Overview

Comprehensive Description

Biology

Occur in sandy and muddy, sometimes rocky, pools of headwaters, creeks, and small to medium rivers; and in sandy shores of lakes (Ref. 5723, 10294); also found in streams (Ref. 10294). Adults feed on midge larvae, mayfly nymphs, caddis larvae, and microcrustaceans; young on entomostracans and tiny midge larvae (Ref. 10294). Eggs are found clustered on underside of stone and guarded by males (Ref. 7043).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

Johnny darters are found throughout eastern North America, from Wyoming, Colorado, the Dakotas, and Saskatchewan east to the Atlantic seaboard as far south as North Carolina. They are also found south into Alabama and Mississippi.

Biogeographic Regions: nearctic (Introduced , Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North America: St. Lawrence-Great Lakes, Hudson Bay, and Mississippi River basins from Hudson Bay to southern Mississippi in the USA, and from Quebec in Canada and from Virginia in the USA to Saskatchewan in Canada and Colorado in the USA; and on Atlantic and Gulf Slope drainages in the USA.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Johnny darters are found throughout eastern North America, from Wyoming, Colorado, the Dakotas, and Saskatchewan east to the Atlantic seaboard as far south as North Carolina. They are also found south into Alabama and Mississippi. Populations in the Rocky Mountains of Wyoming and Colorado and the Ozark Mountains of Arkansas and Oklahoma are disjunct from other populations. They have been introduced to parts of Utah.

Biogeographic Regions: nearctic (Introduced , Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: St. Lawrence-Great Lakes, Hudson Bay, and Mississippi River basins, from Hudson Bay to southern Mississippi and from Quebec and Virginia to Saskatchewan and Colorado; Atlantic Slope in James, Roanoke, Tar, and Neuse river drainages, Virginia and North Carolina; Gulf Slope in Mobile Bay drainage, Alabama and Mississippi; recently introduced in Colorado River drainage, Colorado; common to abundant (Page and Burr 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eastern Canada and eastern U.S.A.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Johnny darters are small, slender fish with brown to yellow scales, paler sides, and whitish bellies. They average 51 mm in length. The backs and sides are marked with darker "saddle marks" and the sides have distinctive "W" shaped brown spots along the lateral line. There is a dark stripe that extends from the mouth to the eye, the dorsal fins are marked with brown spots, the tail fin has brown stripes, and the pectoral and anal fins are clear. Males become black on the head, upper body, and dorsal fins during the breeding season and they develop whitish knobby tips on their lower fins.

Range length: 77 (high) mm.

Average length: 51 mm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: sexes colored or patterned differently

  • Becker, G. 1983. Fishes of Wisconsin. Madison, Wisconsin: The University of Wisconsin Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Johnny darters are small, slender fish with brown to yellow ctenoid scales, paler sides, and whitish bellies. The backs and sides are marked with darker "saddle marks" and the sides have distinctive "W" shaped brown spots along the lateral line. There is a dark stripe that extends from the mouth to the eye, the dorsal fins are marked with brown spots, the tail fin has brown stripes, and the pectoral and anal fins are clear. The first dorsal fin has 7 to 9 spines and the second dorsal find has 11 to 14 rays. Males become dusky to black on the head, upper body, and dorsal fins during the breeding season. The ventral portion of the pectoral fins and pelvic rays develop whitish, knobby tips. The average length is 51 mm and the largest recorded individual was 77 mm.

Range length: 77 (high) mm.

Average length: 51 mm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: sexes colored or patterned differently

  • Becker, G. 1983. Fishes of Wisconsin. Madison, Wisconsin: The University of Wisconsin Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 72 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

7.2 cm TL (male/unsexed; (Ref. 5723)); max. reported age: 4 years (Ref. 12193)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Length: 6 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Johnny darters are found in shallow water (usually less than 0.5 m) in small to medium sized rivers, creeks, streams, and headwaters. They are found in areas with sandy, muddy, or rocky substrates, but are more common over sandy or gravel substrates in slow-moving water. They are also found along the sandy shores of lakes or large rivers.

Range depth: 64 (high) m.

Average depth: 0.5 m.

Habitat Regions: temperate ; freshwater

Aquatic Biomes: benthic ; lakes and ponds; rivers and streams

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

benthopelagic; freshwater; pH range: 7.0; dH range: 15
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Johnny darters are found in shallow water in small to medium sized rivers, creeks, streams, and headwaters. They are found in areas with sandy, muddy, or rocky substrates, but are more common over sandy or gravel substrates in slow-moving water. They are also found along the sandy shores of lakes or large rivers. Johnny darters are generally found in benthic parts of aquatic habitats, at depths of less than 0.5 m, although they have been captured in water as deep as 64 m. Johnny darters are considered pioneer species because they can quickly move in and become established in disturbed habitats.

Range depth: 64 (high) m.

Average depth: 0.5 m.

Habitat Regions: temperate ; freshwater

Aquatic Biomes: benthic ; lakes and ponds; rivers and streams

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Freshwater

Comments: Most often found over sand or silt in quiet or sluggish areas of headwaters, creeks, and small to medium rivers (Leidy 1992, Page and Burr 1991), less often over gravel or in weedy areas of lakes or sandy lake shallows (Page 1983). Small to medium streams in pools over sand or bedrock (Kuehne and Barbour 1983). In Colorado, occurs most often in shallow, slow-velocity water over cobble-sand substrate (Propst and Carlson 1989). Eggs are laid on the underside of a stone or other object.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Considerable upstream and downstream movements may precede spawning (Kuehne and Barbour 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Johnny darters feed on small insect larvae and crustaceans as both adults and young. Young feed on much smaller prey, such as tiny Chironomidae larvae and Ostracoda. Adults eat Chironomidae larvae, Ephemeroptera nymphs, Trichoptera larvae, Simulium larvae, and small Crustacea.

Animal Foods: insects; aquatic crustaceans

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Occurs in sandy and muddy, sometimes rocky, pools of headwaters, creeks, and small to medium rivers; and in sandy shores of lakes (Ref. 5723).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Johnny darters feed on small insect larvae and crustaceans as both adults and young. Young feed on much smaller prey, such as tiny midge larvae and ostracods. Adults eat midge larvae, mayfly nymphs, caddisfly larvae, blackfly larvae, and small crustaceans, such as Hyalella, Cyclops, and Daphnia.

Animal Foods: insects; aquatic crustaceans

Primary Diet: carnivore (Insectivore , Eats non-insect arthropods)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Young eat mainly midge larvae and microcrustaceans. Larger individuals eat mainly midge larvae and mayfly larvae (Page 1983, Propst and Carlson 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Johnny darters are important members of native aquatic ecosystems, they are important predators of small invertebrates and are prey for larger predatory fish, including game fish, and wading and diving birds.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Johnny darters are eaten by larger, predatory fish, including Salvelinus namaycush, Coregonus clupeaformis, Lota lota, Micropterus dolomieu, Perca flavescens, and others. Because of their shallow water habits, they are also likely prey of wading and diving birds, such as Ardeidae, and Nerodia. Johnny darters are cryptically colored.

Known Predators:

  • lake trout (Salvelinus_namaycush)
  • lake whitefish (Coregonus_clupeaformis)
  • burbot (Lota_lota)
  • smallmouth bass (Micropterus_dolomieu)
  • yellow perch (Perca_flavescens)
  • herons (Ardeidae)
  • water snakes (Nerodia)

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecosystem Roles

Johnny darters are important members of native aquatic ecosystems, they are important predators of small invertebrates and are prey for larger predatory fish, including game fish, and wading and diving birds.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Johnny darters are eaten by larger, predatory fish, including lake trout, lake whitefish, burbot, smallmouth bass, yellow perch, and others. Because of their shallow water habits, they are also likely prey of wading and diving birds, such as herons, and water snakes. Johnny darters are cryptically colored.

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Johnny darters use their large eyes and keen vision to find prey. They don't seem to have a good sense of small. They use touch and vision in communication during mating.

Communication Channels: visual ; tactile

Perception Channels: visual ; vibrations

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Communication and Perception

Johnny darters use their large eyes and keen vision to find prey. They don't respond strongly to olfactory cues. Tactile and visual signals are used in mating communication. They have a complete lateral line.

Communication Channels: visual ; tactile

Perception Channels: visual ; vibrations

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Development

Johnny darters spawn in waters from 11.7 to 21.1 degrees Celsius, taking from 10 to 16 days to hatch. Larvae are 5 mm long at hatching and generally grow to 29 to 54 mm by September.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eggs are found clustered on underside of stone (Ref. 7043). Males guard the eggs (Ref. 7043).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Development

Johnny darters spawn in waters from 11.7 to 21.1 degrees Celsius. Temperature influences length of development to hatching, with eggs laid in April (12.8 degrees Celsius) hatching at 16 days and eggs laid in May (20 degrees Celsius) hatching at 10 days. Larvae are 5 mm long at hatching and generally grow to 29 to 54 mm by September.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Johnny darters live for up to 3 years.

Typical lifespan

Status: wild:
3 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan/Longevity

Johnny darters live for up to 3 years.

Typical lifespan

Status: wild:
3 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Johnny darter males migrate to spawning areas before females and establish small nesting territories in protected, shallow waters. Males choose a stationary object, such as a log, rock, or even trash, that they will use as a nest. Males compete for nesting territories and aggressively defend their nests, even against fish up to 3 times their size. Johnny darters clean the underside of their chosen spawning object with their fins. They also enlarge the nest with movements of their body. When a female approaches, a male will begin to swim upside down under the spawning object, which attracts the female. The female swims upside down under the spawning object, alongside the male, who then prods her sides. This stimulates the female to deposit eggs, one at a time on the object, creating a small, single layer patch of eggs. Females deposit eggs in the nests of different males, and most males have several females deposit eggs in their nest.

Mating System: polygynandrous (promiscuous)

Females can have from 86 to 691 eggs, which they lay in small batches in the nests of different males. Male nests have been recorded with between 30 and 1150 eggs in them. Johnny darters can breed in their first year after hatching.

Breeding interval: Johnny darters breed once yearly.

Breeding season: Spawning occurs in the spring, usually in April or May.

Range number of offspring: 48 to 691.

Range time to hatching: 10 to 16 days.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); oviparous

Johnny darter eggs are attached to the underside of rocks and guarded by males until they hatch. Males rub the eggs with their fins to clean them from 13 to 16 times an hour. They also fan the eggs with their pectoral fins. When an eggs becomes covered with fungus, the male will eat it. Males aggressively defend their eggs against fish that might want to eat them.

Parental Investment: pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Protecting: Male)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Johnny darter males migrate to spawning areas before females and establish small nesting territories in protected, shallow waters. Males select a stationary object of at least 25 cm in diameter, such as a log, rock, or even trash under which spawning occurs. Males compete for nesting territories, with a side-by-side display that helps them to establish dominance. Once one is established as dominant, it drives the other male away. Male Johnny darters aggressively defend their nests, even against fish up to 3 times their size. They attack by butting the threat with their head and biting at the fins of an intruding fish. Johnny darters clean the underside of the chosen spawning object with their anal, pectoral, and tail fins. They also enlarge the nest with movements of their body. Males rarely leave their territory during the day, but territories are not defended at night. Males first swim aggressively towards females that approach their nest, but then begin to swim upside down under their spawning object, which attracts the female. The female swims upside down under the spawning object, alongside the male, who then prods her sides. This stimulates the female to move along the object and deposit eggs. Females place one egg at a time on the object, eventually creating a small, single layer patch of eggs up to 13 cm in diameter. Females mate with 4 to 6 males and males typically mate with more than 1 female.

Mating System: polygynandrous (promiscuous)

Females lay from 30 to 200 eggs at each spawning event, which they will do several times in the nests of different males. Male nests have been recorded with between 30 and 1150 eggs in them. Smaller females have been recorded with from 48 to 299 eggs and larger females with from 86 to 691 eggs. Johnny darters can breed in their first year after hatching.

Breeding interval: Johnny darters breed once yearly.

Breeding season: Spawning occurs in the spring, usually in April or May.

Range number of offspring: 48 to 691.

Range time to hatching: 10 to 16 days.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); oviparous

Johnny darter eggs are attached to the underside of rocks and guarded by males until they hatch. Males rub the eggs with their fins to clean them from 13 to 16 times an hour. They also fan the eggs with their pectoral fins. When an eggs becomes covered with fungus, the male will eat it. Males aggressively defend their eggs against fish that might want to eat them.

Parental Investment: pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Protecting: Male)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Spawns April-June over most of range, but spawning peaks July to early August in Colorado (Propst and Carlson 1989); spawns mid-March to mid-May at southern limit of range in Mississippi (Parrish et al. 1991). Male guards eggs, which in Michigan hatch in 16 days in April, 10 days in May, and 6 days in June. Several females may contribute to egg mass of each male. Sexually mature in 1 year (Page 1983). In Colorado, few survived past age III (Propst and Carlson 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Etheostoma nigrum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 37 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATCTAGTATTTGGTGCTTGAGCCGGAATAGTGGGCACCGCCCTGAGCTTACTTATTCGAGCCGAACTTAGCCAACCCGGCGCACTCCTCGGAGACGACCAGATTTATAACGTAATTGTTACAGCACATGCCTTTGTAATAATTTTCTTTATAGTGATACCAATTATGATTGGAGGGTTTGGAAACTGACTTATTCCACTTATGATTGGGGCCCCCGACATGGCATTTCCTCGAATAAACAACATGAGCTTTTGACTTCTTCCCCCTTCCTTCCTTCTACTTCTTGCCTCCTCAGGAGTAGAAGCAGGGGCTGGGACCGGGTGAACCGTCTACCCACCCCTAGCTGGGAATTTAGCACACGCCGGGGCATCTGTTGATCTAACTATTTTTTCCCTACACCTGGCGGGTGTCTCTTCAATTCTTGGAGCAATCAATTTTATTACTACCATTATTAATATAAAACCCCCTGCCATCTCCCAATACCAGACACCACTATTCGTGTGGGCTGTGCTGATTACTGCCGTTCTTCTTCTTCTCTCCCTCCCCGTGCTTGCCGCAGGCATCACCATACTTCTCACAGATCGAAACTTAAACACCACCTTCTTTGACCCCGCAGGAGGAGGGGACCCTATTCTCTACCAACACCTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Etheostoma nigrum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 37
Specimens with Barcodes: 295
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Johnny darters are not considered threatened throughout most of their range. They are considered vulnerable or imperiled in some states, including Arkansas, Kentucky, Oklahoma, Kansas, and Nebraska. Johnny darters are tolerant of high levels of silt and some pollution and are able to colonize disturbed aquatic habitats readily.

IUCN Red List of Threatened Species: not evaluated

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Johnny darters are not considered threatened throughout most of their range. They are considered vulnerable or imperiled in some states, including Arkansas, Kentucky, Oklahoma, Kansas, and Nebraska. Johnny darters are tolerant of high levels of silt and some pollution and are able to colonize disturbed aquatic habitats readily.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no negative effects of Johnny darters on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Johnny darters are important members of native aquatic ecosystems and are some of the first fish to colonize disturbed aquatic habitats. They are important prey for larger game fish.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

There are no negative effects of Johnny darters on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Johnny darters are important members of native aquatic ecosystems and are some of the first fish to colonize disturbed aquatic habitats. They are important prey for larger game fish.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Johnny darter

The johnny darter, Etheostoma nigrum, is a species of ray-finned fish found in shallow water throughout eastern North America. Its name comes from the Greek root words etheo, meaning to filter, stoma, meaning mouth, and nigrum, meaning black in Latin.[1] They are important members of their aquatic ecosystems as predators and prey, and do not normally cause problems or have negative effects on their habitats.[2] Their lifespans are about three years and they reach sexual maturity at one year.[1] They are generally small, solitary fish that live in benthic habitats in fresh water and are active during the day.

Contents

Geographic distribution [edit]

The johnny darter is found throughout eastern North America, from Wyoming and Colorado to the Atlantic seaboard as far south as North Carolina. They are the most common darter in Minnesota[1] and Ohio.[3]

Physical description [edit]

Size [edit]

The johnny darter has an average length between 1.5 and 2.5 inches.[2] The males are generally longer than the females; males can reach up to 3.0 inches and the females do not get much longer than 2.3 inches.[1] Males weigh a little over 2.0 grams, and the females weigh about 1.6 grams.[1]

Color [edit]

These small, slender fish have brown to yellow scales, paler sides, and whitish bellies.[2] They have no bright colors and generally just have brown or black markings on a lighter tan background. These markings are usually a series of black "w" or "x" shapes along their sides running along their lateral lines.[3]

Scales and fins [edit]

On the fish, the opercles (or bony areas forming the gill covers) have scales, whereas the preopercles (bone at the start of the cheek), napes, and breasts are scaleless. The johnny darter has two dorsal fins, the first has hard (spinous) rays, while the second is soft-rayed (flexible). The pectoral and pelvic fins are close to each other behind the gills. The pectorals are large and fan-like and are situated on the lower sides of the fish. The pelvic fins are small and round and situated in the ventral side of the fish.[4] They have a rounded tail fin on the ventral side, as well.

Habitat, diet, and predators [edit]

Johnny darters prefer clear water with sandy and gravelly bottoms. They like slow-moving water, but can be found in moderately cloudy, moving water, as well.[1] They are bottom dwellers and stay on rocks at the bottoms of small ponds and streams with their heads facing into the current.[3] Of all the darter species, the johnny darter is the most tolerant of diverse conditions.[5] Since this darter is a benthic, freshwater fish,[2] its mouth is a subterminal where the nose is only slightly beyond the mouth and is situated in an inferior position that makes it easy for it to eat and catch food. Its diet is varied, but as young fish, it tends to eat copepods, small crustaceans, and waterfleas. As it grows, the fish start eating larger waterfleas, different types of larvae, including midges, mayflies, and caddisflies, and the occasional sideswimmer.[1] These darters are generally eaten by larger predatory fish, such as burbots, lake trout, smallmouth bass, walleyes, and yellow perch.[1]

Breeding [edit]

The spawning season is May and most of June, when the water temperatures are between 12 and 24°C. Males arrive first to establish territories throughout the pond, lake, or stream. Spawning occurs in the shallow water, pools and slow runs, with large rocks, logs, cans, shells, or other debris. When a female approaches the nest, the male darts at her and chases her out of the territory. However, when she approaches the nest upside down and tries to enter, the male will accept her. They then both turn upside down and the female will lay between 30 and 200 eggs on the underside of the debris. Johnny darters are not monogamous and the female and male will spawn with other fish. A single nest may hold up to 1000 developing eggs. The male will guard the nest and keep them oxygenated and will eat the ones that develop fungus until the embryos hatch, which is after about six to 10 days.[2]

Conservation status [edit]

These fish are not considered threatened throughout most of their range. They are considered vulnerable only in Arkansas, Kentucky, Oklahoma, Kansas, and Nebraska.[2] In Minnesota, they have no special conservation status, but are protected by state law.[1]

References [edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Etheostoma susanae formerly was regarded as a subspecies of E. nigrum; mtDNA data support recognition of the two as distinct species (Strange 1998).

E. nigrum formerly included E. olmstedi as a subspecies (Lee et al. 1980). See Chapleau and Pageau (1985) for relationship between nigrum and olmstedi in Canada.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!