Table of Contents
Overview
Comprehensive Description
Biology
Oceanic and mesopelagic, found in the upper 200 m at night but deeper in the region of Subtropical Convergence (Ref. 4066). Feeds mainly on Euphausia superba; also takes copepods (Euchaeta antarctica, Rhincalanus gigas), amphipods (Primno macropa, Themisto gaudichaudii) and the euphausiid Thysanoessa macrura.
-
Hulley, P.A. 1990 Myctophidae. p. 146-178. In O. Gon and P.C. Heemstra (eds.) Fishes of the Southern Ocean. J.L.B. Smith Institute of Ichthyology, Grahamstown, South Africa. (Ref. 5182)
http://www.fishbase.org/references/FBRefSummary.php?id=5182&speccode=6981
© FishBase
Source:
FishBase
Trusted
Distribution
Generally ranges between the coasts of Antarctic and 33°S (south-western Atlantic Ocean sector), 46°S (Indian Ocean sector between 50°-71°E), and about 46°S (Pacific Ocean sector off Chile).
-
Hulley, P.A. 1990 Myctophidae. p. 146-178. In O. Gon and P.C. Heemstra (eds.) Fishes of the Southern Ocean. J.L.B. Smith Institute of Ichthyology, Grahamstown, South Africa. (Ref. 5182)
http://www.fishbase.org/references/FBRefSummary.php?id=5182&speccode=6981
© FishBase
Source:
FishBase
Trusted
Physical Description
Morphology
Dorsal spines (total): 0; Dorsal soft rays (total): 14 - 17; Analspines: 0; Analsoft rays: 16 - 20
-
Hulley, P.A. 1986 Myctophidae. p. 282-321. In M.M. Smith and P.C. Heemstra (eds.) Smiths' sea fishes. Springer-Verlag, Berlin. (Ref. 4066)
http://www.fishbase.org/references/FBRefSummary.php?id=4066&speccode=10238
© FishBase
Source:
FishBase
Trusted
Size
Max. size
13.2 cm SL (male/unsexed; (Ref. 5182))
-
Hulley, P.A. 1990 Myctophidae. p. 146-178. In O. Gon and P.C. Heemstra (eds.) Fishes of the Southern Ocean. J.L.B. Smith Institute of Ichthyology, Grahamstown, South Africa. (Ref. 5182)
http://www.fishbase.org/references/FBRefSummary.php?id=5182&speccode=6981
© FishBase
Source:
FishBase
Trusted
Type Information
Type for Myctophum braueri Gilbert
Catalog Number: USNM 51527
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Year Collected: 1902
Locality: Between Honolulu and Kauai Island, Oahu, Hawaii, United States, Hawaiian Islands, Pacific
Vessel: Albatross
Catalog Number: USNM 51527
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Year Collected: 1902
Locality: Between Honolulu and Kauai Island, Oahu, Hawaii, United States, Hawaiian Islands, Pacific
Vessel: Albatross
- Type: Gilbert, C. H. 1905. Bulletin of the United States Fish Commission. 23 (for 1903): 599.
© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Trusted
Paratype for Myctophum braueri Gilbert
Catalog Number: USNM 51537
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1902
Locality: West of Niihau, Hawaii, Niihau, Hawaii, United States, Hawaiian Islands, Pacific
Depth (m): 4625 to 4625
Vessel: Albatross
Catalog Number: USNM 51537
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1902
Locality: West of Niihau, Hawaii, Niihau, Hawaii, United States, Hawaiian Islands, Pacific
Depth (m): 4625 to 4625
Vessel: Albatross
- Paratype: Gilbert, C. H. 1905. Bulletin of the United States Fish Commission. 23 (for 1903): 599.
© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Trusted
Paratype for Myctophum braueri Gilbert
Catalog Number: USNM 51526
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1902
Locality: West of Niihau, Hawaii, Niihau, Hawaii, United States, Hawaiian Islands, Pacific
Vessel: Albatross
Catalog Number: USNM 51526
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1902
Locality: West of Niihau, Hawaii, Niihau, Hawaii, United States, Hawaiian Islands, Pacific
Vessel: Albatross
- Paratype: Gilbert, C. H. 1905. Bulletin of the United States Fish Commission. 23 (for 1903): 599.
© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Trusted
Paratype for Myctophum braueri Gilbert
Catalog Number: USNM 51525
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1902
Locality: S. of Lanai Island, W of Kahoolawe, Hawaii, Lanai, Hawaii, United States, Hawaiian Islands, Pacific
Vessel: Albatross
Catalog Number: USNM 51525
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1902
Locality: S. of Lanai Island, W of Kahoolawe, Hawaii, Lanai, Hawaii, United States, Hawaiian Islands, Pacific
Vessel: Albatross
- Paratype: Gilbert, C. H. 1905. Bulletin of the United States Fish Commission. 23 (for 1903): 599.
© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Trusted
Ecology
Habitat
Environment
bathypelagic; oceanodromous (Ref. 51243); marine; depth range ? - 2700 m (Ref. 58018)
-
Bogutskaya, N.G. 2007 Preliminary assignment of coordinates to type localities in the Catalog of Fishes. Unpublished dbf file. (Ref. 58018)
http://www.fishbase.org/references/FBRefSummary.php?id=58018&speccode=6010
-
Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
http://www.fishbase.org/references/FBRefSummary.php?id=51243&speccode=4683
© FishBase
Source:
FishBase
Trusted
Depth range based on 307 specimens in 1 taxon.
Water temperature and chemistry ranges based on 293 samples.
Environmental ranges
Depth range (m): 0 - 4625
Temperature range (°C): -1.176 - 6.592
Nitrate (umol/L): 19.196 - 39.220
Salinity (PPS): 33.672 - 34.816
Oxygen (ml/l): 3.612 - 8.084
Phosphate (umol/l): 1.450 - 2.635
Silicate (umol/l): 7.177 - 153.933
Graphical representation
Depth range (m): 0 - 4625
Temperature range (°C): -1.176 - 6.592
Nitrate (umol/L): 19.196 - 39.220
Salinity (PPS): 33.672 - 34.816
Oxygen (ml/l): 3.612 - 8.084
Phosphate (umol/l): 1.450 - 2.635
Silicate (umol/l): 7.177 - 153.933
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 293 samples.
Environmental ranges
Depth range (m): 0 - 4625
Temperature range (°C): -1.176 - 6.592
Nitrate (umol/L): 19.196 - 39.220
Salinity (PPS): 33.672 - 34.816
Oxygen (ml/l): 3.612 - 8.084
Phosphate (umol/l): 1.450 - 2.635
Silicate (umol/l): 7.177 - 153.933
Graphical representation
Depth range (m): 0 - 4625
Temperature range (°C): -1.176 - 6.592
Nitrate (umol/L): 19.196 - 39.220
Salinity (PPS): 33.672 - 34.816
Oxygen (ml/l): 3.612 - 8.084
Phosphate (umol/l): 1.450 - 2.635
Silicate (umol/l): 7.177 - 153.933
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Migration
Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
-
Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
http://www.fishbase.org/references/FBRefSummary.php?id=51243&speccode=4683
© FishBase
Source:
FishBase
Trusted
Trophic Strategy
Oceanic and mesopelagic, found in the upper 200 m at night but deeper in the region of Subtropical Convergence (Ref. 4066). Feeds mainly on Euphausia superba; also takes copepods (Euchaeta antarctica, Rhincalanus gigas), amphipods (Primno macropa, Themisto gaudichaudii) and the euphausiid Thysanoessa macrura.
-
Hulley, P.A. 1990 Myctophidae. p. 146-178. In O. Gon and P.C. Heemstra (eds.) Fishes of the Southern Ocean. J.L.B. Smith Institute of Ichthyology, Grahamstown, South Africa. (Ref. 5182)
http://www.fishbase.org/references/FBRefSummary.php?id=5182&speccode=6981
© FishBase
Source:
FishBase
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Gymnoscopelus braueri
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There are 16 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 16 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
CCTTTATTTAGTATTCGGTGCCTGAGCAGGCATAGTAGGAACTGCTCTTAGCCTTCTCATTCGAGCTGAGGTTAGCCAACCTGGAGCCCTCCTTGGGGACGACCAGATTTATAACGTAATCGTAACAGCTCACGCCTTCGTAATAATCTTCTTTATGGTAATGCCTATTATAATCGGTGGATTTGGAAACTGACTAATTCCCCTTATGATCGGGGCCCCCGATATAGCATTCCCACGAATGAATAACATGAGCTTCTGACTCCTCCCTCCCTCTTTCCTTCTCCTCCTAGCCTCCTCCGGCGTAGAAGCTGGGGCTGGTACTGGTTGAACCGTTTATCCCCCACTTGCTGGCAACCTGGCCCACGCCGGGGCTTCCGTGGACCTAACAATTTTCTCGCTTCACCTGGCAGGTGTGTCTTCAATTCTGGGAGCAATCAACTTCATTACGACCATTATTAATATGAAGCCCCCTGCGATTACTCAGTACCAAACTCCACTATTTGTTTGGGCAGTATTAATTACAGCCGTACTCCTTCTCCTTTCCCTTCCCGTCCTGGCTGCCGGCATCACGATGCTCCTGACAGACCGTAATCTAAATACTACCTTCTTCGACCCTGCGGGAGGAGGGGACCCCATCCTTTACCAACACTTA
-- end --
-- end --
Download FASTA File
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage: Gymnoscopelus braueri
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 13
Specimens with Barcodes: 26
Species With Barcodes: 1
Public Records: 13
Specimens with Barcodes: 26
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Conservation
Threats
Not Evaluated
-
IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
http://www.fishbase.org/references/FBRefSummary.php?id=57073
© FishBase
Source:
FishBase
Trusted
Relevance to Humans and Ecosystems
Benefits
Importance
fisheries: minor commercial; price category: high; price reliability: very questionable: based on ex-vessel price for species in this family
-
Hulley, P.A. 1986 Myctophidae. p. 282-321. In M.M. Smith and P.C. Heemstra (eds.) Smiths' sea fishes. Springer-Verlag, Berlin. (Ref. 4066)
http://www.fishbase.org/references/FBRefSummary.php?id=4066&speccode=10238
© FishBase
Source:
FishBase
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!
