Overview

Comprehensive Description

Biology

Most common in shallow, sandy areas in and around seagrass beds. Prefers clear waters (Ref. 9626). Generally of no interest to fisheries because of its small average size (Ref. 5217).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Amazon River basin: Brazil, Colombia, Ecuador and Peru.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic: Bermuda and southern Florida (USA) to Brazil; throughout the Caribbean Sea.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This species is known from Bermuda and southern Florida (USA) to Brazil (including Fernando do Noronha and Trinidade Islands) (Bertoncini pers. comm. 2009), and throughout the Caribbean Sea.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Gulf of Mexico
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Maximum size: 175 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

17.5 cm TL (male/unsexed; (Ref. 9626))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Adults have a vertically elongate blue spot on each scale, the head has alternating vertical lines of pale blue and brownish orange, but these are broader than on X. novacula; adult males are more green in overall color and have a blue-edged inky black spot on midside of body within a pale region of pink or yellow (Ref. 13442).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth: 3 - 15m.
From 3 to 15 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

reef-associated; marine; depth range 3 - 15 m (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This species is most common in shallow, sandy areas in and around seagrass beds and coral reefs to depths of 15 m. It prefers clear waters over sand and rubble bottoms adjacent to reefs.

Species of Xyrichtys are called razorfish in allusion to their compressed bodies and the sharp leading edge of their forehead and snout, specialisations for quick entry into sand (Randall 2007).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 9 specimens in 1 taxon.
Water temperature and chemistry ranges based on 7 samples.

Environmental ranges
  Depth range (m): 1.2 - 28
  Temperature range (°C): 26.658 - 27.542
  Nitrate (umol/L): 0.174 - 1.844
  Salinity (PPS): 34.880 - 36.130
  Oxygen (ml/l): 4.583 - 4.686
  Phosphate (umol/l): 0.075 - 0.121
  Silicate (umol/l): 1.868 - 2.134

Graphical representation

Depth range (m): 1.2 - 28

Temperature range (°C): 26.658 - 27.542

Nitrate (umol/L): 0.174 - 1.844

Salinity (PPS): 34.880 - 36.130

Oxygen (ml/l): 4.583 - 4.686

Phosphate (umol/l): 0.075 - 0.121

Silicate (umol/l): 1.868 - 2.134
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Xyrichtys splendens

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 22 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTACCTTATTTTCGGTGCCTGGGCCGGGATAGTGGGCACAGCCCTAAGCTTGCTTATTCGAGCAGAGCTAAGCCAGCCCGGAGCCCTTCTTGGAGACGATCAAATTTACAATGTAATTGTTACAGCACATGCATTTGTAATAATTTTCTTTATAGTAATGCCAATCATGATCGGGGGATTTGGAAATTGACTTATCCCTCTCATGATTGGAGCCCCCGACATGGCCTTCCCTCGAATAAACAACATAAGCTTCTGGCTCCTGCCCCCTTCCTTCTTACTTCTTCTGGCCTCATCCGGCGTAGAAGCCGGAGCCGGGACAGGCTGAACTGTTTATCCTCCTTTAGCCGGAAATCTTGCCCACGCAGGTGCATCTGTCGATTTAACAATCTTCTCCCTTCACCTGGCAGGAATTTCTTCAATTTTAGGAGCAATTAATTTTATTACAACAATCATTAACATAAAACCCCCTGCCATCTCCCAGTATCAAACTCCCCTATTCGTTTGAGCCGTCCTGATTACAGCCGTCCTGCTTCTTCTCTCTCTCCCTGTTCTTGCTGCAGGAATTACAATGCTCCTGACAGATCGAAATCTAAACACCACCTTCTTTGACCCTGCGGGAGGAGGTGATCCAATTCTTTACCAGCACCTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Xyrichtys splendens

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 22
Specimens with Barcodes: 44
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Rocha, L.

Reviewer/s
Robertson, R. & Carpenter, K.E.

Contributor/s

Justification
This species is widely distributed in the western tropical Atlantic. It is common throughout its range, and can be locally abundant. There are no known major threats. It is listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is common throughout its range, and can be abundant in sand bottoms adjacent to reefs.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
There are no major threats known to this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no specific conservation measures in place for this species. This species distribution overlaps several marine protected areas within its range. It is present in conservation areas throughout the Caribbean, USA and Brazil.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!