Overview

Comprehensive Description

Biology

Occurs in swamps, sloughs, pools, and backwaters of sluggish creeks and small to medium rivers. Usually found near vegetation (Ref. 5723). Not a seasonal killifish. Is very difficult to maintain in aquarium (Ref. 27139).
  • Page, L.M. and B.M. Burr 1991 A field guide to freshwater fishes of North America north of Mexico. Houghton Mifflin Company, Boston. 432 p. (Ref. 5723)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

endemic to a single nation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (20,000-200,000 square km (about 8000-80,000 square miles)) This species occurs throughout the Florida panhandle and closely adjacent areas of southern Alabama, west to the lower Mobile Bay drainage, Alabama, and east to the Ochlockonee River, Florida; also the Suwannee and Waccasassa river drainages, Florida (Gilbert et al. 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

This species occurs throughout the Florida panhandle and closely adjacent areas of southern Alabama, west to the lower Mobile Bay drainage, Alabama, and east to the Ochlockonee River, Florida; also the Suwannee and Waccasassa river drainages, Florida (Gilbert et al. 1992).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America: USA from Satilla River drainage in eastern Georgia to lower Mobile Bay drainage in Alabama, south in Florida to Tamiami Canal.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Southeastern U.S.A.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Length: 7 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum size: 78 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

7.8 cm TL (male/unsexed; (Ref. 5723))
  • Page, L.M. and B.M. Burr 1991 A field guide to freshwater fishes of North America north of Mexico. Houghton Mifflin Company, Boston. 432 p. (Ref. 5723)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Differ from FUNDULUS RUBRIFRONS in having six pores in the preopercular series and both pores 5 and 6 present in the supraorbital series (vs. five pores in the preopercular series and only pore 6 present in the supraorbital series) and in lacking red pigment on the jaws and sides of the head in males (Gilbert et al. 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Zygonectes craticula
Catalog Number: USNM 31439
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): J. Henshall
Locality: Branch Elbow Creek, Trib. Indian R., Florida., Florida, United States, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Syntype; Paralectotype for Zygonectes auroguttatus Hay
Catalog Number: USNM 315090
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Locality: Westville, Florida., Florida, United States, North America
  • Syntype: Hay, O. P. 1885. Proceedings of the United States National Museum. 8 (537): 552.; Paralectotype: Gilbert, C. R., et al. 1992. Copeia. 1992 (3): 755.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Syntype; Lectotype; Neotype for Zygonectes auroguttatus Hay
Catalog Number: USNM 37362
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Radiograph
Collector(s): O. Hay
Locality: Westville, Florida, Florida, United States, North America
  • Syntype: Hay, O. P. 1885. Proceedings of the United States National Museum. 8 (537): 552.; Lectotype: Gilbert, C. R., et al. 1992. Copeia. 1992 (3): 755.; Neotype: Lazara, K. 2002. Copeia. (1): 227.; Cuvier, G. & Valenciennes, A. 1846. Histoire naturelle des poissons. Tome dix-huitième. Suite du livre dix-huitième. Cyprinoïdes. Livre dix-neuvième. Des Ésoces ou Lucioïdes. 18: 197.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Freshwater

Comments: Typically this species is found in backwater areas of sluggish lowland creeks and small to medium rivers, swamps, and marshes, often in association with extensive aquatic vegetation (Lee et al. 1980, Page and Burr 2011). The frequently ephemeral nature of the habitat suggests that eggs may often survive and develop in dewatered substrate, as is true of various other cyprinodontid species.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Typically this species is found in backwater areas of sluggish lowland creeks and small to medium rivers, swamps, and marshes, often in association with extensive aquatic vegetation (Lee et al. 1980, Page and Burr 2011). The frequently ephemeral nature of the habitat suggests that eggs may often survive and develop in dewatered substrate, as is true of various other cyprinodontid species.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

benthopelagic; non-migratory; freshwater
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.

Environmental ranges
  Depth range (m): 0.23 - 0.23
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Bottom feeder.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 21 - 80

Comments: This species is represented by a fairly large number of occurrences (subpopulations).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

10,000 - 1,000,000 individuals

Comments: Total adult population size is unknown but presumably exceeds 10,000. This species is regarded as fairly common (Page and Burr 2011).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Fundulus cingulatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATTTAGTATTTGGTGCCTGAGCCGGGATAGTGGGGACAGCTCTTAGTCTCCTTATTCGAGCTGAATTGAGCCAACCAGGCTCCCTTCTAGGAGATGACCAAATTTACAACGTAATTGTAACAGCTCATGCCTTTGTAATAATCTTTTTTATAGTCATACCTATCATAATTGGGGGATTCGGTAATTGATTAGTCCCGCTTATGATCGGGGCCCCAGATATAGCTTTTCCTCGAATAAATAATATGAGCTTCTGACTACTCCCCCCTTCATTCCTACTTCTTCTAGCTTCTTCTGGGGTTGAAGCAGGGGCCGGAACAGGTTGAACTGTATACCCACCCTTAGCAGGAAACTTGGCCCACGCAGGGGCTTCAGTCGACTTAACTATTTTTTCTCTACACTTAGCTGGTGTTTCTTCAATTTTAGGCGCTATTAATTTCATTACTACTATCATTAACATGAAACCTCCAGCCATTTCTCAATACCAAACTCCTTTATTCGTGTGGGCCGTCTTAATCACTGCCGTTCTTCTCCTACTTTCTCTCCCAGTTCTTGCTGCAGGAATTACTATACTGCTCACTGACCGAAATCTAAACACCACATTCTTTGACCCAGCTGGAGGGGGGGATCCTATTCTTTACCAACATCTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Fundulus cingulatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Reasons: Small range (Alabama, Georgia, Florida) but evidently secure.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
NatureServe

Reviewer/s
Smith, K. & Darwall, W.R.T.

Contributor/s

Justification
Somewhat small extent of occurrence, but listed as Least Concern because the number of subpopulations and population size are relatively large, and because the species probably is not declining fast enough to qualify for any of the threatened categories.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: Trend over the past three generations is uncertain but probably relatively stable or slowly declining.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is represented by a fairly large number of occurrences (subpopulations).

Total adult population size is unknown but presumably exceeds 10,000. This species is regarded as fairly common (Page and Burr 2011).

Trend over the past three generations is uncertain but probably relatively stable or slowly declining.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Least Concern (LC)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: No major threats are known.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Major Threats
No major threats are known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Currently, this species is of relatively low conservation concern and does not require significant additional protection or major management, monitoring, or research action.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Gilbert et al. (1992) discussed the complex taxonomic and nomenclatural problems involving the banded topminnow and recognized the two previously recognized junior synonyms of F. cingulatus as representing valid species, the western F. auroguttatus (Hay) in the panhandle of Florida and adjacent areas of southern Alabama and southwestern Georgia and the eastern F. rubrifrons (Jordan) in eastern Florida and southeastern Georgia. The common name 'redface topminnow' is applied to the latter" (Cashner et al. 1992). Arguing that the present holotype of F. cingulatus in the MNHN (Paris) does not agree with the original description and probably represents a substituted specimen, Lazara (2002) designated the lectotype of F. auroguttatus as the neotype of F. cingulatus, resulting in F. auroguttatus becoming a junior synonym of F. cingulatus (Nelson et al. 2004).

Often has been confused with F. chrysotus. Allozyme data indicate that "F. cingulatus" and F. luciae are sister species and that F. chrysotus is the sister to this clade (Cashner et al. 1992).

The genus Fundulus was removed from Atheriniformes:Cyprinodontidae and placed in Cyprinodontiformes:Fundulidae by Parenti (1981); pending confirmation based on other character suites, this change was not accepted in the 1991 AFS checklist (Robins et al. 1991). See Wiley (1986) for a study of the evolutionary relationships of Fundulus topminnows based on morphological characters. See Cashner et al. (1992) for an allozyme-based phylogenetic analysis of the genus Fundulus.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!