Overview

Comprehensive Description

Biology

Found on rocky bottoms with sand or mud, or among seaweeds (Ref. 4698). Benthic (Ref. 58426). Feeds on fishes, large crustaceans, occasionally polychaetes and amphipods (Ref. 4698). During the spawning season, the male's underside becomes deep red with white spots.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

 Myoxocephalus scorpius is a moderately sized species of scorpionfish occasionally reaching as much as 60 cm in length. It has a large, broad head with warty protuberances and spines. It has a large, slightly downward pointing mouth and large dorsal eyes. Its body tapers gradually from the head to the tail. It has two dorsal fins narrowly attached. Its fins are tall, large and rounded apart from the the pelvic fins which consists of just three rays. The bull rout is green-brown above and often has dark blotches and bright milky-white spots above the pectoral fins. The underside is either cherry red (males) or light orange (females). The fins are mottled or with dark bands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

The most abundant and widespread arctic sculpin
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Spiny, plate-like scales above the body lateral line; Four dark, irregularly shaped saddles without distinct darker edges; Primary and secondary postocular and occipital protuberances (behind eye and on top of head) present in various combinations and weakly to well developed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

Like all scorpion fish this species has a broad, spiny head and a stout, scaleless body. There are numerous small spines on the skin above and below the lateral line. The colour is very variable and can be camouflaged with that of the surroundings. It is usually mottled green above with orange (females) or red (males) on the underside. It is one of the largest scorpion fish that occurs in the waters around Britain and Ireland growing to 30cm in length. The bull rout is similar to the long-spined sea scorpion (Taurulus bubalis) and the Norway bullhead (Taurulus lilljeborgi) but can be distinguished by the absence of a barbel at the corners of the mouth.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Atlantic: south-eastern coasts of Greenland, Jan Mayen Island, Iceland to British Isles and southward to Bay of Biscay, also North Sea, Baltic Sea, Spitsbergen and southern part of Barents Sea (including White Sea). Western Atlantic: James Bay in Canada to New York, USA (Ref. 7251). Arctic Ocean.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Circumpolar (including White Sea, Baltic Sea, North Sea).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Atlantic: south-eastern coasts of Greenland, Jan Mayen I., Iceland to British Isles, southward to Bay of Biscay, also North Sea, Baltic Sea, Spitzbergen and southern part of Barents Sea (including White Sea). Western Atlantic: James Bay in Canada to New York, USA. Arctic Ocean.
  • Bigelow, H.B. and W.C. Schroeder, 1953; Fedorov, V.V., 1986; Robins, C.R. and G.C. Ray, 1986; Whiteheat, P.J.P., Bauchot, M.-L., Hureau, J.-C., Nielsen, J., and E. Tortonese, 1984.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

This species is common all around the coasts of Britain and Ieland.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Baffin Bay, Hudson Bay, James Bay to New York
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 7 - 11; Dorsal soft rays (total): 13 - 19; Analspines: 0; Analsoft rays: 9 - 15; Vertebrae: 34 - 39
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 900 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

60.0 cm TL (male/unsexed; (Ref. 9925))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

to 90.0 cm TL (male/unsexed).
  • Bigelow, H.B. and W.C. Schroeder, 1953; Fedorov, V.V., 1986; Robins, C.R. and G.C. Ray, 1986; Whiteheat, P.J.P., Bauchot, M.-L., Hureau, J.-C., Nielsen, J., and E. Tortonese, 1984.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Caudal fin rounded. Greenish brown above, often with dark blotches and bright milky-white spots above pectoral fins; underside cherry red (males) or light orange (females) with white spots; fins with dark bands (Ref. 4698).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; brackish; marine; depth range 0 - 451 m (Ref. 58496)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 24334 specimens in 1 taxon.
Water temperature and chemistry ranges based on 8471 samples.

Environmental ranges
  Depth range (m): -9 - 482
  Temperature range (°C): -2.072 - 20.092
  Nitrate (umol/L): 0.664 - 28.605
  Salinity (PPS): 6.094 - 36.742
  Oxygen (ml/l): 0.982 - 8.635
  Phosphate (umol/l): 0.060 - 2.437
  Silicate (umol/l): 1.077 - 65.120

Graphical representation

Depth range (m): -9 - 482

Temperature range (°C): -2.072 - 20.092

Nitrate (umol/L): 0.664 - 28.605

Salinity (PPS): 6.094 - 36.742

Oxygen (ml/l): 0.982 - 8.635

Phosphate (umol/l): 0.060 - 2.437

Silicate (umol/l): 1.077 - 65.120
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 11 specimens in 1 taxon.
Water temperature and chemistry ranges based on 8 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 9.607 - 10.665
  Nitrate (umol/L): 2.603 - 16.868
  Salinity (PPS): 31.982 - 35.082
  Oxygen (ml/l): 6.356 - 6.677
  Phosphate (umol/l): 0.318 - 0.890
  Silicate (umol/l): 1.801 - 11.419

Graphical representation

Temperature range (°C): 9.607 - 10.665

Nitrate (umol/L): 2.603 - 16.868

Salinity (PPS): 31.982 - 35.082

Oxygen (ml/l): 6.356 - 6.677

Phosphate (umol/l): 0.318 - 0.890

Silicate (umol/l): 1.801 - 11.419
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

 The bull rout is a coastal benthic species usually found on rocky bottoms with sand or mud at depths down to 50 m.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 110m.
Recorded at 110 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Demersal; brackish; marine; depth range to 110 m. Found on rocky bottoms with sand or mud, or among seaweeds.
  • Bigelow, H.B. and W.C. Schroeder, 1953; Fedorov, V.V., 1986; Robins, C.R. and G.C. Ray, 1986; Whiteheat, P.J.P., Bauchot, M.-L., Hureau, J.-C., Nielsen, J., and E. Tortonese, 1984.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Arctic-subarctic; Benthic, from shoal waters to depth of 550 m (1,804 ft), typically < 100 m in the Arctic; On various substrates from muddy to rocky and smooth or vegetated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The bull rout occurs on a wide variety of seabed types at depths between 2-60m.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

benthic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Found on rocky, sandy and muddy bottoms to depths of 110 m.
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Found on rocky bottoms with sand or mud, or among seaweeds (Ref. 4698). Benthic (Ref. 58426). Feeds on fishes, large crustaceans, occasionally polychaetes, amphipods and benthic invertebrates (Ref. 4698, 12224). Preyed upon by black guillemots. Parasites of the species include 2 protozoans, 2 myxosporidians, 6 trematodes, 1 cestode, 3 nematodes and 4 hirudinoideans (Ref. 5951).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Fishes, large crustaceans, occasionally polychaetes and amphipods.
  • Bigelow, H.B. and W.C. Schroeder, 1953; Fedorov, V.V., 1986; Robins, C.R. and G.C. Ray, 1986; Whiteheat, P.J.P., Bauchot, M.-L., Hureau, J.-C., Nielsen, J., and E. Tortonese, 1984.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Feeds mainly on fishes (e.g., cods, flounders, smelts) and large crustaceans (e.g., Sclerocrangon, Hyas), occasionally polychaetes and amphipods; Semi-sedentary fish, lies in wait for prey
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Known predators

Myxocephalus scorpius (Myxocephalus scorpius fatherlasher) is prey of:
Lutra lutra
Ardea cinerea
Platichthys flesus
Cryptocotyle lingua
Podocotyle staffordi
Derogenes varicus
Opacelididii
Tetraphyllidae
Cestoda
Hysterothylacium aduncum

Based on studies in:
Scotland (Estuarine)

This list may not be complete but is based on published studies.
  • Hall SJ, Raffaelli D (1991) Food-web patterns: lessons from a species-rich web. J Anim Ecol 60:823–842
  • Huxham M, Beany S, Raffaelli D (1996) Do parasites reduce the chances of triangulation in a real food web? Oikos 76:284–300
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Myxocephalus scorpius (Myxocephalus scorpius fatherlasher) preys on:
Pomatoschistus microps
Crangon crangon
Copepoda
Balanus balanoides
Neomysis integer
Corophium volutator
Gammarus
Jaera albifrons

Based on studies in:
Scotland (Estuarine)

This list may not be complete but is based on published studies.
  • Hall SJ, Raffaelli D (1991) Food-web patterns: lessons from a species-rich web. J Anim Ecol 60:823–842
  • Huxham M, Beany S, Raffaelli D (1996) Do parasites reduce the chances of triangulation in a real food web? Oikos 76:284–300
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Diet

Feeds on fishes, large crustaceans, polychaetes and amphipods
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Eggs are deposited in a clutch on the bottom and defended by the male. Larvae hatch after about 5 weeks.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Spawns late fall to early spring; Eggs demersal, laid in clumps between rocks and guarded by males; Larvae and young juveniles pelagic
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Spawning season is from December to March during which time the male?s underside becomes deep red with white spots. A female deposits a clutch of eggs on the bottom, and the male defends the eggs. Larvae hatch after about 5 weeks.
  • Bigelow, H.B. and W.C. Schroeder, 1953; Fedorov, V.V., 1986; Robins, C.R. and G.C. Ray, 1986; Whiteheat, P.J.P., Bauchot, M.-L., Hureau, J.-C., Nielsen, J., and E. Tortonese, 1984.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Myoxocephalus scorpius

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 46
Specimens with Barcodes: 85
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Myoxocephalus scorpius

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 30 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATATCTAGTATTTGGTGCCTGAGCCGGAATAGTAGGCACAGCTCTAAGCCTCCTAATTCGGGCAGAACTAAGCCAACCCGGCGCCCTTTTAGGGGACGACCAAATTTATAATGTAATTGTTACCGCTCACGCCTTCGTAATAATCTTCTTTATAGTAATACCAATCATAATCGGGGGCTTCGGAAACTGACTCATCCCCCTAATGATTGGGGCCCCTGACATAGCCTTTCCCCGAATAAATAACATGAGCTTTTGGCTCCTCCCTCCCTCTTTTCTACTTCTCTTGGCCTCTTCGGGGGTTGAAGCAGGGGCAGGAACCGGGTGAACAGTCTACCCTCCCCTTGCTGGAAACCTGGCCCACGCGGGAGCCTCTGTTGACCTCACAATCTTTTCTTTACATCTAGCAGGAATCTCCTCAATTCTCGGAGCAATCAATTTTATTACGACCATCATCAACATAAAACCCCCAGCTATTTCCCAATACCAGACCCCCCTGTTCGTATGGTCTGTCCTAATTACAGCAGTCTTACTCCTTCTTTCTCTCCCCGTCCTTGCCGCCGGCATCACAATACTTTTAACGGACCGAAACCTTAACACCACCTTTTTTGATCCGGCAGGGGGTGGAGACCCCATCCTTTACCAACATCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N4 - Apparently Secure

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: public aquariums
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Myoxocephalus scorpius

Myoxocephalus scorpius, known variously as the shorthorn sculpin, short-spined sea scorpion, bull-head, bull-rout and the father-lasher, is a relatively small demersal fish of the Northern Atlantic and adjacent subarctic coasts. Adult fishes are commonly 15-30 cm in length, with a squat appearance. The fish has a large spiny head and a tapering body. It is a mottled grey-brown in colour but can be darker, including black as base coloring. It has a large mouth and spiny gill covers.[1]

Shorthorn sculpin is found among seaweed and stones on rocky bottoms with mud or sand.

Myoxocephalus scorpius is not venomous, but it can be mistaken for similar looking venomous fishes (scorpionfish).[2]

Other names[edit]

The English vernacular names of this fish include shorthorn sculpin (USA, Canada, Alaska), short-spined sea scorpion (UK, Ireland), bull-rout (UK), bullhead (UK), father-lasher (Isle of Man), goat sculpin, guffy, horny whore, pig-fish, scolping, scopin, scopy, scully, sculpin, granny fish, scummy and scumpy (all Newfoundland).[1]

References[edit]

  1. ^ a b Froese, Rainer and Pauly, Daniel, eds. (2006). "Myoxocephalus scorpius" in FishBase. April 2006 version.
  2. ^ http://www.glaucus.org.uk/Terror.htm
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!