Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Inhabit intertidal zone to depths of at least 25 m on both lagoon and seaward reefs. May be taken anywhere from the surface to approximately 176 m in the Indo-Pacific area, average depth of known captures at 19 m. Those from Eastern Atlantic at deeper waters, between 44 and 293 m, average depth of 107 m. In life, its esca resembles a tiny stout-bodied shrimp (Ref. 37816). Benthic (Ref. 58302). Oviparous. Eggs are bound in ribbon-like sheath or mass of gelatinous mucus called 'egg raft' or 'veil' (Ref. 6773).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Indo-Pacific: Red Sea, Persian Gulf and East Africa to the Hawaiian and Society islands, north to Japan, south to New Zealand. Eastern Atlantic: Azores, Madeira, the Canary Islands, and St. Helena.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern and Central Atlantic: Azores, Madeira, Canary Islands, Saint Helena; Red Sea, Indo-West Pacific: East Africa, South Africa, Madagascar and Mascarenes east Hawaiian Islands and Society Islands, north to southern Japan, south to Rottnest Island (Wes
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 3; Dorsal soft rays (total): 12 - 13; Analspines: 0; Analsoft rays: 7 - 8
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 130 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

13.0 cm TL (male/unsexed; (Ref. 4113))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Color variable, yellow, pink, red, brown, or black. a dark spot at base of posterior dorsal rays (a black phase with tips of pectoral rays white also occurs, Ref# 1602). Illicium about equal in length with 2nd dorsal spine. Bulbous esca with filamentous tentacles (resembling a stout-bodied shrimp, Ref# 1602). Last pelvic fin ray bifurcate. Caudal peduncle present. Eyes usually with bands radiating from its pupil (Ref. 48635).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Cotype for Antennarius nummifer
Catalog Number: USNM 49820
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): Imperial University
Locality: Misaki, Honshu, Japan, Pacific
  • Cotype: Snyder, J. O. 1902. Proceedings of the United States National Museum. 24 (1261): 374, fig. 5.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 0 - 293 m (Ref. 6773)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 50 specimens in 1 taxon.
Water temperature and chemistry ranges based on 18 samples.

Environmental ranges
  Depth range (m): 0.5 - 171.5
  Temperature range (°C): 22.496 - 29.171
  Nitrate (umol/L): 0.045 - 1.246
  Salinity (PPS): 34.113 - 37.566
  Oxygen (ml/l): 4.314 - 5.079
  Phosphate (umol/l): 0.112 - 0.277
  Silicate (umol/l): 0.873 - 5.386

Graphical representation

Depth range (m): 0.5 - 171.5

Temperature range (°C): 22.496 - 29.171

Nitrate (umol/L): 0.045 - 1.246

Salinity (PPS): 34.113 - 37.566

Oxygen (ml/l): 4.314 - 5.079

Phosphate (umol/l): 0.112 - 0.277

Silicate (umol/l): 0.873 - 5.386
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 293m.
Recorded at 293 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Inhabits intertidal zone to depths of at least 25 m on both lagoon and seaward reefs (Ref. 6773). In rocky reefs (Ref. 9137, 75154).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous. Eggs are bound in ribbon-like sheath or mass of gelatinous mucus called 'egg raft' or 'veil' (Ref. 6773).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Antennarius nummifer

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CCTATATCTTGTATTCGGCGCATGGGCCGGCATAGTAGGGACAGCCCTCAGCCTGCTAATTCGTGCAGAGCTAAGTCAACCAGGCGCACTTTTAGGTGACGATCAAATTTATAATGTTATCGTTACAGCGCACGCTTTCGTTATAATCTTTTTTATAGTCATACCAATTATAATCGGCGGATTTGGCAATTGACTAATCCCATTAATGATTGGTGCACCAGACATGGCATTCCCTCGAATGAATAACATAAGCTTCTGACTCTTACCTCCATCTTTTCTCCTTCTATTGGCATCATCGGGAGTAGAAGCTGGGGCAGGTACGGGATGAACAGTTTATCCCCCTCTCGCAGGCAACCTGGCCCACGCCGGAGCATCCGTTGATCTAACTATTTTCTCACTGCATCTCGCAGGGGTATCATCCATTTTAGGGGCTATTAATTTTATTACAACTATCATTAATATGAAACCCCCAGCCCTTTCACAATACCAAACACCATTATTTGTATGAGCTGTGTTGGTCACTGCTGTGCTGCTTCTTCTGTCTCTTCCTGTTCTTGCTGCAGGAATTACAATGTTACTAACCGATCGAAACCTAAATACAACCTTTTTTGACCCTACAGGCGGAGGAGATCCTATTCTTTATCAACATCT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Antennarius nummifer

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Antennatus nummifer

The following is a representative barcode sequence, the centroid of all available sequences for this species.


No available public DNA sequences.

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Antennatus nummifer

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest; aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Spotfin frogfish

The spotfin frogfish, Antennatus nummifer, is a fish of the family Antennariidae, found in all subtropical oceans to depths of 300 m. It grows to 13 cm (5.1 in) in total length. This species can be found in the aquarium trade.

Information[edit]

The species varies in color to match their surroundings. They are known for their ability to camouflage and get lost in their surroundings to avoid predators. They are able to lure in their prey with a stalk found between their eyes that imitates the movements of their prey; its mouth can be opened and expanded to the same width as its body to catch and swallow prey. They feed on small fish, crustaceans, and worms. [1]

Names[edit]

The spotfin frogfish is also commonly known as:[1]

  • Coin-bearing frogfish
  • Dark-spotted frogfish
  • Spotfin anglerfish
  • Spotfin angler
  • Whitefinger anglerfish
  • Whitefinger frogfish

Location[edit]

The spotfin frogfish can be found on sheltered reefs and on sandy bottoms with rich sponge growth along them. They are widespread across the Indo-Pacific region. [1]

References[edit]

  • Froese, Rainer and Pauly, Daniel, eds. (2012). "Antennatus nummifer" in FishBase. April 2012 version.
  • Tony Ayling & Geoffrey Cox, Collins Guide to the Sea Fishes of New Zealand, (William Collins Publishers Ltd, Auckland, New Zealand 1982) ISBN 0-00-216987-8
  1. ^ a b c "Spotfin Frogfish". What's That Fish. Retrieved 23 December 2012. 


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!