 Schlitz tagging program including a cumulative analysis of previous results. Technical Series 59, Florida State Board of Conservation, St. Petersburg, Florida.
  • Beckman, D.W., A.L. Stanley, J.H. Render and C.A. Wilson, 1990 Age and growth of black drum in Louisiana waters of the Gulf of Mexico. Trans. Am. Fish. Soc. 119(3):537-544.
  • Benson, N. G., ed. 1982. Life history requirements of selected finfish and shellfish of Mississippi Sound and adjacent areas. U.S. Fish Wildl. Serv. Biol. Serv. Program FWS/O35-81/15.
  • Cody, T. J., K. W. Rice, and C. E. Bryan. 1985. Distribution and gonadal development of black drum in Texas Gulf waters. Tex. Pks. Wildl. Dep., Coast Fish. Branch, Manage. Data Ser. No. 72. 16 PP.
  • Etzold, D. J., and J. Y. Christmas, eds. 1979. A Mississippi marine finfish management plan. Mississippi-Alabama Sea Grant Consortium. MASGP-78-146. 36 pp.
  • Fitzhugh, G.R., B.A. Thompson and T.G. Snider III, 1993 Ovarian development, fecundity, and spawning frequency of black drum Pogonias cromis in Louisiana. Fish. Bull., U.S. 91:244-253.
  • Gunter, G. 1956. A revised list of euryhaline fishes of North and Middle America. Am. Midl. Nat. 56(2):345-354.
  • Hoese, H. D. 1965. Spawning of marine fishes in the Port Aransas, Texas area as determined by the distribution of young larvae. Ph.D. Dissertation. University of Texas, Austin. 144 pp.
  • International Game Fish Association, 2001 Database of IGFA angling records until 2001. IGFA, Fort Lauderdale, USA.
  • Joseph, E. B., W. H. Massmann, and J. J. Norcross. 1964. The pelagic eggs and early larval states of the black drum from Chesapeake Bay. Copeia 1964(2):425-434.
  • Johnson, G.D., 1978 Development of fishes of the Mid-Atlantic Bight. An atlas of egg, larval and juvenile stages. Vol. 4. Carangidae through Ephippidae. US Fish Wildl. Serv. Biol. Serv. Prog. FWS/OBS-78/12.
  • Leard, R., and ten co-authors. 1993. The black drum fishery of the Gulf of Mexico, United States: a regional management plan. Gulf States Marine Fisheries Commission, Number 28, Ocean Springs, MS.
  • McIlwain, T. D. 1978. An analysis of recreational angling in Biloxi Bay - 1972-1974. Ph.D. Dissertation. University of Southern Mississippi. Hattiesburg. 156 pp.
  • Miles, 0. W. 1949. A study of the food habits of the fishes of Aransas Bay area. Tex. Game Fish Oyster Comm., Mar. Lab. Annu. Rep. 1948-1949; 126-169.
  • Murphy, M.D.; Adams, D.H.; Tremain, D.M.; Winner, B.L. 1998. Direct validation of ages determined for adult black drum, Pogonias cromis, in east-central Florida with notes on black drum migration. Fish. Bull. (US) 96(2): 382-387.
  • Murphy, M.D.; Taylor, R.G. 1989. Reproduction and growth of black drum, Pogonias cromis, in Northeast Florida. Northeast Gulf Sci. 10(2): 127-137.
  • Murphy, M.D.; Muller, R.G. 1995. stock assessment of black drum Pogonias cromis in Florida. FMRI, In-house Report Series IHR 1995-005.
  • Osburn, H. R., and G. C. Matlock. 1984. Black drum movement in Texas bays. N. Am. J. Fish. Manage. 4:523-530.
  • Peters, K.M.; McMichael, R.H., Jr. 1990. Early life history of the black drum Pogonias cromis (Pisces: Sciaenidae) in Tampa Bay, Florida. Northeast Gulf Sci. 11(1):39-58.
  • Richards, C.E., 1973 Age, growth and distribution of the black drum (Pogonias cromis). Trans. Am. Fish. Soc. 102(3):584-590.
  • Ross, J. F., J. S. Pavela, and M. E. Chittenden, Jr. 1983. Seasonal occurrence of black drum, Pogonias cromis, and red drum, Sciaenops ocellatus, off Texas. Northeast Gulf Sci. 6(1):67-70.
  • Silverman, M. J. 1979. Biological and fisheries data on black drum, Pogonias cromis (Linnaeus). Northeast Fish. Nt. Sandy Hook Lab. Tech. Ser. Rep. 22. 35 Pp.
  • Simmons, E. G., and J. P. Breuer. 1962. A study of redfish, Sciaenops ocellata Linnaeus, and black drum, Pogonias cromis Linnaeus. Publ. Inst. Mar. Univ. Tex. 8:184-211.
  • Sutter, F.C., R.S. Wailer, and T.D. McIlwain. 1986. Species profiles: life histories and environmental requirements of coastal fishes and invertebrates (Gulf of Mexico)--black drum. U.S. Fish Wildl. Serv. Biol. Rep. 82(11.51). U.S. Army Corps of Engineers, TR EL-82-4.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Crustaceans, molluscs and fishes.
  • Bigelow, H.B. and Schroeder, W.C., 1953; Robins, C.R. and G.C. Ray, 1986; Smith, C.L., 1997.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Known prey organisms

Pogonias cromis (black drum) preys on:
benthic invertebrates

Based on studies in:
USA: Florida (Estuarine)

This list may not be complete but is based on published studies.
  • W. M. Kemp, W. H. B. Smith, H. N. McKellar, M. E. Lehman, M. Homer, D. L. Young and H. T. Odum, Energy cost-benefit analysis applied to power plants near Crystal River, Florida. In: Ecosystem Modeling in Theory and Practice: An Introduction with Case His
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Diet

Feeds mainly on crustaceans, molluscs and fishes
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: captivity:
43 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Black Drum spawn in many different areas. They can spawn in bays, the Gulf, or estuaries and river systems when temperatures begin to rise in March and April. To make their presence known to females, male Black Drum make deep drumming noises. Females only respond on certain nights when their ovaries are filled with eggs. When the female does acknowledge the male's presence, the two engage in what is known as a mating chase. During this chase, males bump the sides of the female that causes the release of the female's eggs. This causes a cloud as the male's sperm and the female's eggs mix. The eggs hatch within 24 hours. Black Drum reach sexual maturity after 2 years. (Virginia Tech Database 1996)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Black drum mature at approximately 450 - 700 mm (17.7 - 27.6 inches) total length (TL) when they are 2 - 6 years of age. Males mature at somewhat younger and smaller size than do females. Murphy and Taylor (1989) estimated that in northeastern Florida, males reached maturity at 4-5 years of age when they measured approximately 590 mm (23.2 inches), while females reached maturity at 5-6 years of age, at measurements of 650 - 699 mm (25.6 - 27.5 inches). Pogonias cromis spawns in bays, estuaries and nearshore waters (Hoese 1965; Etzold and Christmas 1979). Gravid and spent fishes are most commonly collected where waters are 20 - 27 m (65.6 - 88.6 feet) deep (Ross et al. 1983; Cody et al. 1985). Spawning periods are dependent upon geographic location. In Texas, up to 90% of spawning occurs from February through March (Simmons and Breuer 1962), with limited spawning continuing into June and July. Cody et al. (1985)) reported that in the Gulf of Mexico, spawning in deeper Gulf waters around Texas occurred from November through April. Florida, black drum also spawn from November through April, with activity peaking during February and March (Murphy and Taylor 1989). Black drum are multiple spawners with continuous oocyte recruitment throughout the spawning season (Fitzhugh 1993), and are capable of spawning approximately every 3 days. Pearson (1929) estimated that a ripe female black drum measuring 1.1 m (43.3 inches) total length (TL) would produce approximately 6 million eggs annually. In a more recent study, Fitzhugh et al. (1993) estimated fecundity of average sized females weighing 13.4 pounds at 32 million eggs annually.
  • Beaumariage, D. S. 1969. Returns from the 1965 Schlitz tagging program including a cumulative analysis of previous results. Technical Series 59, Florida State Board of Conservation, St. Petersburg, Florida.
  • Beckman, D.W., A.L. Stanley, J.H. Render and C.A. Wilson, 1990 Age and growth of black drum in Louisiana waters of the Gulf of Mexico. Trans. Am. Fish. Soc. 119(3):537-544.
  • Benson, N. G., ed. 1982. Life history requirements of selected finfish and shellfish of Mississippi Sound and adjacent areas. U.S. Fish Wildl. Serv. Biol. Serv. Program FWS/O35-81/15.
  • Cody, T. J., K. W. Rice, and C. E. Bryan. 1985. Distribution and gonadal development of black drum in Texas Gulf waters. Tex. Pks. Wildl. Dep., Coast Fish. Branch, Manage. Data Ser. No. 72. 16 PP.
  • Etzold, D. J., and J. Y. Christmas, eds. 1979. A Mississippi marine finfish management plan. Mississippi-Alabama Sea Grant Consortium. MASGP-78-146. 36 pp.
  • Fitzhugh, G.R., B.A. Thompson and T.G. Snider III, 1993 Ovarian development, fecundity, and spawning frequency of black drum Pogonias cromis in Louisiana. Fish. Bull., U.S. 91:244-253.
  • Gunter, G. 1956. A revised list of euryhaline fishes of North and Middle America. Am. Midl. Nat. 56(2):345-354.
  • Hoese, H. D. 1965. Spawning of marine fishes in the Port Aransas, Texas area as determined by the distribution of young larvae. Ph.D. Dissertation. University of Texas, Austin. 144 pp.
  • International Game Fish Association, 2001 Database of IGFA angling records until 2001. IGFA, Fort Lauderdale, USA.
  • Joseph, E. B., W. H. Massmann, and J. J. Norcross. 1964. The pelagic eggs and early larval states of the black drum from Chesapeake Bay. Copeia 1964(2):425-434.
  • Johnson, G.D., 1978 Development of fishes of the Mid-Atlantic Bight. An atlas of egg, larval and juvenile stages. Vol. 4. Carangidae through Ephippidae. US Fish Wildl. Serv. Biol. Serv. Prog. FWS/OBS-78/12.
  • Leard, R., and ten co-authors. 1993. The black drum fishery of the Gulf of Mexico, United States: a regional management plan. Gulf States Marine Fisheries Commission, Number 28, Ocean Springs, MS.
  • McIlwain, T. D. 1978. An analysis of recreational angling in Biloxi Bay - 1972-1974. Ph.D. Dissertation. University of Southern Mississippi. Hattiesburg. 156 pp.
  • Miles, 0. W. 1949. A study of the food habits of the fishes of Aransas Bay area. Tex. Game Fish Oyster Comm., Mar. Lab. Annu. Rep. 1948-1949; 126-169.
  • Murphy, M.D.; Adams, D.H.; Tremain, D.M.; Winner, B.L. 1998. Direct validation of ages determined for adult black drum, Pogonias cromis, in east-central Florida with notes on black drum migration. Fish. Bull. (US) 96(2): 382-387.
  • Murphy, M.D.; Taylor, R.G. 1989. Reproduction and growth of black drum, Pogonias cromis, in Northeast Florida. Northeast Gulf Sci. 10(2): 127-137.
  • Murphy, M.D.; Muller, R.G. 1995. stock assessment of black drum Pogonias cromis in Florida. FMRI, In-house Report Series IHR 1995-005.
  • Osburn, H. R., and G. C. Matlock. 1984. Black drum movement in Texas bays. N. Am. J. Fish. Manage. 4:523-530.
  • Peters, K.M.; McMichael, R.H., Jr. 1990. Early life history of the black drum Pogonias cromis (Pisces: Sciaenidae) in Tampa Bay, Florida. Northeast Gulf Sci. 11(1):39-58.
  • Richards, C.E., 1973 Age, growth and distribution of the black drum (Pogonias cromis). Trans. Am. Fish. Soc. 102(3):584-590.
  • Ross, J. F., J. S. Pavela, and M. E. Chittenden, Jr. 1983. Seasonal occurrence of black drum, Pogonias cromis, and red drum, Sciaenops ocellatus, off Texas. Northeast Gulf Sci. 6(1):67-70.
  • Silverman, M. J. 1979. Biological and fisheries data on black drum, Pogonias cromis (Linnaeus). Northeast Fish. Nt. Sandy Hook Lab. Tech. Ser. Rep. 22. 35 Pp.
  • Simmons, E. G., and J. P. Breuer. 1962. A study of redfish, Sciaenops ocellata Linnaeus, and black drum, Pogonias cromis Linnaeus. Publ. Inst. Mar. Univ. Tex. 8:184-211.
  • Sutter, F.C., R.S. Wailer, and T.D. McIlwain. 1986. Species profiles: life histories and environmental requirements of coastal fishes and invertebrates (Gulf of Mexico)--black drum. U.S. Fish Wildl. Serv. Biol. Rep. 82(11.51). U.S. Army Corps of Engineers, TR EL-82-4.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Spawns from January until April in bays and sounds. Eggs are spawned in open water but sink to the bottom.
  • Bigelow, H.B. and Schroeder, W.C., 1953; Robins, C.R. and G.C. Ray, 1986; Smith, C.L., 1997.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Growth

Eggs of black drum are pelagic and measure 0.8 - 1 mm (0.031 - 0.039 inches) in diameter with 2-6 oil droplets in the early stages. Droplets merge into a single drop in later stages prior to hatching. Eggs hatch in less than 24 hours at 20 °C (Joseph et al. 1964).Larvae measure approximately 1.9 - 2.4 mm (0.075 - 0.094 inches) TL at hatching (Joseph et al 1964). The yolk sac is completely absorbed when larvae grow to 2.8 mm (0.11 inches). Upon reaching approximately 15 mm (0.59 inches) TL, the overall adult body shape is recognizable. After hatching, larvae rely upon tidal currents for transport into estuaries, where they begin appearing in February or early March.
  • Beaumariage, D. S. 1969. Returns from the 1965 Schlitz tagging program including a cumulative analysis of previous results. Technical Series 59, Florida State Board of Conservation, St. Petersburg, Florida.
  • Beckman, D.W., A.L. Stanley, J.H. Render and C.A. Wilson, 1990 Age and growth of black drum in Louisiana waters of the Gulf of Mexico. Trans. Am. Fish. Soc. 119(3):537-544.
  • Benson, N. G., ed. 1982. Life history requirements of selected finfish and shellfish of Mississippi Sound and adjacent areas. U.S. Fish Wildl. Serv. Biol. Serv. Program FWS/O35-81/15.
  • Cody, T. J., K. W. Rice, and C. E. Bryan. 1985. Distribution and gonadal development of black drum in Texas Gulf waters. Tex. Pks. Wildl. Dep., Coast Fish. Branch, Manage. Data Ser. No. 72. 16 PP.
  • Etzold, D. J., and J. Y. Christmas, eds. 1979. A Mississippi marine finfish management plan. Mississippi-Alabama Sea Grant Consortium. MASGP-78-146. 36 pp.
  • Fitzhugh, G.R., B.A. Thompson and T.G. Snider III, 1993 Ovarian development, fecundity, and spawning frequency of black drum Pogonias cromis in Louisiana. Fish. Bull., U.S. 91:244-253.
  • Gunter, G. 1956. A revised list of euryhaline fishes of North and Middle America. Am. Midl. Nat. 56(2):345-354.
  • Hoese, H. D. 1965. Spawning of marine fishes in the Port Aransas, Texas area as determined by the distribution of young larvae. Ph.D. Dissertation. University of Texas, Austin. 144 pp.
  • International Game Fish Association, 2001 Database of IGFA angling records until 2001. IGFA, Fort Lauderdale, USA.
  • Joseph, E. B., W. H. Massmann, and J. J. Norcross. 1964. The pelagic eggs and early larval states of the black drum from Chesapeake Bay. Copeia 1964(2):425-434.
  • Johnson, G.D., 1978 Development of fishes of the Mid-Atlantic Bight. An atlas of egg, larval and juvenile stages. Vol. 4. Carangidae through Ephippidae. US Fish Wildl. Serv. Biol. Serv. Prog. FWS/OBS-78/12.
  • Leard, R., and ten co-authors. 1993. The black drum fishery of the Gulf of Mexico, United States: a regional management plan. Gulf States Marine Fisheries Commission, Number 28, Ocean Springs, MS.
  • McIlwain, T. D. 1978. An analysis of recreational angling in Biloxi Bay - 1972-1974. Ph.D. Dissertation. University of Southern Mississippi. Hattiesburg. 156 pp.
  • Miles, 0. W. 1949. A study of the food habits of the fishes of Aransas Bay area. Tex. Game Fish Oyster Comm., Mar. Lab. Annu. Rep. 1948-1949; 126-169.
  • Murphy, M.D.; Adams, D.H.; Tremain, D.M.; Winner, B.L. 1998. Direct validation of ages determined for adult black drum, Pogonias cromis, in east-central Florida with notes on black drum migration. Fish. Bull. (US) 96(2): 382-387.
  • Murphy, M.D.; Taylor, R.G. 1989. Reproduction and growth of black drum, Pogonias cromis, in Northeast Florida. Northeast Gulf Sci. 10(2): 127-137.
  • Murphy, M.D.; Muller, R.G. 1995. stock assessment of black drum Pogonias cromis in Florida. FMRI, In-house Report Series IHR 1995-005.
  • Osburn, H. R., and G. C. Matlock. 1984. Black drum movement in Texas bays. N. Am. J. Fish. Manage. 4:523-530.
  • Peters, K.M.; McMichael, R.H., Jr. 1990. Early life history of the black drum Pogonias cromis (Pisces: Sciaenidae) in Tampa Bay, Florida. Northeast Gulf Sci. 11(1):39-58.
  • Richards, C.E., 1973 Age, growth and distribution of the black drum (Pogonias cromis). Trans. Am. Fish. Soc. 102(3):584-590.
  • Ross, J. F., J. S. Pavela, and M. E. Chittenden, Jr. 1983. Seasonal occurrence of black drum, Pogonias cromis, and red drum, Sciaenops ocellatus, off Texas. Northeast Gulf Sci. 6(1):67-70.
  • Silverman, M. J. 1979. Biological and fisheries data on black drum, Pogonias cromis (Linnaeus). Northeast Fish. Nt. Sandy Hook Lab. Tech. Ser. Rep. 22. 35 Pp.
  • Simmons, E. G., and J. P. Breuer. 1962. A study of redfish, Sciaenops ocellata Linnaeus, and black drum, Pogonias cromis Linnaeus. Publ. Inst. Mar. Univ. Tex. 8:184-211.
  • Sutter, F.C., R.S. Wailer, and T.D. McIlwain. 1986. Species profiles: life histories and environmental requirements of coastal fishes and invertebrates (Gulf of Mexico)--black drum. U.S. Fish Wildl. Serv. Biol. Rep. 82(11.51). U.S. Army Corps of Engineers, TR EL-82-4.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pogonias cromis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 15 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTACCTAGTTTTCGGTGCATGAGCCGGAATAGTAGGCACAGCCCTAAGCCTCCTGATCCGAGCGGAGCTAAGTCAGCCCGGCTCACTCCTCGGAGATGATCAAGTTTATAACGTAATTGTTACGGCGCATGCCTTCGTTATAATTTTCTTTATAGTAATGCCTATTATGATTGGAGGGTTCGGGAACTGACTCGTACCCCTAATAGTAGGGGCACCCGACATAGCATTCCCCCGAATGAATAACATGAGCTTCTGGCTTCTCCCCCCTTCTTTCCTTCTGCTCCTAACCTCCTCAGGAGTAGAGGCAGGAGCCGGAACAGGATGAACAGTATACCCCCCACTTGCCGGCAACCTCGCACATGCAGGGGCCTCTGTCGACTTAGCCATCTTCTCCCTACACCTTGCAGGTGTTTCATCAATTCTTGGCGCTATCAACTTTATTACAACAATTATTAATATGAAACCTCCCGCCATTTCCCAATATCAAACACCCCTATTTGTATGAGCCGTTTTAATTACAGCTGTCCTTCTACTACTATCACTCCCAGTCTTAGCTGCTGGCATCACAATACTTCTGACAGACCGAAACCTAAACACAACCTTCTTCGACCCAGCAGGAGGGGGCGACCCAATTCTTTACCAACATTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Pogonias cromis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 14
Specimens with Barcodes: 22
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Presently, there are no conservation efforts being made for the Black Drum.

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; gamefish: yes; aquarium: public aquariums
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

The oyster industry suffers losses due to Black Drum predation (Beaulne and Ramcharan 2001)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

The Black Drum is valuable as a delicacy along the Gulf coast from Texas to Mississippi. It has recreational and moderate commercial importance along the Gulf of Mexico. The Black Drum is considered to be one of the best tasting Gulf fishes. The only drawback is that fish larger than 50 centimeters are not good to eat because they tend to contain Spaghetti Worms. So, fish smaller than 50 centimeters are the only ones that are harvested with regularity. (Texas Parks and Wildlife 2000, Maryland Dept. of Natural Resources 1999)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Limited commercial and recreational value. Fisheries Importance: COMMERCIAL FISHERY: Black drum are not an important commercial species in Florida, but are considered important recreationally. Between 1987 - 2001, the total commercial harvest of Pogonias cromis in Florida totaled 1.6 million pounds, and was valued at $679,928. Approximately 69.7% of black drum landings occurred on Florida's west coast. East coast landings totaled approximately 484,600 pounds,and were valued at $290,466. Of this, the 5 county area encompassing the IRL (Volusia, Brevard, Indian River, St. Lucie and Martin Counties) accounted for 94% of east coast landings (272,514 pounds), and was valued at $131,995. This ranks the black drum sixty-ninth in commercial value and fifty-ninth in pounds harvested. Figure 1 below shows the dollar value of the black drum commercial fishery to IRL counties by year. The fishery ranged in value from a high of $27,414 in 1988, to a low of $2,924 the following year. Volusia County accounted for 49.2% of the catch, followed distantly by Brevard (21.2%), Martin (14.3%), St. Lucie (12.0%) and Indian River (3.3%) Counties. Of note is the decrease in commercial catch, especially in Volusia and Martin Counties after the 1995 ban on gill-netting was implemented. RECREATIONAL FISHERY: The black drum, especially at larger size, is not generally considered a high-quality food fish due to commonly being infested with cestodes (spaghetti worms) (Simmons and Breuer 1962; Etzolt and Christmas 1979). However, black drum measuring less than 20 inches are valued in the recreational fishery (Silverman 1979). Recreational landings of black drum are significantly larger than commercial landings in all states within their range. For example, in 2003, 757,867 pounds of black drum were landed in Florida by commercial and recreational interests. Of the total harvest, 98% of landings were made by recreational anglers rather than by commercial fishers, with 72% of landings occurring on the Atlantic coast. Within the 5-county area of the Indian River Lagoon, black drum are regularly taken, but are not especially prized. Based on angler survey data, recreational anglers captured 926,545 black drum between 1997 - 2004 (Table 4, Figure 3), not including those fishes that were caught and released. The bulk of the recreational catch (43.6%) was taken within inland waters other than the Indian River Lagoon. Approximately 36.2% of the recreational catch is harvested from nearshore waters up to 3 miles offshore. Anglers fishing in the Indian River Lagoon took approximately 19.6% of the harvest, while those fishing up to 200 miles offshore accounted for only 0.6% of the total.As of 2005, Fishing regulations in Florida state that black drum must be no less than 14 inches TL, but not more than 24 inches TL to be of legal size; however, one black drum larger than 24 inches TL may be kept. A bag limit of 5 legal-sized black drum per person per day is in effect.
  • Beaumariage, D. S. 1969. Returns from the 1965 Schlitz tagging program including a cumulative analysis of previous results. Technical Series 59, Florida State Board of Conservation, St. Petersburg, Florida.
  • Beckman, D.W., A.L. Stanley, J.H. Render and C.A. Wilson, 1990 Age and growth of black drum in Louisiana waters of the Gulf of Mexico. Trans. Am. Fish. Soc. 119(3):537-544.
  • Benson, N. G., ed. 1982. Life history requirements of selected finfish and shellfish of Mississippi Sound and adjacent areas. U.S. Fish Wildl. Serv. Biol. Serv. Program FWS/O35-81/15.
  • Cody, T. J., K. W. Rice, and C. E. Bryan. 1985. Distribution and gonadal development of black drum in Texas Gulf waters. Tex. Pks. Wildl. Dep., Coast Fish. Branch, Manage. Data Ser. No. 72. 16 PP.
  • Etzold, D. J., and J. Y. Christmas, eds. 1979. A Mississippi marine finfish management plan. Mississippi-Alabama Sea Grant Consortium. MASGP-78-146. 36 pp.
  • Fitzhugh, G.R., B.A. Thompson and T.G. Snider III, 1993 Ovarian development, fecundity, and spawning frequency of black drum Pogonias cromis in Louisiana. Fish. Bull., U.S. 91:244-253.
  • Gunter, G. 1956. A revised list of euryhaline fishes of North and Middle America. Am. Midl. Nat. 56(2):345-354.
  • Hoese, H. D. 1965. Spawning of marine fishes in the Port Aransas, Texas area as determined by the distribution of young larvae. Ph.D. Dissertation. University of Texas, Austin. 144 pp.
  • International Game Fish Association, 2001 Database of IGFA angling records until 2001. IGFA, Fort Lauderdale, USA.
  • Joseph, E. B., W. H. Massmann, and J. J. Norcross. 1964. The pelagic eggs and early larval states of the black drum from Chesapeake Bay. Copeia 1964(2):425-434.
  • Johnson, G.D., 1978 Development of fishes of the Mid-Atlantic Bight. An atlas of egg, larval and juvenile stages. Vol. 4. Carangidae through Ephippidae. US Fish Wildl. Serv. Biol. Serv. Prog. FWS/OBS-78/12.
  • Leard, R., and ten co-authors. 1993. The black drum fishery of the Gulf of Mexico, United States: a regional management plan. Gulf States Marine Fisheries Commission, Number 28, Ocean Springs, MS.
  • McIlwain, T. D. 1978. An analysis of recreational angling in Biloxi Bay - 1972-1974. Ph.D. Dissertation. University of Southern Mississippi. Hattiesburg. 156 pp.
  • Miles, 0. W. 1949. A study of the food habits of the fishes of Aransas Bay area. Tex. Game Fish Oyster Comm., Mar. Lab. Annu. Rep. 1948-1949; 126-169.
  • Murphy, M.D.; Adams, D.H.; Tremain, D.M.; Winner, B.L. 1998. Direct validation of ages determined for adult black drum, Pogonias cromis, in east-central Florida with notes on black drum migration. Fish. Bull. (US) 96(2): 382-387.
  • Murphy, M.D.; Taylor, R.G. 1989. Reproduction and growth of black drum, Pogonias cromis, in Northeast Florida. Northeast Gulf Sci. 10(2): 127-137.
  • Murphy, M.D.; Muller, R.G. 1995. stock assessment of black drum Pogonias cromis in Florida. FMRI, In-house Report Series IHR 1995-005.
  • Osburn, H. R., and G. C. Matlock. 1984. Black drum movement in Texas bays. N. Am. J. Fish. Manage. 4:523-530.
  • Peters, K.M.; McMichael, R.H., Jr. 1990. Early life history of the black drum Pogonias cromis (Pisces: Sciaenidae) in Tampa Bay, Florida. Northeast Gulf Sci. 11(1):39-58.
  • Richards, C.E., 1973 Age, growth and distribution of the black drum (Pogonias cromis). Trans. Am. Fish. Soc. 102(3):584-590.
  • Ross, J. F., J. S. Pavela, and M. E. Chittenden, Jr. 1983. Seasonal occurrence of black drum, Pogonias cromis, and red drum, Sciaenops ocellatus, off Texas. Northeast Gulf Sci. 6(1):67-70.
  • Silverman, M. J. 1979. Biological and fisheries data on black drum, Pogonias cromis (Linnaeus). Northeast Fish. Nt. Sandy Hook Lab. Tech. Ser. Rep. 22. 35 Pp.
  • Simmons, E. G., and J. P. Breuer. 1962. A study of redfish, Sciaenops ocellata Linnaeus, and black drum, Pogonias cromis Linnaeus. Publ. Inst. Mar. Univ. Tex. 8:184-211.
  • Sutter, F.C., R.S. Wailer, and T.D. McIlwain. 1986. Species profiles: life histories and environmental requirements of coastal fishes and invertebrates (Gulf of Mexico)--black drum. U.S. Fish Wildl. Serv. Biol. Rep. 82(11.51). U.S. Army Corps of Engineers, TR EL-82-4.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Black drum

The black drum (Pogonias cromis) is a saltwater fish similar to its cousin, the red drum. It is the only species in the genus Pogonias. Though most specimens are generally found in the 5-30 lb (2–14 kg) range, the black drum is well known as the largest of all the drum family with some specimens reaching excesses of 90 lbs (40 kg). The world record black drum was just over 113 lbs (51 kg). They are often black and/or gray in color with juvenile fish having distinctive dark stripes over a gray body. Their teeth are rounded and they have powerful jaws capable of crushing oysters and other shellfish. It is recommended those over 15 lbs pounds (7 kg) should be released. Black drum are capable of producing tones between 100 Hz and 500 Hz when performing mating calls.

Habits, distribution, and characteristics[edit]

The black drum is usually found in or near brackish waters. Larger, older fish are more commonly found in the saltier areas of an estuary (closer to the ocean) near oyster beds or other plentiful food sources. Juvenile fish have 4 to 6 bold vertical black bars on a light background and can be mistaken for Sheepshead at first glance, but are distinguished on closer inspection because sheepshead have teeth and black drum have chin barbells. These stripes usually fade to dull grey as the fish grow from 12" to 24" in length. Juvenile fish are more commonly found in less salty areas and relate more strongly to structure and cover. In the western Atlantic, black drum are found from Nova Scotia to Florida, the Gulf of Mexico, the Antilles (uncommon), and the southern Caribbean coast; also from the Orinoco delta to Argentina.[1] They are common between the Delaware Bay and Florida coasts, and most abundant along the Texas coast. After reaching maturity by the end of their second year, black drum spawn in and around estuarine waters. In Texas, most spawning takes place in February and March.[2]

Feeding[edit]

Black drum larvae eat mostly zooplankton, and young black drum (less than 20 cm long) eat worms and small fish. Black drum are mostly bottom feeders, with adults eating mostly mollusks and crabs. In shallow water, they have been reported to feed with their heads down so that their tails show above the water surface. Their sensitive chin barbels help locate food, and strong pharyngeal teeth crush the shells of these preferred foods. It has been reported that, in captivity, large drum were able to eat more than two commercial-sized oysters per kilogram of body weight each day.[3] This translates into the potential for a 20 kg drum (about 45 lb) to eat 40 oysters a day. Fishing advice for black drum along the east and southeast coasts of the United States often includes the suggestion to locate an oyster bed. However, this preference has also caused black drum to be a nuisance for those who raise oysters commercially.[4] A group of black drum can do great damage to an oyster bed in a single day.

Black drum forage habits[5]
AgeLengthForage
Larvaefeed largely on zooplankton
Young80 – 200 mmsmall fish (36%) polychaetes (32%) and other invertebrates such as copepods, annelids, and amphipods
Adult210 – 500 mmmollusks (33% Mulinia transversa corbuloides)
Adultlonger than 500 mmmostly mollusks (74%) and crabs, shrimp, and aquatic vegetation depending on location

Growth[edit]

Weight vs. Length for black drum based on data from the Calcasieu Estuary, Louisiana. (Fall female curve is obscured by the spring female curve. Data are from Jenkins, 2004)
Length vs. age for black drum from two Gulf Coast locations.

Black drum reach maturity in 4–5 years (60–70 cm long). Before this, they grow 100–150 mm each year. After maturity, they continue to increase in size by 10–50 mm per year until about age 20.[6] Studies have reported black drum weighing more than 60 kg on the Atlantic coast and they are believed to live up to 60 years. Other studies suggest that black drum in the Gulf of Mexico do not grow as large or live as long; in a sample of 1357 black drum from coastal Louisiana, the largest individual was 22.6 kg and the oldest was 44 years.[7]

The Length vs. Age graph shows how the typical length of black drum increases with age.[8][9] The Weight vs. Length graph shows how the typical weight of black drum increases with length; small differences during different seasons have been measured as shown.[10] This kind of information can be used to estimate weight based on length. More scientifically, it can be used to determine whether a given sample of black drum is above or below expected weight, which may be related to a number of environmental conditions.

Fishing[edit]

Fish on left and right are black drum caught in the jetties of Calcasieu Pass, Cameron Parish, Louisiana. A red drum is in the middle. The drum were caught using [shrimp] for bait on 80 lb braided line and steel leaders.
Black drum caught in Lake Pontchartrain

Black drum are bottom feeders, so they are most commonly caught with bait either on the bottom or suspended within a couple feet of the bottom. Bottom fishing methods are used both in surf fishing and inshore fishing.[11] Shrimp is a typical bait that works well; squid can also be used and is less subject to bait stealing by hardhead catfish and Atlantic croakers which often frequent the same waters. There are times when the older, larger fish are more readily caught on a half or a quarter of a blue crab with the top shell removed and cut or broken to fit on a 4/0 to 9/0 hook. This type of fishing is often combined with chumming, a baiting practice that involves scattering bits of fish parts and blood into the water as an attractant.[12] Sometimes black drum are caught on spoons and jigs.

Black drum are reported to mouth a natural bait, so anglers need to wait a few seconds before setting the hook.[13] Once a big adult drum grabs the bait, it takes off with gusto, and can put up quite a fight. An unsecured rod can easily be pulled into the water. Landing these big fish on light tackle can be challenging, and since drum are primarily scent-based feeders, there is little disadvantage in using heavier line and tackle. A 40-lb braided line with a comparable weight flurocarbon leader is a good compromise between castability and strength. However, big drum are frequently caught with everything from 8-lb monofiliment to 100-lb braided lines with heavy steel leaders.

An effective strategy for fishing from a boat is to select a spot with a sandy bottom or oyster bed where food is plentiful at a time of day with some tidal movement. Pier or bank fishing should target jetties, structure, or a boat channel near a rapid increase in depth and some tidal movement. With stout tackle, black drum above 10 lbs are relatively easy for children to catch because they are not particularly skittish and do not easily come off once they are hooked. Because bigger drum can make a long, strong run right after taking the bait, preventing broken line often requires a relatively light drag setting early in the fight.

One researcher reported good success with trotline fishing techniques, which he used to catch a large sample of black drum for tagging and scientific study.[14]

On the table[edit]

Black drum are edible, with a moderate flavor and are not oily. Some restaurants in the southern US serve smaller black drum. Big drum can be challenging to clean; removing the large scales is a challenge. Many fishermen prefer to fillet with an electric knife, first removing the fillet from along the backbone, and then using the electric knife to cut the fillet from the skin and scales. Fish over 15 lbs can become tough and have a consistency comparable with chicken, rather than the flakey texture of many species of fish. Younger fish are often indistinguishable in flavor from red drum.[15]

Notes[edit]

  1. ^ Pogonias cromis, Froese, R. and D. Pauly. Editors. 2009.FishBase. World Wide Web electronic publication. www.fishbase.org, version (07/2009). http://www.fishbase.org/Summary/SpeciesSummary.php?id=425
  2. ^ Black Drum. Species Profiles: Life Histories and Environmental Requirements of Coastal Fishes and Invertebrates (Gulf of Mexico). US Department of the Interior Fish and Wildlife Service and US Army Corps of Engineers Coastal Ecology Group, Biological Report 82(11.51), 1986
  3. ^ Black Drum. Species Profiles: Life Histories and Environmental Requirements of Coastal Fishes and Invertebrates (Gulf of Mexico). US Department of the Interior Fish and Wildlife Service and US Army Corps of Engineers Coastal Ecology Group, Biological Report 82(11.51), 1986
  4. ^ George, Gerald. Acoustic Tagging of Black Drum on Louisiana Oyster Reefs: Movements, Site Fidelity, and Habitat Use. 2007. Master’s Thesis, Louisiana State University, p. 6
  5. ^ Black Drum. Species Profiles: Life Histories and Environmental Requirements of Coastal Fishes and Invertebrates (Gulf of Mexico); Biological Report 82 (11.51); US Department of the Interior, Fish and Wildlife Service; and US Army Corps of Engineers, Coastal Ecology Group Waterways Experiment
  6. ^ George, Gerald. Acoustic Tagging of Black Drum on Louisiana Oyster Reefs: Movements, Site Fidelity, and Habitat Use. 2007. Master’s Thesis, Louisiana State University
  7. ^ George, Gerald. Acoustic Tagging of Black Drum on Louisiana Oyster Reefs: Movements, Site Fidelity, and Habitat Use. 2007. Master’s Thesis, Louisiana State University, p. 9
  8. ^ Massey, Julie Kay, Age and Growth of Black Drum (Pogonias cromis Linnaeus) from Galveston Bay, Master’s Thesis, Texas A&M University, 1984, p. iii
  9. ^ Murphy, MD and Taylor RG, Reproduction and growth of black drum, Pogonias cromis, in Northeast Florida. Northeast Gulf Science, 10(2):127-137
  10. ^ Jenkins, J. Fish Bioindicators of Ecosystem Condition at the Calcasieu Estuary, Louisiana. USGS National Wetlands Research Center, Lafayette, LA, Open-File Report 2004-1323
  11. ^ Ken Schultz’s Essentials of Fishing, John Wiley & Sons, Inc., 2010, p. 70-71
  12. ^ Ken Schultz’s Essentials of Fishing, John Wiley & Sons, Inc., 2010, p. 70-71
  13. ^ Ken Schultz’s Essentials of Fishing, John Wiley & Sons, Inc., 2010, p. 70-71
  14. ^ George, Gerald. Acoustic Tagging of Black Drum on Louisiana Oyster Reefs: Movements, Site Fidelity, and Habitat Use. 2007. Master’s Thesis, Louisiana State University
  15. ^ A Comparison of Black Drum, Red Drum, and their Hybrid in Saltwater Pond Culture Anne Henderson-Arzapalo, Robert L. Colura, Anthony F. Maciorowski, Journal of the World Aquaculture Society Volume 25 Issue 2, Pages 289 - 296

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!