Overview

Comprehensive Description

Description: Body thin and long with a markedly narrowed eye (pre-transitional) to large and round (recruits) with a pointed snout and a terminal small mouth. Pectoral fins medium, reach to vent. Pelvic fins stubs. Dorsal and anal-fin bases long, caudal peduncle short. There are no surface or internal melanophores. Transitional recruits show a dark stripe of fine melanophores curving up from the eye across the upper body onto the base of the upper caudal-fin segmented rays. There is a lighter band beneath the stripe ending in a white patch at the base of the central caudal-fin rays.

Creative Commons Attribution 3.0 (CC BY 3.0)

© www.coralreeffish.com by Benjamin Victor

Source: CORALREEFFISH.COM

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

Most common in open sandy areas. Feeds on small sand-dwelling invertebrates. Dives head first into the sand when frightened. Generally common (Ref. 9710). Generally of no interest to fisheries because of its small average size (Ref. 5217).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Xyrichtys martinicensis is distributed from southern Florida and the Bahamas to northern South America, including the eastern and southern Gulf of Mexico and the Antilles.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic: southern Florida, USA and Bahamas to northern South America.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Maximum size: 150 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

15.0 cm TL (male/unsexed; (Ref. 7251))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Diagnosis: The fin-ray count of D-IX,12 A-III,12 and Pect-12 indicates the razorfish genus Xyrichtys. One other regional labrid, Halichoeres cyanocephalus, shares the median-fin ray count, but has 13 pectoral-fin rays and a clearly different body shape. The three Caribbean razorfishes, X. martinicensis, X. novacula, and X. splendens, share fin-ray counts and the larvae can overlap in appearance. The species become distinct as they develop juvenile markings: X. martinicensis recruits are recognized by a simple lateral stripe from the eye to the tail that is not broken up into patches or spots.

Creative Commons Attribution 3.0 (CC BY 3.0)

© www.coralreeffish.com by Benjamin Victor

Source: CORALREEFFISH.COM

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Females light greenish gray, becoming pinkish ventrally, with diffuse orange-red stripe from behind eye to base of caudal fin; a broad white area over abdomen, the lower part with vertical lines of red; there may be faint red bars on the body. Large adult males lose the distinctive red, white and black markings; they develop a vertically elongate blue spot on each body scale; a yellow head with near-vertical pale blue bands, and a large dark spot in axil of pectoral fins (Ref. 13442).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type for Xyrichthys infirmus
Catalog Number: USNM 37076
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): T. Bean
Year Collected: 1885
Locality: Caribbean Sea: Off Yucatan, Cozumel, Havana, Cuba To Yucatan, Yucatan, Mexico, Caribbean Sea, Atlantic
Vessel: Albatross
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type for Xyrichthys niveilatus
Catalog Number: USNM 50646
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): D. Jordan & B. Evermann
Locality: Honolulu, Hawaii, Oahu, Hawaii, United States, Hawaiian Islands, Pacific
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Look Alikes

Analogues: Larval Xyrichtys have no melanophores and often markedly-narrowed eyes. The absence of external melanophores is shared with larval Doratonotus megalepis, which are distinctly wider-bodied and have large round eyes. All other regional labrid and scarid larvae have melanophores. X. martinicensis recruits have a simple lateral stripe from the eye to the tail while X. novacula recruits have a stripe that is broken up into discrete patches or spots. X. splendens recruits develop a complex pattern of bars and reticulations. X. martinicensis recruits also do not display the extended first dorsal fin spines characteristic of the juveniles of the other two razorfish species.

Creative Commons Attribution 3.0 (CC BY 3.0)

© www.coralreeffish.com by Benjamin Victor

Source: CORALREEFFISH.COM

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Xyrichtys martinicensis inhabits sand and rubble bottoms adjacent to reefs and seagrass to depths of 21 m. Species of Xyrichtys are called razorfish in allusion to their compressed bodies and the sharp leading edge of their forehead and snout, specialisations for quick entry into sand (Randall 2007). It feeds on small sand-dwelling invertebrates.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

reef-associated; marine; depth range 2 - 21 m (Ref. 7251)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 3 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3 samples.

Environmental ranges
  Depth range (m): 2.25 - 114
  Temperature range (°C): 19.645 - 27.438
  Nitrate (umol/L): 0.174 - 7.308
  Salinity (PPS): 35.377 - 36.238
  Oxygen (ml/l): 3.728 - 4.662
  Phosphate (umol/l): 0.100 - 0.633
  Silicate (umol/l): 2.134 - 3.510

Graphical representation

Depth range (m): 2.25 - 114

Temperature range (°C): 19.645 - 27.438

Nitrate (umol/L): 0.174 - 7.308

Salinity (PPS): 35.377 - 36.238

Oxygen (ml/l): 3.728 - 4.662

Phosphate (umol/l): 0.100 - 0.633

Silicate (umol/l): 2.134 - 3.510
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 2 - 21m.
From 2 to 21 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Most common in open sandy areas. Feeds on small sand-dwelling invertebrates. Dives head first into the sand when frightened.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Xyrichtys martinicensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 14 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTTATTTTCGGTGCTTGGGCCGGGATAGTGGGCACAGCCCTAAGCTTGCTTATTCGAGCAGAGCTAAGCCAACCCGGGGCCCTTCTTGGAGACGACCAAATTTACAATGTAATCGTTACAGCACACGCATTCGTAATAATCTTCTTTATAGTAATACCAATTATAATTGGCGGATTTGGAAACTGACTAATTCCCTTAATGATCGGGGCCCCCGACATGGCGTTCCCTCGAATGAACAACATAAGTTTCTGACTTCTGCCCCCCTCTTTCTTACTCCTCCTGGCATCGTCTGGCGTTGAAGCTGGAGCCGGAACTGGTTGAACCGTCTACCCCCCCCTGGCTGGAAACCTTGCCCATGCAGGTGCATCCGTTGATTTAACAATCTTCTCACTGCATCTTGCAGGGATTTCTTCAATTTTAGGAGCAATTAATTTTATTACAACGATTATTAACATGAAGCCCCCTGCCATCTCCCAATACCAGACCCCCCTATTTGTTTGAGCCGTCCTTATTACAGCCGTCCTACTCCTTCTCTCCCTGCCGGTTCTTGCCGCAGGCATTACAATGCTCCTCACAGACCGAAACCTAAACACAACCTTCTTTGACCCTGCCGGAGGAGGTGACCCAATTCTTTACCAACATTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Xyrichtys martinicensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 14
Specimens with Barcodes: 14
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Sadovy, Y.J. & Luiz Rocha.

Reviewer/s
Collen, B., Richman, N., Beresford, A., Chenery, A. & Ram, M.

Contributor/s
De Silva, R., Milligan, H., Lutz, M., Batchelor, A., Jopling, B., Kemp, K., Lewis, S., Lintott, P., Sears, J., Wilson, P., Smith, J. & Livingston, F.

Justification
Xyrichtys martinicensis has been assessed as Least Concern. This species is widely distributed in the Caribbean and Brazil. It is common throughout its range, and can be locally abundant. There are no known major threats.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Xyrichtys martinicensis is common throughout its range. It can be abundant over sand bottoms adjacent to reefs.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
There are no known major threats to Xyrichtys martinicensis.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species-specific conservation measures in place. This species is present in marine protected areas throughout the Caribbean, Brazil and USA.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!