Overview
Comprehensive Description
Biology
Most common in open sandy areas. Feeds on small sand-dwelling invertebrates. Dives head first into the sand when frightened. Generally common (Ref. 9710). Generally of no interest to fisheries because of its small average size (Ref. 5217).
-
Robins, C.R. and G.C. Ray 1986 A field guide to Atlantic coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 354 p. (Ref. 7251)
http://www.fishbase.org/references/FBRefSummary.php?id=7251&speccode=942
Trusted
Distribution
Western Atlantic: southern Florida, USA and Bahamas to northern South America.
-
Robins, C.R. and G.C. Ray 1986 A field guide to Atlantic coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 354 p. (Ref. 7251)
http://www.fishbase.org/references/FBRefSummary.php?id=7251&speccode=942
Trusted
Range Description
Xyrichtys martinicensis is distributed from southern Florida and the Bahamas to northern South America, including the eastern and southern Gulf of Mexico and the Antilles.
Trusted
Gulf of Mexico
-
Felder, D.L. and D.K. Camp (eds.), Gulf of Mexico–Origins, Waters, and Biota. Biodiversity. Texas A&M Press, College Station, Texas.
http://www.marinespecies.org/porifera/porifera.php?p=sourcedetails&id=145245
Trusted
Physical Description
Size
Max. size
15.0 cm TL (male/unsexed; (Ref. 7251))
-
Robins, C.R. and G.C. Ray 1986 A field guide to Atlantic coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 354 p. (Ref. 7251)
http://www.fishbase.org/references/FBRefSummary.php?id=7251&speccode=942
Trusted
Diagnostic Description
Females light greenish gray, becoming pinkish ventrally, with diffuse orange-red stripe from behind eye to base of caudal fin; a broad white area over abdomen, the lower part with vertical lines of red; there may be faint red bars on the body. Large adult males lose the distinctive red, white and black markings; they develop a vertically elongate blue spot on each body scale; a yellow head with near-vertical pale blue bands, and a large dark spot in axil of pectoral fins (Ref. 13442).
-
Randall, J.E. 1996 Caribbean reef fishes. Third edition - revised and enlarged. T.F.H. Publications, Inc. Ltd., Hong Kong. 3nd ed. 368 p. (Ref. 13442)
http://www.fishbase.org/references/FBRefSummary.php?id=13442&speccode=942
Trusted
Type Information
Type for Xyrichthys infirmus
Catalog Number: USNM 37076
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): T. Bean
Year Collected: 1885
Locality: Caribbean Sea: Off Yucatan, Cozumel, Havana, Cuba To Yucatan, Yucatan, Mexico, Caribbean Sea, Atlantic
Vessel: Albatross
Catalog Number: USNM 37076
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): T. Bean
Year Collected: 1885
Locality: Caribbean Sea: Off Yucatan, Cozumel, Havana, Cuba To Yucatan, Yucatan, Mexico, Caribbean Sea, Atlantic
Vessel: Albatross
- Type:
Trusted
Type for Xyrichthys niveilatus
Catalog Number: USNM 50646
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): D. Jordan & B. Evermann
Locality: Honolulu, Hawaii, Oahu, Hawaii, United States, Hawaiian Islands, Pacific
Catalog Number: USNM 50646
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): D. Jordan & B. Evermann
Locality: Honolulu, Hawaii, Oahu, Hawaii, United States, Hawaiian Islands, Pacific
- Type:
Trusted
Ecology
Habitat
Environment
reef-associated; marine; depth range 2 - 21 m (Ref. 7251)
-
Robins, C.R. and G.C. Ray 1986 A field guide to Atlantic coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 354 p. (Ref. 7251)
http://www.fishbase.org/references/FBRefSummary.php?id=7251&speccode=942
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
Xyrichtys martinicensis inhabits sand and rubble bottoms adjacent to reefs and seagrass to depths of 21 m. Species of Xyrichtys are called razorfish in allusion to their compressed bodies and the sharp leading edge of their forehead and snout, specialisations for quick entry into sand (Randall 2007). It feeds on small sand-dwelling invertebrates.
Systems
- Marine
Trusted
Depth range based on 3 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3 samples.
Environmental ranges
Depth range (m): 2.25 - 114
Temperature range (°C): 19.645 - 27.438
Nitrate (umol/L): 0.174 - 7.308
Salinity (PPS): 35.377 - 36.238
Oxygen (ml/l): 3.728 - 4.662
Phosphate (umol/l): 0.100 - 0.633
Silicate (umol/l): 2.134 - 3.510
Graphical representation
Depth range (m): 2.25 - 114
Temperature range (°C): 19.645 - 27.438
Nitrate (umol/L): 0.174 - 7.308
Salinity (PPS): 35.377 - 36.238
Oxygen (ml/l): 3.728 - 4.662
Phosphate (umol/l): 0.100 - 0.633
Silicate (umol/l): 2.134 - 3.510
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 3 samples.
Environmental ranges
Depth range (m): 2.25 - 114
Temperature range (°C): 19.645 - 27.438
Nitrate (umol/L): 0.174 - 7.308
Salinity (PPS): 35.377 - 36.238
Oxygen (ml/l): 3.728 - 4.662
Phosphate (umol/l): 0.100 - 0.633
Silicate (umol/l): 2.134 - 3.510
Graphical representation
Depth range (m): 2.25 - 114
Temperature range (°C): 19.645 - 27.438
Nitrate (umol/L): 0.174 - 7.308
Salinity (PPS): 35.377 - 36.238
Oxygen (ml/l): 3.728 - 4.662
Phosphate (umol/l): 0.100 - 0.633
Silicate (umol/l): 2.134 - 3.510
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Trophic Strategy
Most common in open sandy areas. Feeds on small sand-dwelling invertebrates. Dives head first into the sand when frightened.
-
Robins, C.R. and G.C. Ray 1986 A field guide to Atlantic coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 354 p. (Ref. 7251)
http://www.fishbase.org/references/FBRefSummary.php?id=7251&speccode=942
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Xyrichtys martinicensis
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 14 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 14 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
CCTTTATCTTATTTTCGGTGCTTGGGCCGGGATAGTGGGCACAGCCCTAAGCTTGCTTATTCGAGCAGAGCTAAGCCAACCCGGGGCCCTTCTTGGAGACGACCAAATTTACAATGTAATCGTTACAGCACACGCATTCGTAATAATCTTCTTTATAGTAATACCAATTATAATTGGCGGATTTGGAAACTGACTAATTCCCTTAATGATCGGGGCCCCCGACATGGCGTTCCCTCGAATGAACAACATAAGTTTCTGACTTCTGCCCCCCTCTTTCTTACTCCTCCTGGCATCGTCTGGCGTTGAAGCTGGAGCCGGAACTGGTTGAACCGTCTACCCCCCCCTGGCTGGAAACCTTGCCCATGCAGGTGCATCCGTTGATTTAACAATCTTCTCACTGCATCTTGCAGGGATTTCTTCAATTTTAGGAGCAATTAATTTTATTACAACGATTATTAACATGAAGCCCCCTGCCATCTCCCAATACCAGACCCCCCTATTTGTTTGAGCCGTCCTTATTACAGCCGTCCTACTCCTTCTCTCCCTGCCGGTTCTTGCCGCAGGCATTACAATGCTCCTCACAGACCGAAACCTAAACACAACCTTCTTTGACCCTGCCGGAGGAGGTGACCCAATTCTTTACCAACATTTA
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Xyrichtys martinicensis
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 14
Specimens with Barcodes: 14
Species With Barcodes: 1
Public Records: 14
Specimens with Barcodes: 14
Species With Barcodes: 1
Trusted
Conservation
Conservation Status
IUCN Red List Assessment
Red List Category
LC
Least Concern
Red List Criteria
Version
3.1
Year Assessed
2010
Assessor/s
Sadovy, Y.J. & Luiz Rocha.
Reviewer/s
Collen, B., Richman, N., Beresford, A., Chenery, A. & Ram, M.
Contributor/s
De Silva, R., Milligan, H., Lutz, M., Batchelor, A., Jopling, B., Kemp, K., Lewis, S., Lintott, P., Sears, J., Wilson, P., Smith, J. & Livingston, F.
Justification
Xyrichtys martinicensis has been assessed as Least Concern. This species is widely distributed in the Caribbean and Brazil. It is common throughout its range, and can be locally abundant. There are no known major threats.
Trusted
Trends
Population
Population
Population Trend
Xyrichtys martinicensis is common throughout its range. It can be abundant over sand bottoms adjacent to reefs.
Population Trend
Unknown
Trusted
Threats
Least Concern (LC)
-
IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
http://www.fishbase.org/references/FBRefSummary.php?id=57073
Trusted
Major Threats
There are no known major threats to Xyrichtys martinicensis.
Trusted
Management
Conservation Actions
Conservation Actions
There are no species-specific conservation measures in place. This species is present in marine protected areas throughout the Caribbean, Brazil and USA.
Trusted
Relevance to Humans and Ecosystems
Benefits
Importance
aquarium: commercial
-
Burgess, W.E., H.R. Axelrod and R.E. Hunziker III 1990 Dr. Burgess's atlas of marine aquarium fishes. T.F.H. Publications, Inc., Neptune City, New Jersey. 768 p.
http://www.fishbase.org/references/FBRefSummary.php?id=9210
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!


