Overview

Comprehensive Description

Biology

Inhabits sand and gravel runs of small to medium rivers, usually near debris (Ref. 5723, 10294). Feeds on midge, blackfly, and caddisfly larvae, and mayfly nymphs (Ref. 10294).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species is scattered throughout lower Mississippi River tributaries west (in the Red and Arkansas river drainages to eastern Oklahoma and eastern Texas, and north to southeastern Missouri, southern Illinois, and western Kentucky; it also occurs in isolated areas in the Wabash River drainage, Illinois and Indiana, and Green River system, Kentucky; this darter also occurs in Gulf Coast drainages from Escambia River, Alabama and Florida, to Neches River, Texas (Page and Burr 2011).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (200,000-2,500,000 square km (about 80,000-1,000,000 square miles)) This species is scattered throughout lower Mississippi River tributaries west (in the Red and Arkansas river drainages to eastern Oklahoma and eastern Texas, and north to southeastern Missouri, southern Illinois, and western Kentucky; it also occurs in isolated areas in the Wabash River drainage, Illinois and Indiana, and Green River system, Kentucky; this darter also occurs in Gulf Coast drainages from Escambia River, Alabama and Florida, to Neches River, Texas (Page and Burr 2011).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North America: Former Mississippi Embayment and Gulf Slope drainages from Kentucky and Missouri to Louisiana, and from Escambia River in Alabama and Florida to Neches River in Texas in the USA. In Red and Arkansas drainages west to Oklahoma and Texas; in Wabash River drainage and Green River system in USA.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

endemic to a single nation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Central and southeastern U.S.A.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Maximum size: 77 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

7.7 cm TL (male/unsexed; (Ref. 5723))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Length: 7 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Paralectotype for Etheostoma (Ulocentra) histrio Jordan & Gilbert
Catalog Number: USNM 36448
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan & C. Gilbert
Locality: Saline River, Benton, Arkansas, Arkansas, United States, North America
  • Paralectotype: Collette, B. B. & Knapp, L. W. 1967. Proceedings of the United States National Museum. 119 (3550): 29.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paralectotype for Etheostoma (Ulocentra) histrio Jordan & Gilbert
Catalog Number: USNM 36409
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan & C. Gilbert
Locality: Washita River, At Arkadelphia, Ark., Arkansas, United States, North America
  • Paralectotype: Collette, B. B. & Knapp, L. W. 1967. Proceedings of the United States National Museum. 119 (3550): 29.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lectotype for Etheostoma (Ulocentra) histrio Jordan & Gilbert
Catalog Number: USNM 36386
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan & C. Gilbert
Locality: Poteau R., Hackett City, Ark. (Ind. Terr.), Arkansas, United States, North America
  • Lectotype: Collette, B. B. & Knapp, L. W. 1967. Proceedings of the United States National Museum. 119 (3550): 29.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paralectotype for Etheostoma (Ulocentra) histrio Jordan & Gilbert
Catalog Number: USNM 188972
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan & C. Gilbert
Year Collected: 1884
Locality: Poteau R., Ind., Indiana, United States, North America
  • Paralectotype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Habitat includes sand and gravel runs of small to medium rivers (Page and Burr 2011). Above the Fall Line this darter occurs most often in riffles with coarse gravel substrate; in lowland streams, it often occurs over sand among brush and detritus where logjams have created strong mid-stream currents.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Freshwater

Comments: Habitat includes sand and gravel runs of small to medium rivers (Page and Burr 2011). Above the Fall Line this darter occurs most often in riffles with coarse gravel substrate; in lowland streams, it often occurs over sand among brush and detritus where logjams have created strong mid-stream currents.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

benthopelagic; freshwater
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Arkansas River Benthopelagic Habitat

This taxon is one of a several benthopelagic species in the Arkansas River system. Benthopelagic river fish are found near the river bottom, feeding on benthos and zooplankton.The Arkansas River rises near Leadville, Colorado at an elevation of approximately 3010 meters about thirty kilometers north of Mount Elbert, Colorado's highest peak.

Tthe upper reaches of the Arkansas River manifest turbulent high gradient passage through rugged volcanic terrain; the flow continues to the Royal Gorge, where one of the world's highest suspension bridges towers 320 meters above the river surface; thereafter, the river course flows generally eastward through Kansas, thence southeastward through Oklahoma and Arkansas until its discharge to the Mississippi River. The river basin also includes parts of the states of New Mexico, Texas and Missouri.

Chief tributaries of the Arkansas River are Purgatoire River, Fountain Creek, Pawnee River, Salt Fork River, Illinois River,Verdigris River, Neosho River, Cimarron River and the Canadian River. The mean annual discharge at Little Rock, Arkansas is approximately 1118 cubic meters per second, a level remarkably undifferentiated from virgin flow, before the era of locks, impoundments and extraction.

Water quality at the headwaters near Leadville, Colorado is quite high, consisting of cold, rapidly flowing water of pH 6.3. Concentrations of calcium, sodium, magnesium and chloride are all less than ten milligrams per liter in this pristine headwaters area.

Crossing the Southern Plains below Great Bend, Kansas, the pH elevates to a level of 8.0, sodium concentrations rise to a range of 300 to 500 mg/l, with other ions rising by similar large percentages. After receiving the more pristine runoff from the Ozark Plateau, below Fort Smith, Arkansas, the pH level can be measured as low as 7.5, and sodium along with other ion concentrations are reduced by a factor of four. At the Mississippi Embayment, nitrate and phosphate levels are elevated due to row crop agricultural runoff of this region.

There are 141 species of fish present in the Arkansas basin, including two near endemic benthopelagic species: slough darter (Etheostoma gracile) and speckled darter (Etheostoma stigmae). The federally threatened and near-endemic Neosho madtom (Noturus placidus) occurs in the Neosho River, a tributary that rises in the Flint Hills. Also present in the Neosho River is the endangered Topeka shiner (Notropis topeka). The cardinal shiner (Luxilus cardinalis) is a near-endemic that is now restricted to populations in the Arkansas River and Red River, and disjunctive populations in the Neosho River.

In the upper Arkansas River mainstem a number of reptiles are found in the upper basin, including yellow mud turtle (Kinosternon flavescens), midland smooth softshell (Apalone mutica), western spiny softshell turtle (Apalone spinifera hartwegi) and northern water snake (Nerodia sipedon). In the downriver portions of the basin (Eastern Oklahoma and Arkansas) are found the false map turtle (Graptemys pseudogeographica) and the venomous cottonmouth (Agkistrodon piscivorus).

Creative Commons Attribution 3.0 (CC BY 3.0)

© C.Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 - 300

Comments: This species is represented by a large number of occurrences (subpopulations).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

Ripe females have been observed in Texas and Mississippi in February and March (Kuehne and Barbour 1983), mid-February to late March in Texas (Hubbs 1985).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Etheostoma histrio

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATCTAGTATTTGGTGCTTGAGCCGGAATAGTGGGCACCGCCCTAAGCTTACTTATCCGGGCCGAACTTAGCCAACCCGGCGCACTCCTAGGGGACGACCAAATTTATAACGTAATTGTTACCGCACACGCCTTTGTAATAATTTTCTTTATAGTGATACCCATCATAATTGGGGGTTTTGGTAACTGACTTATTCCACTTATGATCGGCGCCCCCGACATAGCATTTCCCCGTATAAACAACATGAGCTTTTGGCTTCTTCCCCCCTCCTTCCTCCTACTTCTTGCCTCCTCAGGCGTAGAAGCTGGGGCCGGAACCGGGTGAACCGTCTATCCTCCGCTAGCTGGAAATTTAGCACATGCTGGAGCATCCGTTGACTTAACTATCTTTTCCCTACACCTAGCAGGTATTTCTTCAATTTTGGGGGCCATCAATTTTATTACAACAATTATTAATATAAAACCCCCAGCCATTTCCCAATACCAAACACCTTTATTCGTGTGGGCTGTATTAATTACTGCAGTGCTTCTCCTACTTTCTCTCCCCGTGCTTGCCGCAGGCATCACCATACTTCTGACAGACCGCAACTTAAATACCACCTTTTTTGATCCCGCAGGAGGAGGGGACCCCATTTTATATCAACACCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Etheostoma histrio

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
NatureServe

Reviewer/s
Smith, K. & Darwall, W.R.T.

Contributor/s

Justification
Listed as Least Concern because extent of occurrence, number of subpopulations, and population size are relatively large, and because the species probably is not declining fast enough to qualify for any of the threatened categories.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is represented by a large number of occurrences (subpopulations).

Total adult population size is unknown but presumably exceeds 10,000. This species is widely distributed but generally uncommon (Page and Burr 2011). Recently it has been recognized as more common than previously thought.

Trend over the past three generations is uncertain but probably relatively stable or slowly declining.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Relatively stable to decline of 30%

Comments: Trend over the past three generations is uncertain but probably relatively stable or slowly declining.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Threats include habitat destruction or modification such as river channelization and pollution.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Degree of Threat: B : Moderately threatened throughout its range, communities provide natural resources that when exploited alter the composition and structure of the community over the long-term, but are apparently recoverable

Comments: Threats include habitat destruction or modification such as river channelization and pollution.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Research is needed on the ecology of the species, especially habitat requirements. Better information is needed on current distribution and abundance. Species would benefit from increased protection of occupied waters.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biological Research Needs: Research is needed on the ecology of the species, especially habitat requirements.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Protection: Unknown whether any occurrences are appropriately protected and managed

Needs: Species would benefit from increased protection of occupied waters.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Harlequin darter

The harlequin darter (Etheostoma histrio) is a small (40–50 mm (1.6–2.0 in) in length at maturity), freshwater fish in the family Percidae.[1] The distribution of the harlequin darter includes tributaries and Gulf Coastal drainage basins of the lower Mississippi River within the United States.[2] At the northern end of its range, the harlequin darter appears to prefer swift riffles located above gravel substrates. However, further south, the harlequin darter appears to prefer areas below downed wood, near detritus, with a sandy substrate.[3] The preferred diet of the harlequin darter includes aquatic macroinvertebrates, including caddisfly, midge, and black fly larvae, as well as mayfly nymphs.[4] Sexual maturity for this species is reached at age 1, and 90–450 eggs are deposited after spawning.[1] The IUCN Red List status of this darter has not yet been evaluated; but it is believed to be a highly resilient species and is not very vulnerable to population problems.[4] Not much current management is being done for this species, but due to highly variable seasonal movements, future management may benefit from analysis of dams as a barrier to movement.

Distribution[edit]

The harlequin darter was first recorded in the Ouachita River in Arkansas and the Poteau River in Oklahoma. Since then, knowledge of its geographic range has expanded to include the majority of the Southeast and the tributaries of the lower Mississippi River.[2] This species is found from Illinois, south to Florida and as far west as Texas.[5] The majority of the harlequin darter's population is found south of the Fall Line;[6] however, the northernmost record of this species occurred within the Embarras River, which is a tributary of the Wabash River of Illinois.[2] Within Tennessee, the harlequin darter only occurs in the western portion of the state, within the Mississippi River and western Tennessee River tributaries.[1] The extent of the harlequin darter's range is believed to be underestimated due to its preferred habitat type. The harlequin darter prefers areas full of woody debris in large, fast-moving bodies of water, requiring special sampling methods and likely resulting in a high degree of sampling error.[7] It has been removed from the Indiana list of endangered species after unknown populations were found.[7] In addition, known populations within the Wabash River drainage in Indiana have been noticeably increasing.[8] This species is only found in one watershed, the Escambia, in Florida. Due to the limited occurrence of this species in Florida, it is particularly vulnerable to catastrophic events within this limited range. It was further cut off from other nearby populations by the building of dams in Alabama.[9] The harlequin darter is fairly widely distributed, but is largely uncommon within its range.[6]

Ecology[edit]

The harlequin darter displays a green coloration on its sides, with six or seven brown saddles present along the top of the body. The belly of this darter is generally a yellow or tan color with dark blotches present, and the base of the caudal peduncle and caudal fin show a 'B' shape. The first dorsal fin is characterized by being clear with a red boundary.[5] The other fins are mostly dark, with many dark blotches. Males and females of this species look similar except during the breeding season, when males display a much brighter green color than females. Nuptial tubercles in this species are absent. The name harlequin darter refers to mask-like pigmentation on the face, consisting of a suborbital bar and dark blotching on the head, breast, and body.[1] The diet of the harlequin darter consists of benthic invertebrates, including larvae from midges, caddisflies, mayflies, and blackflies.[10] Ecological specialization is one of the top reasons darters have such an incredible amount of diversity.[11] Within its range, the harlequin darter prefers moderate- to fast-flowing riffles with fairly high water quality conditions;[10] but what sets it apart is its dependence on detritus and downed woody debris. It is one of the few darter species reliably found within the main channel of the Mississippi River, and it often avoids smaller streams.[1] Agricultural runoff tends to accumulate heavily into these large water bodies, greatly increasing nitrate and phosphate levels, creating an unfavorable environment for these darters.[6] Also, companies along these larger bodies of water tend to remove vegetation and woody debris in riparian zones, further negatively affecting the harlequin darter.

Lifecycle[edit]

Harlequin darters spawn once in February or March.[12] The female seeks out an appropriate nesting site as the male follows. Snags or downed woody debris usually serve as prime nesting habitats for this species. When the eggs are released, they attach to detritus within deep water at the nesting site.[5] Sexual maturity of females occurs at one year of age. The fecundity of this species has a broad range, from 90-450 eggs being produced, depending on age of the female. The maximum lifespan of this species is four years.[1] This species is believed to participate in a relatively high amount of seasonal movement. Late spring through fall are generally spent in smaller streams, and during the colder months, movement occurs into larger reservoirs and other large bodies of water. After spawning, the adults are thought to move away from large bodies of water into smaller streams, leaving behind the young of the year in the large rivers and reservoirs for the rest of that year. During sampling efforts, in areas where adults were reliably caught in the winter, only young of that year's harlequin darters were caught that May in the same water bodies.[1] So dams and other barriers to movement may be negatively affecting the lifecycle of this species. It is probably further being negatively affected by removal of downed woody debris within the water bodies preferred for spawning beds.

Management[edit]

Currently, management for this species is lacking in most areas. Sampling for this species is difficult, resulting in a lack of population data throughout its range.[9] Due to this fact, the IUCN status of this species has not yet been evaluated. However, the harlequin darter is not considered a federally endangered or threatened species.[5] Few states have management plans in place for this species. The Missouri Department of Conservation, one of the few that has developed best management practices for the harlequin darter, restricts the dates when work can be done near wetlands to protect harlequin darter breeding, leaves vegetation and woody debris in water bodies, puts up sediment controls such as silt fences, avoids the use of permanent dams that restrict movement, and avoids stream crossings by using culverts or detouring routes that cross streams where the harlequin darter resides.[12] A biological status review conducted in Florida determined many of the same management problems, including woody debris removal, damming water bodies, turbidity, and sediment loads lead to the decrease in harlequin darter numbers. This review also listed oil and coal exploration as potential threats to the success of this species. However, no direct management plan has been formed for the Florida population of harlequin darters.[9] This is notable, considering the harlequin darter is considered a species of special concern within Florida.[5]

Recommendations[edit]

The harlequin darter exhibits some degree of seasonal movement, going from large rivers into smaller tributaries for part of the year,[12] so the removal of dams and other dispersal barriers would benefit this species. This species also relies heavily on woody, organic debris over sandy bottoms.[12] Management for this species should include limiting removal of vegetation and downed woody debris in and around water bodies where this species is found. Furthermore, because this species relies on a habitat difficult to properly sample, extra sampling efforts should be undertaken within its range to determine the actual population numbers for this species. In addition, nonpoint source pollution and agricultural runoff may be negatively affecting this species.[12] Using best management practices and streamside management zones could alleviate this problem and increase the health of water bodies, not only for the harlequin darter, but for most other aquatic species present, as well. Enforcing the use of silt fences around areas of construction would reduce the sedimentation. Also, encouraging landowners to use the conservation reserve program through the United States Department of Agriculture would not only reduce soil erosion and improve water quality, but would also benefit the human population by enhancing groundwater recharge and reducing potential flood damage.

References[edit]

  1. ^ a b c d e f g Etnier, David A. and Wayne C. Starnes. 1993. The Fishes of Tennessee. Harlequin Darter: 496-497.
  2. ^ a b c Tsai, C.F. 1968. Distribution of Harlequin Darter Etheostoma histrio. Copeia 1968.1: 178-181.
  3. ^ Hubbs, C. and J. Pigg. 1972. Habitat Preferences of the harlequin darter, Etheostoma histrio, in Texas and Oklahoma. Copeia 1972.1: 193-194.
  4. ^ a b Froese, Rainer and Pauly, Daniel, eds. (2006). "Etheostoma histrio" in FishBase. April 2006 version.
  5. ^ a b c d e Florida Fish and Wildlife Conservation Commission. Harlequin Darter (Etheostoma histrio). Retrieved from http://myfwc.com/media/2211566/Harlequin-Darter.pdf.
  6. ^ a b c Encyclopedia of Life. Etheostoma histrio(Harlequin Darter). Retrieved from http://eol.org/pages/207243/details.
  7. ^ a b Fisher, Brant. E. 2008. Current status and distribution of Indiana's seven endangered darter species (Percidae). Proceedings of the Indiana Academy of Science 117(2): 167-192.
  8. ^ Simon, Thomas P. 2006. Biodiversity of fishes in the Wabash River: status, indicators, and threats. Proceedings of the Indiana Academy of Science 115(2): 136-148.
  9. ^ a b c Florida Fish and Wildlife Conservation Commission. Harlequin Darter Biological Status Review Report. Retrieved from http://myfwc.com/media/2273322/Harlequin-Darter-BSR.pdf.
  10. ^ a b Texas Water Development Board. Fluvial Focal Species Summary Report. Retrieved from http://www.twdb.state.tx.us/publications/reports/contracted_reports/doc/0900010976_Fluvial.pdf.
  11. ^ Page, Lawrence M. and David L. Swofford. 1984. Morphological correlates of ecological specialization in darters. Environmental Biology of Fishes 2: 139-159.
  12. ^ a b c d e Missouri Department of Conservation. Best Management Practices (Harlequin Darter). Retrieved from http://mdc.mo.gov/sites/default/files/resources/2010/08/9481_6423.pdf
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!