Overview

Comprehensive Description

Biology

Inhabit rocky riffles of creeks and small to medium rivers (Ref. 5723, 10294); also found in small to medium upland streams (Ref. 10294). Adults feed on midge, blackfly, and caddisfly larvae, mayfly nymphs, isopods, and amphipods (Ref. 10294). Eggs are found clustered on underside of stone and guarded by males (Ref. 7043).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (200,000 to >2,500,000 square km (about 80,000 to >1,000,000 square miles)) Range includes the Atlantic, Great Lakes, and Mississippi River basins from southern Quebec to Minnesota, and south to northeastern Oklahoma, northern Alabama, and the Peedee River system of South Carolina (Page and Burr 2011).

Subspecies brevispina: Catawba, Broad, and Peedee river drainages, North Carolina and South Carolina. Subspecies humerale: Atlantic drainages from lower Susquehanna River to the Cape Fear River. Undescribed subspecies: upper Tennessee River drainage (upstream of the Little Tennessee River), New River, and headwaters of Shavers Fork Cheat River (Monongahela River system). Subspecies flabellare: remainder of range.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Range includes the Atlantic, Great Lakes, and Mississippi River basins from southern Quebec to Minnesota, and south to northeastern Oklahoma, northern Alabama, and the Peedee River system of South Carolina (Page and Burr 2011).

Subspecies brevispina: Catawba, Broad, and Peedee river drainages, North Carolina and South Carolina. Subspecies humerale: Atlantic drainages from lower Susquehanna River to the Cape Fear River. Undescribed subspecies: upper Tennessee River drainage (upstream of the Little Tennessee River), New River, and headwaters of Shavers Fork Cheat River (Monongahela River system). Subspecies flabellare: remainder of range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America: Atlantic, Great Lakes, and Mississippi River basins from southern Quebec in Canada to Minnesota, and south to South Carolina (in Santee River system) in northern Alabama, and northeastern Oklahoma in the USA.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Central U.S.A.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Length: 8 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum size: 84 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

8.4 cm TL (male/unsexed; (Ref. 5723)); max. reported age: 4 years (Ref. 12193)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Freshwater

Comments: Habitat includes riffles with gravel or rubble substrate in streams of 1st through 8th order (creeks and small to medium rivers); in large streams, this darter occurs in shallow areas away from main current; occasionally it occurs in lakes; it occupies deeper water in winter (Lee et al. 1980, Page and Burr 2011). Eggs are laid in flat clusters on the undersides of stones in male territories in slow to moderate current in shallow water.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Habitat includes riffles with gravel or rubble substrate in streams of 1st through 8th order (creeks and small to medium rivers); in large streams, this darter occurs in shallow areas away from main current; occasionally it occurs in lakes; it occupies deeper water in winter (Lee et al. 1980, Page and Burr 2011). Eggs are laid in flat clusters on the undersides of stones in male territories in slow to moderate current in shallow water.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

benthopelagic; freshwater
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 11 specimens in 3 taxa.

Environmental ranges
  Depth range (m): 0.1 - 0.55

Graphical representation

Depth range (m): 0.1 - 0.55
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Migrates downstream to deep water wintering sites in some areas (Scott and Crossman 1973, Trautman 1981).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Eats mainly immature aquatic insects and small crustaceans.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Inhabits rocky riffles of creeks and small to medium rivers.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Comments: This species is represented by a large number of occurrences (subpopulations).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

100,000 to >1,000,000 individuals

Comments: Total adult population size is unknown but very large. This species is abundant in much of its range.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Eggs are found clustered on underside of stone (Ref. 7043). Males guard the eggs (Ref. 7043).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Spawns from April to May (Missouri), June, or July, depending on the locality. Several females may oviposit in territory of single male. Male guards eggs, which hatch in 30-35 days at 17-20 C, 14-16 days at 23.5 C. Age range of breeding females is 1-2 years (Bart and Page 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Etheostoma flabellare

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 32 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATCTAGTATTTGGTGCTTGGNCCGGTATAGTAGGCACCGCCCTAAGCTTACTTATCCGAGCCGAACTGAGCCAACCCGGTGCACTCCTCGGAGATGACCAGATTTATAATGTAATTGTTACAGCACATGCCTTTGTAATAATTTTCTTTATAGTGATACCAATTATAATTGGAGGCTTTGGAAACTGACTTGTGCCACTCATAATTGGNGCCCCCGACATGGCATTCCCTCGAATAAATAATATGAGTTTTTGACTCCTTCCCCCTTCCTTCCTCCTACTTCTTGCCTCTTCAGGAGTAGAAGCAGGGGCTGGGACCGGATGAACCGTCTATCCGCCACTAGCTGGTAACTTAGCACACGCTGGGGCATCCGTTGATTTGACTATTTTTTCCCTGCACCTAGCCGGGATTTCTTCAATTCTAGGGGCCATCAACTTTATTACGACTATTATTAACATAAAACCCCCAGCCATTTCTCAATACCAGACACCCCTATTTGTCTGGGCTGTATTAATTACTGCTGTGCTTCTTCTTCTTTCCCTCCCCGTGCTTGCCGCAGGTATCACTATACTTCTTACAGACCGAAACTTAAACACTACCTTCTTTGATCCGGCGGGAGGGGGAGATCCTATCCTCTACCAACACCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Etheostoma flabellare

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 32
Specimens with Barcodes: 57
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N4 - Apparently Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
NatureServe

Reviewer/s
Smith, K. & Darwall, W.R.T.

Contributor/s

Justification
Listed as Least Concern in view of the large extent of occurrence, large number of subpopulations, large population size, apparently stable trend, and lack of major threats.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: Trend over the past 10 years or three generations is uncertain but likely relatively stable.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is represented by a large number of occurrences (subpopulations).

Total adult population size is unknown but very large. This species is abundant in much of its range.

Trend over the past 10 years or three generations is uncertain but likely relatively stable.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Comments: No major threats are known.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Major Threats
No major threats are known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Currently, this species is of relatively low conservation concern and does not require significant additional protection or major management, monitoring, or research action.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Fantail darter

The fantail darter (Etheostoma flabellare) is a species of fish in the Percidae family, widely distributed across streams in North America.

Distribution and habitat[edit]

The fantail darter is distributed across much of eastern North America, from the Great Lakes and the Mississippi River basins to South Carolina and northern Alabama, in small streams. They can be found as far west as northeastern Oklahoma.[2] These darters, like many others, live in smaller streams. Due to their breeding habits, they are found in areas of the stream with cobbles and flat stones. .[3] These fish are especially abundant near large slabs of limestone or shale.[4] Partly because of their wide range of habitats, fantail darters have not been labelled as endangered.

It is well-adapted for stream life, and the environmental changes that occur in streams as the seasons change. Changes can include the loss of microhabitats, when the fish must drift downstream to find another,[5] and also include changes in oxygen levels due to pollution or weather.[6]

Ecology[edit]

Similar to other darters, fantail darters have several predators. They are also well-colored for their habitats, and they blend in easily with the surrounding stream bed and rocks. Depending on the size of the specific darter, they can eat anything from tiny insects to larger insects and midge larve.[4] Their food sources can include mayflies, caddisflies, dipterans, copepods, cladocerans, amphipods, isopods, and gastropods. The larger fantail darters can include the larger type of insects, including mayfly and midge larvae.[4] Fantail darters are primarily benthic invertivores, so inhabit shallow, high-velocity microhabitats of the streams - riffles.[5] If the microhabitat is destroyed or all the resources are used up, the fantail darter will simply move to another, where more food can be found.[5] During the summer months, the water temperatures of streams rise significantly, causing the water to have a lower oxygen level.[6] Fantail darters have a good tolerance for this temperature change and low oxygen levels.[6] With higher temperatures, water in the streams will evaporate quickly. The fantail darter has actually adapted to this, and is sometimes found to evacuate a drying riffle.[5] Though the fantail darter has a fairly good low-oxygen tolerance, there comes a point when too little oxygen is harmful. Without oxygen in the water, the fish will die out eventually. Low oxygen levels can also be caused by pollution of the stream. Pollution can also kill off the small invertebrates the fantail darter consumes.

Life history[edit]

The fish spawn in early summer, when water temperatures reach 17-20°C.[7] Other darters, such as the logperch and rainbow darters, spawn at least a month before the fantail darter.[7] which apparently needs warmer temperature waters before it can spawn; the eggs also tend to be larger.[7] Fantail darters have an interesting growth period in that they do not really have a larval stage; instead, they start to feed two to three days after hatching. By then, the medial fins are differentiated.[7] They are born large, with well-developed heads, jaws, and teeth.[7] When first hatched, the free embryos are benthic and rarely go into the water column.[7] Fantail darters also have extensive and well-developed vitelline plexuses from the time they are very young, which allows them to feed on bigger prey quickly. This means that they have no need to drift farther down the stream to find small planktonic prey as early young.[7] As the darters grow and mature, they take on the characteristics of their sex. They mature and become of breeding age in one to two years, and usually do not live longer than four years.[5] The males of this species have modified first dorsal fins that characteristically look like little bulbs. This is believed to be used for egg mimicry purposes. Females are proven to be more likely to spawn with a male that already has a clutch of eggs.[3] This may have led to an evolutionary change of the specialized egg-mimicking morphology in males.[3] Since the male already looks like he has eggs, the female will come under the rock where he has cleared a space, and will lay her eggs on the underside of the top rock; usually, several females add to each male’s clutch, resulting in more diversity and offspring produced. Throughout the time of egg growth, the male will take care of the eggs, but he may eat some of them to keep up his energy.[8] These nests can be easily disturbed, and the delicate eggs can be destroyed simply by a human walking through the stream, yet another potential risk in their lives.

Though the males guard the eggs, studies have shown they exhibit filial cannibalism, meaning they eat some of the eggs in their nest.[3] A research study collecting data on the fantail darter found all the males are, in fact, cannibals. Some males will eat the entire nest of eggs, while others will eat only part of it.

Management[edit]

Currently, no management plans are in place for the fantail darter, as it is fairly well distributed with good population sizes. Although not currently at risk for extinction, or even endangered, the fantail darter should be managed so this risk can be avoided in the future. If, for instance, the rock bed of the stream is disturbed, this could cause the little nooks in which the females lay their eggs to disappear. Without this, the females have nowhere to lay their eggs, the males cannot care for them, and thus no offspring are produced. If, however, the female still lays her eggs without the male's nest, the eggs now risk heavy predation. Many other circumstances may cause a need for population management of the fantail darter, such as pollution of the stream, invasive species, or even human invasion of habitat. To avoid future decline of this species, the streams where they live should be managed and protected. To accomplish this, development near the streams and upstream hazards, such as wastewater plants, should be controlled. Though the fantail darter does not need to be managed now, periodic sampling of the species should occur to determine if management is needed. Should an area come under concern for low populations, research should be conducted to see what exactly is causing the dropping numbers. Next, areas of critical habitats should be protected. Lastly, the general public should be informed.

References[edit]

  1. ^ NatureServe (2013). "Etheostoma flabellare". IUCN Red List of Threatened Species. Version 3.1. International Union for Conservation of Nature. Retrieved November 22, 2013. 
  2. ^ Page, L.M.; Burr, B.M. (1991). A field Guide to freshwater fishes of North America north of Mexico. 
  3. ^ a b c d Knapp, R.A.; Sargent, R.C. (1989). "Egg-mimicry as a mating strategy in the fantail darter, Etheostoma flabellare: females prefer males with eggs". Behavioral Ecology and Sociobiology 25: 321–326. doi:10.1007/bf00302989. 
  4. ^ a b c Smith, C.L. (1985). The Inland Fishes of New York State. 
  5. ^ a b c d e Roberts, J.H.; Angermeier, P.L. (2007). "Spatiotemporal variability of stream habitat and movement of three species of fish". Oecologia 151: 417–430. doi:10.1007/s00442-006-0598-6. 
  6. ^ a b c Hlohowskyj, I.; Wissing, T.E. (1987). "Seasonal changes in low oxygen tolerance of fantail, Etheostoma flabellare, rainbow, E. caeruleum, and greenside, E. blennioides, darters". Environmental Biology of Fishes 18: 227–283. doi:10.1007/bf00004880. 
  7. ^ a b c d e f g Paine, M.D. (1984). "Ecological and evolutionary consequences of early ontogenies of darters (Etheostomatini)". Environmental Biology of Fishes 11: 97–106. doi:10.1007/bf00002258. 
  8. ^ Lindstrom, K.; Sargent, R.C. (1997). "Food access, brood size and filial cannibalism in the fantail darter, Etheostoma flabellare". Behavioral Ecology and Sociobiology 40: 107–110. doi:10.1007/s002650050322. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Possibly a multi-species conglomerate (Lee et al. 1980). Based on morphological evidence, Blanton and Shuster (2008) concluded that Etheostoma flabellare brevispinum should be recognized as a distinct species, E. brevispinum. Data did not support recognition of the New River and Roanoke River populations of E. flabellare as intergrade zones between E. brevispinum and E. flabellare as was previously suggested.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!