Overview

Comprehensive Description

Biology

Most common in open sandy areas. Feeds on small sand-dwelling invertebrates. Dives head first into the sand when frightened. Generally common (Ref. 9710). Generally of no interest to fisheries because of its small average size (Ref. 5217).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Western Atlantic: southern Florida, USA and Bahamas to northern South America.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Xyrichtys martinicensis is distributed from southern Florida and the Bahamas to northern South America, including the eastern and southern Gulf of Mexico and the Antilles.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Gulf of Mexico
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Maximum size: 150 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

15.0 cm TL (male/unsexed; (Ref. 7251))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Females light greenish gray, becoming pinkish ventrally, with diffuse orange-red stripe from behind eye to base of caudal fin; a broad white area over abdomen, the lower part with vertical lines of red; there may be faint red bars on the body. Large adult males lose the distinctive red, white and black markings; they develop a vertically elongate blue spot on each body scale; a yellow head with near-vertical pale blue bands, and a large dark spot in axil of pectoral fins (Ref. 13442).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type for Xyrichthys infirmus
Catalog Number: USNM 37076
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): T. Bean
Year Collected: 1885
Locality: Caribbean Sea: Off Yucatan, Cozumel, Havana, Cuba To Yucatan, Yucatan, Mexico, Caribbean Sea, Atlantic
Vessel: Albatross
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type for Xyrichthys niveilatus
Catalog Number: USNM 50646
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): D. Jordan & B. Evermann
Locality: Honolulu, Hawaii, Oahu, Hawaii, United States, Hawaiian Islands, Pacific
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 2 - 21 m (Ref. 7251)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Xyrichtys martinicensis inhabits sand and rubble bottoms adjacent to reefs and seagrass to depths of 21 m. Species of Xyrichtys are called razorfish in allusion to their compressed bodies and the sharp leading edge of their forehead and snout, specialisations for quick entry into sand (Randall 2007). It feeds on small sand-dwelling invertebrates.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 3 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3 samples.

Environmental ranges
  Depth range (m): 2.25 - 114
  Temperature range (°C): 19.645 - 27.438
  Nitrate (umol/L): 0.174 - 7.308
  Salinity (PPS): 35.377 - 36.238
  Oxygen (ml/l): 3.728 - 4.662
  Phosphate (umol/l): 0.100 - 0.633
  Silicate (umol/l): 2.134 - 3.510

Graphical representation

Depth range (m): 2.25 - 114

Temperature range (°C): 19.645 - 27.438

Nitrate (umol/L): 0.174 - 7.308

Salinity (PPS): 35.377 - 36.238

Oxygen (ml/l): 3.728 - 4.662

Phosphate (umol/l): 0.100 - 0.633

Silicate (umol/l): 2.134 - 3.510
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 2 - 21m.
From 2 to 21 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Most common in open sandy areas. Feeds on small sand-dwelling invertebrates. Dives head first into the sand when frightened.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Xyrichtys martinicensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 14 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTTATTTTCGGTGCTTGGGCCGGGATAGTGGGCACAGCCCTAAGCTTGCTTATTCGAGCAGAGCTAAGCCAACCCGGGGCCCTTCTTGGAGACGACCAAATTTACAATGTAATCGTTACAGCACACGCATTCGTAATAATCTTCTTTATAGTAATACCAATTATAATTGGCGGATTTGGAAACTGACTAATTCCCTTAATGATCGGGGCCCCCGACATGGCGTTCCCTCGAATGAACAACATAAGTTTCTGACTTCTGCCCCCCTCTTTCTTACTCCTCCTGGCATCGTCTGGCGTTGAAGCTGGAGCCGGAACTGGTTGAACCGTCTACCCCCCCCTGGCTGGAAACCTTGCCCATGCAGGTGCATCCGTTGATTTAACAATCTTCTCACTGCATCTTGCAGGGATTTCTTCAATTTTAGGAGCAATTAATTTTATTACAACGATTATTAACATGAAGCCCCCTGCCATCTCCCAATACCAGACCCCCCTATTTGTTTGAGCCGTCCTTATTACAGCCGTCCTACTCCTTCTCTCCCTGCCGGTTCTTGCCGCAGGCATTACAATGCTCCTCACAGACCGAAACCTAAACACAACCTTCTTTGACCCTGCCGGAGGAGGTGACCCAATTCTTTACCAACATTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Xyrichtys martinicensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 14
Specimens with Barcodes: 14
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Sadovy, Y.J. & Luiz Rocha.

Reviewer/s
Collen, B., Richman, N., Beresford, A., Chenery, A. & Ram, M.

Contributor/s
De Silva, R., Milligan, H., Lutz, M., Batchelor, A., Jopling, B., Kemp, K., Lewis, S., Lintott, P., Sears, J., Wilson, P., Smith, J. & Livingston, F.

Justification
Xyrichtys martinicensis has been assessed as Least Concern. This species is widely distributed in the Caribbean and Brazil. It is common throughout its range, and can be locally abundant. There are no known major threats.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Xyrichtys martinicensis is common throughout its range. It can be abundant over sand bottoms adjacent to reefs.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
There are no known major threats to Xyrichtys martinicensis.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species-specific conservation measures in place. This species is present in marine protected areas throughout the Caribbean, Brazil and USA.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!