Overview

Comprehensive Description

Biology

Occurs in fast, deep rocky riffles in small to medium rivers (Ref. 5723, 10294).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

North America: found only in Holston and Nolichucky River systems (Tennessee River drainage) in western Virginia, western North Carolina and eastern Tennessee, USA.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

endemic to a single nation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Holston and Nolichucky river systems, upper Tennessee River drainage, eastern Tennessee, western Virginia (extremely rare, South Fork Holston River above the head of South Holston Reservoir), and western North Carolina (rediscovered after reported extirpation). The largest and most viable populations are in the Nolichucky River, Tennessee (about 125 river km); occurs both above and below Davy Crockett Reservoir. In North Carolina (1991-1993), found at 11 of 57 sites sampled in the Nolichucky River and upstream in the lowest 8 km of the Cane River, the lowest 18.6 km of the North Toe River, and in one tributary of the last (Rohde and Arndt 1994). Occupies about 3 river km of the South Fork Holston River in Virginia. See Etnier and Starnes (1993) for an historical account of the known distribution.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Tennessee, North Carolina and Virginia, eastern U.S.A.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Maximum size: 84 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

8.4 cm TL (male/unsexed; (Ref. 5723)); max. reported age: 3 years (Ref. 10294)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Length: 6 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

benthopelagic; freshwater
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Freshwater

Comments: Strongly flowing water in riffles and chutes of large upland creeks and medium-sized rivers where substrate consists of coarse gravel, rubble, or boulders and the water is cool or warm, usually clear or slightly turbid, with a moderate gradient. Where common, as in the Nolichucky River, Tennessee, often occurs among lush growth of riverweed (Podostemum). In North Carolina, most common in riffles near river islands. See Kuehne and Barbour (1983), Burkhead and Jenkins (1991), and Rohde and Arndt (1994). Eggs evidently are buried in sand in riffle areas near the base of a large rock (Bryant 1979), apparently in the same areas of swift current that are inhabited during the nonspawning period (Burkhead and Jenkins 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Comments: Eats mainly immature benthic insects such as blackflies, mayflies, and midges (Bryant 1979, Page 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 6 - 20

Comments: Known from a couple dozen collecting localities. In 1995, TVA reported 18 locations, of which 4 are extirpated. There are at least several element occurrences (EOs) (number depends on how collection sites are lumped to delimit EOs).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

Unknown

Comments: In North Carolina, common to abundant at most occupied sites (Rohde and Arndt 1994). Most surveys find 1 to 20 individuals at a single site. Often the most abundant darter in Nolichucky River downstream from Irwin, Tennessee, and also abundant in the lower Cane River (D. Eisenhour, fide Mel Warren, pers. comm., 1999).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Eggs are left buried in small gravel and pebbles (Ref. 6466).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Spawning period appears to extend from late June through mid-August; sexually mature in 1-2 years (Bryant 1979, Page 1983, Lee et al. 1980). Age range of breeding females generally is 1-2 years (Bart and Page 1992). Some individuals live as long as 3 years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Etheostoma acuticeps

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATCTAGTATTTGGTGCTTGGGCCGGAATAGTGGGCACTGCCCTTAGTCTACTCATCCGCGCAGAACTAAGCCAACCCGGAGCACTCCTTGGAGATGACCAGATCTATAACGTCATTGTTACAGCACACGCCTTTGTAATGATTTTCTTTATAGTGATGCCAATTATGATTGGAGGGTTTGGAAACTGACTTGTACCACTTATGATTGGTGCTCCCGACATGGCATTCCCCCGAATAAACAACATAAGCTTTTGGCTCCTGCCCCCTTCCTTCCTTCTACTTCTTGCTTCCTCAGGAGTAGAGGCTGGCGCTGGGACTGGCTGAACCGTTTATCCGCCTCTAGCCGGAAACTTGGCACACGCCGGGGCATCCGTTGACCTAACCATTTTTTCTCTGCATCTGGCAGGAATCTCCTCAATTCTGGGGGCCATTAATTTTATTACAACTATCATTAACATGAAACCCCCCGCTATTTCCCAGTACCAAACCCCCCTATTCGTCTGAGCTGTACTAATTACCGCAGTACTTCTTCTTCTTTCCCTTCCCGTGCTTGCCGCAGGCATCACCATGCTCCTCACAGATCGAAACTTAAACACAACTTTCTTCGACCCCGCGGGAGGGGGAGATCCAATCCTTTACCAACACTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Etheostoma acuticeps

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LR/nt
Lower Risk/near threatened

Red List Criteria

Version
2.3

Year Assessed
1996
  • Needs updating

Assessor/s
Gimenez Dixon, M.

Reviewer/s

History
  • 1994
    Rare
    (Groombridge 1994)
  • 1990
    Rare
    (IUCN 1990)
  • 1988
    Vulnerable
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Vulnerable
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N3 - Vulnerable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G3 - Vulnerable

Reasons: Occurs in the South Fork Holston and Nolichucky river systems in Tennessee, North Carolina, and Virginia; range is fragmented by impoundments and has been negatively affected by water pollution, but some populations apparently have increased with improvements in water quality; currently there are several populations not facing imminent threats, but a catastrophic pollution event in the Nolichucky River could affect conservation status.

Other Considerations: Listed by Deacon et al. (1979) as threatened, but this was prior to survey work that significantly expanded the known range.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Decline of 10-30%

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Lower Risk: near threatened (LR/nt)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Degree of Threat: B : Moderately threatened throughout its range, communities provide natural resources that when exploited alter the composition and structure of the community over the long-term, but are apparently recoverable

Comments: Populations have been greatly reduced or eliminated through siltation and inundation and cold tailwaters resulting from impoundment (Burkhead and Jenkins 1991). One large toxic spill in the upper Nolichucky River could severely damage the population there and affect the conservation status of the species (Burkhead and Jenkins 1991). "Secure" in North Carolina (Rohde and Arndt 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Restoration Potential: Populations apparently may respond quickly to improvments in water quality (Etnier and Starnes 1993).

Management Requirements: The South Fork Holston River population may benefit by transplanting fishes from the Nolichucky River, though fish competitors (redline darter, sculpins) in the former stream may limit or prevent the success of such a transplant (Burkhead and Jenkins 1991).

Biological Research Needs: A life history study has already been completed.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Protection: None. No occurrences appropriately protected and managed

Needs: Would benefit from improvements in water quality, including reduction in siltation.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Sharphead darter

The sharphead darter (Etheostoma acuticeps) is a species of fish in the Percidae family. It is endemic to the United States.

Source

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!