Overview

Comprehensive Description

Biology

Occurs in both forest and savannah biotopes (Ref. 5644); present in littoral riverine habitats and permanent floodplain lagoons with clear water. Feeds on shrimps, insects and small fishes. A nesting substrate spawner which breeds in the early summer. Used for tilapia control (Ref. 4537). Maximum TL was recorded at 26.5 cm.
  • Teugels, G.G. and D.F.E. Thys van den Audenaerde 1992 Cichlidae. p. 714-779. In C. Levêque, D. Paugy and G.G. Teugels (eds.) Faune des poissons d'eaux douces et saumâtres d'Afrique de l'Ouest. Tome 2. Coll. Faune Tropicale n° 28. Musée Royal de l'Afrique Centrale, Tervuren, Belgique and O.R.S.T.O.M., Paris, 902 p. (Ref. 7378)   http://www.fishbase.org/references/FBRefSummary.php?id=7378&speccode=8581 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Africa: widely distributed in West Africa, where it is known from most hydrographic basins (Ref. 53405). Also in the Nile basin, Lake Chad basin and in the upper Zambezi (Ref. 5644). Distribution of this species and overlap with Hemichromis elongatus unclear, but probably absent from the Congo basin (see also Ref. 43352, 52307, 53405, 81260). Introduced around 1970 in a stream fed by hot springs in Villach (Austria) (Ref. 59043).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This species is recorded from Mauritania to Ethiopia.

Northern Africa: The species is recorded from Mauritania. It is rare in Egypt (Manzalah Lake).

Northeastern Africa: It is recorded in the Ghazal and Jebel systems, including Lake No, Sudan, and Baro River, Ethiopia

Western Africa: The species is known across the majority of the basins in Western Africa.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Central and western Africa; Austria (introduced).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 14 - 15; Dorsal soft rays (total): 11 - 13; Analspines: 3; Analsoft rays: 8 - 11
  • Teugels, G.G. and D.F.E. Thys van den Audenaerde 2003 Cichlidae. p. 521-600. In D. Paugy, C. Lévêque and G.G Teugels (eds.) The fresh and brackish water fishes of West Africa Volume 2. Coll. faune et flore tropicales 40. Institut de recherche de développement, Paris, France, Muséum national d'histoire naturelle, Paris, France and Musée royal de l'Afrique Central, Tervuren, Belgium, 815p. (Ref. 53405)   http://www.fishbase.org/references/FBRefSummary.php?id=53405&speccode=8136 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 204 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

20.4 cm SL (male/unsexed; (Ref. 53405)); max. published weight: 300 g (Ref. 3799)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Diagnosis: 5 dark blotches or cross bars on sides, often alternating with narrower intercalary bars, the first blotch confluent with the opercular spot, the fifth on caudal-fin base; upper profile of snout straight or concave (Ref. 53405).Description: body cylindrical; premaxilla extremely protrusible; lower jaw distinctly prominent; outer jaw teeth mixed mono- and bicuspid, inner jaw teeth monocuspid, pharyngeal jaw teeth bicuspid; dentition reduced to an incomplete row of inner teeth in upper jaw; micro-gillrakers present; scales cycloid; caudal peduncle rather short (length 11.0-16.0% of standard length) (Ref. 53405).Coloration: live colour usually copper-red through olivaceous to dark brown on back; lower part of body orange-red, more pinkish on belly; large, irregular black blotch on upper area of opercle; 4-5 large, black blotches along midline of sides and 3-5 rows of small black spots in between in specimens over 100 mm SL; narrow, dark lacrymal band sometimes present; vertical fins light grey; soft parts of dorsal and anal fins with basal reticulate pattern; spinous part of dorsal fin bright red; soft part of dorsal and distal part of caudal fins edged with bright red; anterior 1/3 of pelvics blackish, other 2/3 light grey; pectoral fins hyaline (Ref. 53405). Juveniles without orange-red coloration of adults, showing traces of dark intercalary bars; subadults and adults also with dark intercalary bars when under stress (Ref. 53405).
  • Teugels, G.G. and D.F.E. Thys van den Audenaerde 2003 Cichlidae. p. 521-600. In D. Paugy, C. Lévêque and G.G Teugels (eds.) The fresh and brackish water fishes of West Africa Volume 2. Coll. faune et flore tropicales 40. Institut de recherche de développement, Paris, France, Muséum national d'histoire naturelle, Paris, France and Musée royal de l'Afrique Central, Tervuren, Belgium, 815p. (Ref. 53405)   http://www.fishbase.org/references/FBRefSummary.php?id=53405&speccode=8136 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Zambezi River Benthopelagic Habitat

This taxon is one of a number of benthopelagic species in the Zambezi River system of southern Africa. Benthopelagic river fish are found near the bottom of the water column, feeding on benthos and zooplankton

Nutrient levels in the Zambezi River are relatively low, especially in the upper Zambezi; in that reach, above Victoria Falls, most of the catchment drains Kalahari sands, whose nutrient levels are inherently low due to their aeolian formation; moreover, agricultural fertilizer addition throughout the Zambezi watershed is low, due to the shortage of capital available to farmers of this region.

Nitrate levels (as nitrogen) in the upper Zambezi are typically in the range of .01 to .03 milligrams per liter. Correspondingly electrical conductivity of the upper Zambezi is on the order of 75 micro-S per centimeter, due to the paucity of ion content. From the Luangwa River downstream nitrate levels elevate to .10 to .18 milligrams per liter, and electrical conductivity rises to a range of two to four times the upper Zambezi levels. Not surprisingly, pH, calcium ion concentration, bicarbonate and electrical conductivity are all higher in portions of the catchment where limestone soils predominate compared to granite.

There are a total of 190 known fish species present in the Zambezi River, including eel and shark taxa. The largest native benthopelagic fish in the Zambezi are the 170 cm North African catfish (Clarias gariepinus), the 146 cm common carp (Cyprinus carpio carpio), the 150 cm Indo-Pacific tarpon (Megalops cyprinoides) and the introduced 120 cm rainbow trout (Oncorhynchus mykiss).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© C.Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Environment

benthopelagic; potamodromous (Ref. 51243); freshwater; pH range: 7.0; dH range: 15
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This species inhabits permanent floodplain lagoons with clear water, occasionally on rocky streams, occasionally in standing deep water, common in shallow swamps. According to Pouilly (1993), Hemichromis fasciatus is found in rivers that have low speed of current, a strong height of water, a formed substrate of blocks and a few plant. According to Albaret (1982), the species is monogamist keeping and protecting eggs and alevins but not practising oral incubation. According to Daget (1965), the eggs are fixed on an immersed support, in a clean place, with the shelter of the current, a depth from 10 to 20 cm. The reproduction of the species seems spread out throughout the year (from April at November in Bandama), with the proportion of mature individuals constantly remaining relatively low and the RGS small. Up to 20 mm length, the alevins nourish phytoplankton. From 20 with 45mm, they preferably seek shellfish and insects. From 50 mm, the young attacks only large preys; they devour all the young fish which pass to their carried. So H. fasciatus is used in pisciculture to limit the proliferation of the species to laying many and invading such as H. niloticus. Used for tilapia control.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Potamodromous. Migrating within streams, migratory in rivers, e.g. Saliminus, Moxostoma, Labeo. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Frequency of occurence in Caprivi: occasionally on rocky streams, occasionally in standing deep water, common in shallow swamps (Ref. 37065).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Introduced individuals in Austria reported to form pairs during spawning. Female deposits eggs on exposed hard surfaces such as stones or wood. Both parents guard larvae and juveniles for 4-8 weeks (Ref. 59043).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Hemichromis fasciatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CTCTATCTAGTATTTGGTGCTTGGGCCGGAATAGTAGGAACCGCACTCAGCCTACTGATTCGAGCAGAACTAAGCCAACCCGGTTCTCTCCTAGGAGACGACCAAATTTATAATGTAATTGTTACGGCGCACGCCTTCGTGATAATTTTCTTTATAGTAATACCAATTATGATTGGGGGCTTCGGAAACTGACTAGTCCCCCTTATAATTGGGGCCCCTGACATAGCCTTCCCTCGCATGAACAACATGAGCTTTTGACTCCTACCCCCCTCGTTCCTTCTCCTCCTCGCCTCGTCAGGCGTTGAAGCTGGTGCCGGCACTGGGTGAACCGTCTACCCCCCTCTAGCTGGCAACCTCGCCCACGCCGGACCCTCCGTTGACCTAACCATCTTCTCCCTTCATCTCGCTGGGGTGTCTTCTATCCTGGGCGCAATTAACTTTATTACTACAATTATTAATATAAAACCCCCAGCTATTTCCCAGTACCAAACACCCTTGTTTGTCTGATCAGTCCTAATTACGGCAGTACTCCTTCTACTATCCCTGCCCGTCCTTGCGGCTGGCATTACGATACTTCTAACAGACCGTAATCTTAACACGACCTTCTTTGACCCAGCTGGAGGGGGCGACCCAATCCTCTACCAACACTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hemichromis fasciatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Azeroual, A., Bousso, T., Getahun, A. & Lalèyè, P.

Reviewer/s
Snoeks, J., Tweddle, D., Getahun, A., Lalèyè, P., Paugy, D., Zaiss, R., Fishar, M.R.A & Brooks, E.

Contributor/s

Justification
This species has a wide distribution, with no known major widespread threats. It is therefore listed as Least Concern. It has also been assessed regionally as Least Concern for western Africa. The north and northeastern regional assessments are currently Data Deficient.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This is a locally declining species.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
Overfishing, loss of dry season refuges and rapids habitat due to development and dams all threaten populations of this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
No information available.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: subsistence fisheries; aquaculture: commercial; aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!