Articles on this page are available in 2 other languages: Spanish (1), Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Description

  Common names: snake-mackerel (English), escolar (Espanol)
 
Gempylus serpens Cuvier, 1829


Common snake-mackerel


Very elongate and slender; snout pointed; eye large; lower jaw pointed, projecting; teeth large, conical, spaced apart, top jaw with fangs at front; 1st  dorsal long and low (XXVI-XXXII); 2nd  dorsal I, 11-14, then 5-7 finlets; anal fin 2 free spines then I, 3-4, then 6-7 finlets; pelvics tiny; tail forked; pelvics tiny; 2 obvious lateral lines, on body, 1 along entire mid-side, other along under 1st  dorsal fin; skin smooth, scales small; no keel on belly.

Dark brown to blackish, with silvery reflections, fins grey-brown with darker margins.

Size: 125 cm.

Habitat: oceanic, surface to midwater.


Depth: 0-1000 m.

Circumtropical; throughout our region (except for most of the Gulf of California), south to Chile.
 
    
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Strictly oceanic and usually solitary (Ref. 6181). Adults migrate to the surface at night while larvae and juveniles are found near the surface during the day (Ref. 6181). Feed on fishes, cephalopods and crustaceans (Ref. 9302). Males mature at 43 cm SL, females at 50 cm (Ref. 36731). Eggs and larvae are pelagic (Ref. 6766). Sold frozen, as sausages or fish cake (Ref. 9302). Not eaten raw, but cooked in any way, also dried (Ref. 7364).
  • Nakamura, I. and N.V. Parin 1993 FAO Species Catalogue. Vol. 15. Snake mackerels and cutlassfishes of the world (families Gempylidae and Trichiuridae). An annotated and illustrated catalogue of the snake mackerels, snoeks, escolars, gemfishes, sackfishes, domine, oilfish, cutlassfishes,. scabbardfishes, hairtails, and frostfishes known to date. FAO Fish. Synop. 125(15):136 p. (Ref. 6181)   http://www.fishbase.org/references/FBRefSummary.php?id=6181&speccode=489 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Worldwide in tropical and subtropical seas; adults also often caught in temperate waters, as far north as 41°N
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific 
 
Global Endemism: All species, TEP non-endemic, Circumtropical ( Indian + Pacific + Atlantic Oceans), "Transpacific" (East + Central &/or West Pacific), All Pacific (West + Central + East), East Pacific + Atlantic (East +/or West), Transisthmian (East Pacific + Atlantic of Central America), East Pacific + all Atlantic (East+West)

Regional Endemism: All species, Eastern Pacific non-endemic, Tropical Eastern Pacific (TEP) non-endemic, Continent + Island (s), Continent, Island (s)

Residency: Resident

Climate Zone: North Temperate (Californian Province &/or Northern Gulf of California), Northern Subtropical (Cortez Province + Sinaloan Gap), Northern Tropical (Mexican Province to Nicaragua + Revillagigedos), Equatorial (Costa Rica to Ecuador + Galapagos, Clipperton, Cocos, Malpelo), South Temperate (Peruvian Province )
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Worldwide in tropical and subtropical seas. Adults also often caught in temperate waters. Specimen caught on the Atlantic side of South Africa (33°08'S 16°47'E at 700 m) (Ref. 6193) probably strayed from the Indian Ocean.
  • Nakamura, I. and N.V. Parin 1993 FAO Species Catalogue. Vol. 15. Snake mackerels and cutlassfishes of the world (families Gempylidae and Trichiuridae). An annotated and illustrated catalogue of the snake mackerels, snoeks, escolars, gemfishes, sackfishes, domine, oilfish, cutlassfishes,. scabbardfishes, hairtails, and frostfishes known to date. FAO Fish. Synop. 125(15):136 p. (Ref. 6181)   http://www.fishbase.org/references/FBRefSummary.php?id=6181&speccode=489 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Circumglobal in tropical through warm temperate seas, including Mascarenes, Hawaiian Islands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth

Depth Range (m): 0 (S) - 1000 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 27 - 33; Dorsal soft rays (total): 10 - 14; Analspines: 3; Analsoft rays: 10 - 12; Vertebrae: 48 - 55
  • Nakamura, I. and N.V. Parin 1993 FAO Species Catalogue. Vol. 15. Snake mackerels and cutlassfishes of the world (families Gempylidae and Trichiuridae). An annotated and illustrated catalogue of the snake mackerels, snoeks, escolars, gemfishes, sackfishes, domine, oilfish, cutlassfishes,. scabbardfishes, hairtails, and frostfishes known to date. FAO Fish. Synop. 125(15):136 p. (Ref. 6181)   http://www.fishbase.org/references/FBRefSummary.php?id=6181&speccode=489 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length max (cm): 125.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 1000 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

100.0 cm SL (male/unsexed; (Ref. 6181))
  • Nakamura, I. and N.V. Parin 1993 FAO Species Catalogue. Vol. 15. Snake mackerels and cutlassfishes of the world (families Gempylidae and Trichiuridae). An annotated and illustrated catalogue of the snake mackerels, snoeks, escolars, gemfishes, sackfishes, domine, oilfish, cutlassfishes,. scabbardfishes, hairtails, and frostfishes known to date. FAO Fish. Synop. 125(15):136 p. (Ref. 6181)   http://www.fishbase.org/references/FBRefSummary.php?id=6181&speccode=489 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Strictly oceanic, epipelagic and mesopelagic and occurring solitarily. Adults migrate to the surface at night while larvae and juveniles stay near the surface only during the day. Feeds on fishes (myctophids, exocoetids, sauries, scombrids), crustaceans and cephalopods. Males mature at 43 cm SL, females at 50 cm. Spawns in tropical waters year round. Fecundity of about 300 thousand to 1 million eggs. No special fishery, but appears sometimes as by-catch in the tuna longline fishery (Ref. 9784). Not eaten raw, but cooked in any way, also dried (Ref. 7364). May also be sold as sausages and fish cake (Ref. 9302).
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Body is elongated and strongly compressed. The mouth is large with fang-like teeth. There are two lateral lines, both originating below the first spine of the dorsal fin. The upper lateral line follows the dorsal contour of the body to the end of the first dorsal fin base. The lower descends gradually posterior to about the tip of the pectoral fin and runs mid-laterally. Body color is uniformly dark brown; all fins dark brown with somewhat darker margins.
  • Nakamura, I. and N.V. Parin 1993 FAO Species Catalogue. Vol. 15. Snake mackerels and cutlassfishes of the world (families Gempylidae and Trichiuridae). An annotated and illustrated catalogue of the snake mackerels, snoeks, escolars, gemfishes, sackfishes, domine, oilfish, cutlassfishes,. scabbardfishes, hairtails, and frostfishes known to date. FAO Fish. Synop. 125(15):136 p. (Ref. 6181)   http://www.fishbase.org/references/FBRefSummary.php?id=6181&speccode=489 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Known from seamounts and knolls
  • Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Strictly oceanic and usually solitary. Adults migrate to the surface at night while larvae and juveniles are found near the surface during the day.
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

nektonic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

pelagic-oceanic; oceanodromous (Ref. 51243); marine; depth range 0 - 600 m (Ref. 13628), usually 0 - 200 m (Ref. 89423)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 39 specimens in 1 taxon.
Water temperature and chemistry ranges based on 24 samples.

Environmental ranges
  Depth range (m): 0 - 1270
  Temperature range (°C): 4.637 - 26.261
  Nitrate (umol/L): 0.103 - 41.378
  Salinity (PPS): 33.960 - 36.527
  Oxygen (ml/l): 0.416 - 5.236
  Phosphate (umol/l): 0.036 - 3.060
  Silicate (umol/l): 0.981 - 90.936

Graphical representation

Depth range (m): 0 - 1270

Temperature range (°C): 4.637 - 26.261

Nitrate (umol/L): 0.103 - 41.378

Salinity (PPS): 33.960 - 36.527

Oxygen (ml/l): 0.416 - 5.236

Phosphate (umol/l): 0.036 - 3.060

Silicate (umol/l): 0.981 - 90.936
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 600m.
Recorded at 600 meters.

Habitat: bathypelagic. Strictly oceanic, epipelagic and mesopelagic and occurring solitarily. Adults migrate to the surface at night while larvae and juveniles stay near the surface only during the day. Feeds on fishes (myctophids, exocoetids, sauries, scombrids), crustaceans and cephalopods. Males mature at 43 cm SL, females at 50 cm. Spawns in tropical waters year round. Fecundity of about 300 thousand to 1 million eggs. No special fishery, but appears sometimes as by-catch in the tuna longline fishery (Ref. 9784). Not eaten raw, but cooked in any way, also dried (Ref. 7364). May also be sold as sausages and fish cake (Ref. 9302).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Salinity: Marine, Marine Only

Inshore/Offshore: Offshore Only, Offshore

Water Column Position: Surface, Near Surface, Mid Water, Water column only

Habitat: Water column

FishBase Habitat: Bathypelagic
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Feeds on fish, cephalopods and crustaceans (Ref. 9302).
  • Nakamura, I. and N.V. Parin 1993 FAO Species Catalogue. Vol. 15. Snake mackerels and cutlassfishes of the world (families Gempylidae and Trichiuridae). An annotated and illustrated catalogue of the snake mackerels, snoeks, escolars, gemfishes, sackfishes, domine, oilfish, cutlassfishes,. scabbardfishes, hairtails, and frostfishes known to date. FAO Fish. Synop. 125(15):136 p. (Ref. 6181)   http://www.fishbase.org/references/FBRefSummary.php?id=6181&speccode=489 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Feeding

Feeding Group: Carnivore

Diet: octopus/squid/cuttlefish, Pelagic crustacea, bony fishes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Known prey organisms

Gempylus serpens (snake mackerel) preys on:
Exocoetidae
Diaphus splendidus

Based on studies in:
unknown (epipelagic zone, Tropical)

This list may not be complete but is based on published studies.
  • N. V. Parin, Ichthyofauna of the Epipelagic Zone (Israel Program for Scientific Translations, Jerusalem, 1970; U.S. Department of Commerce Clearinghouse for Federal Scientific and Technical Information, Springfield, VA 22151), from p. 154.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Gempylus serpens (snake mackerel) is prey of:
Thunninae
Alepisaurus

Based on studies in:
unknown (epipelagic zone, Tropical)

This list may not be complete but is based on published studies.
  • N. V. Parin, Ichthyofauna of the Epipelagic Zone (Israel Program for Scientific Translations, Jerusalem, 1970; U.S. Department of Commerce Clearinghouse for Federal Scientific and Technical Information, Springfield, VA 22151), from p. 154.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Diet

Feeds on fishes, cephalopods and crustaceans
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Egg Type: Pelagic, Pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Gempylus serpens

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 19
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Gempylus serpens

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTCTTTATAGTCATGCCAATTATGATTGGGGGCTTCGGGAATTGACTCATCCCCCTTATG---ATTGGGGCCCCGGACATAGCATTCCCACGAATGAATAACATGAGCTTTTGACTCCTGCCCCCGTCGTTCCTCCTTCTCCTGGCTTCTTCAGGAGTTGAAGCTGGGGCGGGTACTGGATGAACAGTTTACCCCCCTCTGGCAGGCAACCTGGCCCACGCTGGAGCATCAGTTGACCTA---ACTATTTTCTCCCTCCACCTGGCCGGGATTTCTTCAATCCTGGGGGCTATTAACTTCATTACAACAATCATCAATATGAAACCCGCAGCCATTTCACAGTACCAAACGCCTCTATTTGTTTGGTCTGTTTTAATTACTGCTGTCCTTCTACTGTTATCCCTACCAGTCCTAGCTGCC---GGTATTACTATGCTCCTGACGGACCGTAATCTTAACACAACCTTTTTCGACCCCGCAGGCGGTGGAGACCCAATCCTTTACCAGCACCTGTTTTGATTCTTTGGCCACCCCGAAGTCTACATTCTCATCCTGCCTGGGTTCGGGATAATCTCGCATATCGTAGCCTACTACTCTGGTAAAAAA---GAGCCTTTCGGCTACATAGGAATGGTCTGAGCTATGATGGCCATTGGACTCCTTGGGTTCATCGTCTGAGCCCACCACATGTTTACAGTAGGAATGGACGTGGACACACGAGCCTACTTTACGTCCGCAACAATAATTATCGCGATTCCAACCGGTGTAAAAGTCTTTAGCTGACTC---GCAACCCTGCACGGGGGC---TCAGTAAAATGAGAAACCCCGCTCCTATGAGCTGTAGGATTTATTTTCCTCTTCACAGTTGGGGGCCTAACAGGAATTGTTCTGGCAAATTCATCCCTAGACATTGTTCTCCATGACAC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; bait: occasionally; price category: unknown; price reliability:
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Snake mackerel

The snake mackerel, Gempylus serpens, is a species of fish in the monotypic genus Gempylus, belonging to the family Gempylidae (which is also referred to generally as "snake mackerels"). It is found worldwide in tropical and subtropical oceans between the latitudes of 42° N and 40° S; adults are known to stray into temperate waters. It is found to a depth of 600 meters (2,000 feet).[1] Populations of the snake mackerel from the Atlantic and the Indo-Pacific differ in vertebral count (51-55 versus 48-50) and number of first dorsal fin spines (30-32 versus 26-30), and so may represent separate species.[2]

Description[edit]

The snake mackerel has a very long, slender, laterally compressed body. It has a long, pointed head, measuring 17-18% of the standard length, and a large mouth with the lower jaw protruding beyond the upper. Both jaws are densely packed with sharp teeth; the first few teeth in the upper jaw are enlarged into fangs. The pectoral fins contain 12-15 rays; the pelvic fins are tiny and located beneath the pectorals, containing 1 small spine and 3-4 rays. There are two dorsal fins; the first is long and spiny, and is followed immediately by the second, which contains 1 tiny spine and 11-14 soft rays. The anal fin originates opposite the second dorsal fin and consists of 2 free spines followed by 1 spine and 10-12 rays. The dorsal and anal fins are followed by 6-7 finlets. There are two lateral lines, with the upper running to the rear of the first dorsal fin and the lower running to the caudal peduncle. The scales are mostly absent. The coloration is metallic brown, with dark fins. This species grows to 1 meter (3.3 feet) in length.[3][4]

Behaviour[edit]

The head of a snake mackerel. Note the enlarged front teeth in the upper jaw.

Adult snake mackerels conduct a diel vertical migration, staying in deeper water during the day and rising to the surface at night to feed. The young and juveniles also migrate vertically but in the opposite direction, staying near the surface during the day and moving deeper at night.[5] This species feeds on squid, pelagic crustaceans, and bony fishes such as lanternfishes, flying fishes, sauries, and mackerel.[4] It is in turn preyed upon by tuna and marlin.[3] Reproduction is oviparous, with females producing 300,000 to 1,000,000 eggs.[4] Spawning occurs year-round; spawning areas are known to exist in the Caribbean Sea and off the coast of Florida.[5] Males reach sexual maturity at 43 cm (17 in) long and females at 50 cm (20 in) long.[4] As the fish mature and move into deeper water where there is less available light, they lose the cone cells in their eyes in favor of rod cells.[6]

Human Interaction[edit]

The snake mackerel is caught as bycatch in the tuna longline fishery and is of minor commercial importance. It is marketed frozen or in sausages and fish cakes.[1][2] In Hawaii, this fish is known as hāuliuli and is considered good eating cooked or dried. King Kamehameha was apparently not fond of it, as he once remarked that it is a "delicious fish for the back country people", meaning fine for those who could not obtain anything better.[7]

References[edit]

  1. ^ a b Froese, Rainer and Pauly, Daniel, eds. (2009). "Gempylus serpens" in FishBase. March 2009 version.
  2. ^ a b Nakamura, I. and Parin, N.V. (1993). FAO Species Catalogue Vol. 15: Snake Mackerels and Cutlassfishes of the World. Rome: Food and Agricultural Organization of the United Nations. ISBN 92-5-103124-X. 
  3. ^ a b Peterson, R.T., Eschmeyer, W.N., and Herald, E.S. (1999). A Field Guide to Pacific Coast Fishes: North America. Houghton Mifflin Harcourt. ISBN 0-618-00212-X. 
  4. ^ a b c d McEachran, J.D. and Fechhelm, J.D. (2005). Fishes of the Gulf of Mexico: Scorpaeniformes to Tetraodontiformes. University of Texas Press. ISBN 0-292-70634-0. 
  5. ^ a b Burton, R. (2002). International Wildlife Encyclopedia. Marshall Cavendish. ISBN 0-7614-7266-5. 
  6. ^ Collin, S.P. and Marshall, N.J. (2003). Sensory Processing in Aquatic Environments. Springer. ISBN 0-387-95527-5. 
  7. ^ Titcomb, M. and Pukui, M.K. (1972). Native Use of Fish in Hawaii (2nd ed.). University of Hawaii Press. ISBN 0-8248-0592-5. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Chicolar


Chicolar is a fish of the snake mackerel family found in the Mediterranean, the Atlantic and Caribbean.


Source[edit source | edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!