Overview

Comprehensive Description

Biology

Usually found in coastal waters within about 30 km from shore, but as far out as 480 km, forming large, tightly packed schools. Enters bays and inlets. Feeds on euphausiids, copepods and decapod larvae, both by random filter-feeding and by 'pecking' at prey. Oviparous, epipelagic batch spawner (Ref. 6882). Spawns throughout the year, peaking once (Ref. 6882). Processed into fishmeal, used as bait for tuna, occasionally canned (Ref. 9298).
  • Whitehead, P.J.P., G.J. Nelson and T. Wongratana 1988 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (Suborder Clupeoidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/2):305-579. Rome: FAO. (Ref. 189)   http://www.fishbase.org/references/FBRefSummary.php?id=189&speccode=4 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Common names: anchovy (English), anchoa (Espanol), anchoveta (Espanol)
 
Engraulis mordax Girard, 1854

California anchovy,     Northern anchovy



Body elongated, rounded; snout long, sharply pointed, prominent; top jaw moderate, reaching onto preoperculum, with pointed tip; tip of bottom jaw reaching under nostril; fine teeth on lower jaw; gill filament on body under gill cover large, reaching onto inner surface of gill cover; membrane under throat between gill covers not expanded at rear; gill rakers fine and slender, 37-45 lower rakers, third gill arch with rakers on rear surface; gill branch under gill cover longer than eye; dorsal fin origin in mid-body; pectoral short, not reaching pelvics; anal fin short (iii, 13-20), origin under or just behind last dorsal ray.

Silver stripe along flank in young fish only.


Size: 25 cm.

Habitat: marine, coastal pelagic, usually within 30km of shore.

Depth: 0-310 m.

Temperate; British Colombia to the tip of Baja, most of the lower Gulf of California.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

British Columbia, Canadian Exclusive Economic Zone [Pacific part], Coastal Waters of Southeast Alaska and British Columbia, FAO fishing area 67, North East Pacific, North Pacific
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Northeast Pacific: northern Vancouver Island south to Cape San Lucas, Baja California, Mexico. Two subspecies recognized: Engraulis mordax mordax from British Columbia to Baja California and Engraulis mordax nanus in Bays of California.
  • Whitehead, P.J.P., G.J. Nelson and T. Wongratana 1988 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (Suborder Clupeoidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/2):305-579. Rome: FAO. (Ref. 189)   http://www.fishbase.org/references/FBRefSummary.php?id=189&speccode=4 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This species is distributed in temperate waters from British Colombia to the tip of Baja California, and can be found throughout most of the western and the central eastern Gulf of California.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Northern anchovy are found off the west coast of North America, from Queen Charlotte Islands in British Columbia, Canada, to Cabo San Lucas in Baja California, Mexico, and in the Gulf of California.

Biogeographic Regions: nearctic (Native ); pacific ocean (Native )

  • U.S. Fish and Wildlife Service. Species Profiles: Life Histories and Environmental Requirements of Coastal Fishes and Invertebrates (Pacific Southwest): Northern anchovy. Biological Report 82(11.50). Lafayette, Louisiana: U.S. Army Corps of Engineers. 1986. Accessed May 05, 2011 at http://www.nwrc.usgs.gov/wdb/pub/species_profiles/82_11-050.pdf.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eastern Pacific: British Columbia to Gulf of California.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth

Depth Range (m): 0 (S) - 310 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific


 
Global Endemism: All species, East Pacific endemic, TEP non-endemic

Regional Endemism: All species, Tropical Eastern Pacific (TEP) non-endemic, Temperate Eastern Pacific, primarily, California province, primarily, Continent, Continent only

Residency: Vagrant

Climate Zone: North Temperate (Californian Province &/or Northern Gulf of California), Northern Subtropical (Cortez Province + Sinaloan Gap)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 14 - 19; Analspines: 0; Analsoft rays: 19 - 26; Vertebrae: 43 - 47
  • Whitehead, P.J.P., G.J. Nelson and T. Wongratana 1988 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (Suborder Clupeoidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/2):305-579. Rome: FAO. (Ref. 189)   http://www.fishbase.org/references/FBRefSummary.php?id=189&speccode=4 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Northern anchovies are small, slightly compressed and have large, inferior mouths. They are an iridescent bluish-green on the dorsum and shiny silver along the ventral surface. Adults have a faint silver stripe along their side. The insertion point of the anal fin can be used to distinguish northern anchovies from other anchovy species, as it inserts immediately posterior to the dorsal fin. Average adult size is 9 g in mass and 7 cm in length, and individuals rarely exceed 10 g in mass and 9 cm in length. Sexual dimorphism has not been reported in this species.

Range mass: 10 (high) g.

Average mass: 9 g.

Range length: 9.0 (high) cm.

Average length: 7.0 cm.

Other Physical Features: heterothermic ; bilateral symmetry

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length max (cm): 25.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 248 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

24.8 cm SL (male/unsexed; (Ref. 27436)); max. published weight: 68.0 g (Ref. 56527); max. reported age: 7 years (Ref. 6884)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Snout quite sharply pointed; maxilla moderate, tip sharply pointed, reaching to or almost to hind border of pre-operculum, projecting well beyond tip of second supra-maxilla; tip of lower jaw below nostril. gill rakers slender, long; absent on hind face of third epibranchial. Anal fin origin under about base of last dorsal fin ray. A silver stripe along flank, disappearing with age.
  • Whitehead, P.J.P., G.J. Nelson and T. Wongratana 1988 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (Suborder Clupeoidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/2):305-579. Rome: FAO. (Ref. 189)   http://www.fishbase.org/references/FBRefSummary.php?id=189&speccode=4 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type for Engraulis mordax
Catalog Number: USNM 82904
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Locality: Maui, Hawaii, United States, Hawaiian Islands, Pacific
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type for Engraulis mordax
Catalog Number: USNM 946
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): L. Williamson
Locality: San Francisco, Cal., San Francisco County, California, United States, Pacific
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

pelagic-neritic; marine; depth range 0 - 300 m (Ref. 265), usually ? - 219 m (Ref. 54433)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This is a pelagic species that is usually found in coastal waters within about 30 km from shore, but as far out as 480 km. It is found as deep as 310 m. It forms large, tightly packed schools, entering bays and inlets. This species feeds on euphausiids, copepods, and decapod larvae, both by random filter-feeding and by pecking at prey (Chiappa-Carrara and Gallardo-Cabello 1993).

This is an oviparous, epipelagic batch spawner. It spawns throughout the year, peaking once at night between 2000 and 0400 hours. The spawning region corresponds from British Colombia south to Magdalena Bay, Baja California, but most abundantly between Point Conception and Point San Juanico. There are two major spawning areas: 1) southern California and northern Baja California and 2) central and southern Baja California. This species is oviparous, spawning either in inlets or offshore throughout the year, but mainly in the winter and early spring. It depends on hydrological conditions, preferably at in upper water layers and around 22.00 hours (Hunter and Goldberg 1980, Watson and Sandknop 1996).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Engraulis mordax is a neritic, epipelagic species that favors areas of coastal upwelling. Larvae can be found from 0 to 50 meters in depth, and adults are commonly found between 70 m and 200 m in depth. Larvae, juveniles, and adults can tolerate water temperatures between 8 and 25 degrees Celsius.

Range depth: 0 to 200 m.

Average depth: 73 m.

Habitat Regions: temperate ; saltwater or marine

Aquatic Biomes: pelagic ; coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 113 specimens in 1 taxon.
Water temperature and chemistry ranges based on 83 samples.

Environmental ranges
  Depth range (m): 1 - 165
  Temperature range (°C): 7.611 - 17.129
  Nitrate (umol/L): 0.089 - 27.924
  Salinity (PPS): 31.561 - 33.799
  Oxygen (ml/l): 2.801 - 6.583
  Phosphate (umol/l): 0.407 - 2.300
  Silicate (umol/l): 2.569 - 43.395

Graphical representation

Depth range (m): 1 - 165

Temperature range (°C): 7.611 - 17.129

Nitrate (umol/L): 0.089 - 27.924

Salinity (PPS): 31.561 - 33.799

Oxygen (ml/l): 2.801 - 6.583

Phosphate (umol/l): 0.407 - 2.300

Silicate (umol/l): 2.569 - 43.395
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 250m.
Recorded at 250 meters.

Habitat: pelagic. Usually found in coastal waters within about 30 km from shore, but as far out as 480 km, forming large, tightly packed schools. Enters bays and inlets. Feeds on euphausids, copepods and decapod larvae, both by random filter-feeding and by 'pecking' at prey. Spawning occurs from British Colombia, Canada to Magdalena Bay in Baja Calif., Mexico. Spawns throughout the year, both in- and offshore, mainly in winter and early spring, mostly at depths <10 m and temperatures of 10-13°C. Reduced to fish meal, used as bait for tuna, occasionally canned (Ref. 9298).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Salinity: Marine, Marine Only

Inshore/Offshore: Inshore, Inshore Only

Water Column Position: Surface, Near Surface, Water column only

Habitat: Water column

FishBase Habitat: Pelagic
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Coastal species occurring within 30 km offshore, but may be found as far as 480 km offshore and down to 219 m depth. Forms tightly packed schools; enters bays and inlets (e.g., to about 2 km up Newport Bay, mainly in July and September - (Ref. 6361). Feeds both by random filter- and particulate-feeding (Ref. 42392). Moves up near the surface at night.
  • Whitehead, P.J.P., G.J. Nelson and T. Wongratana 1988 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (Suborder Clupeoidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/2):305-579. Rome: FAO. (Ref. 189)   http://www.fishbase.org/references/FBRefSummary.php?id=189&speccode=4 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Northern anchovies feed upon krill, copepods, and decapod larvae, and collect food via filter feeding and active predation. When filter feeding, water and zooplankton pass through its large gaping mouth as it swims. Water passing over the gills is strained through long, finely-separated gill rakers, which collect particulate organic matter, phytoplankton, and zooplankton. Apart from nonselective filter feeding, northern anchovies have also been observed 'pecking' at larger prey. Adult northern anchovies typically attack prey only once and rarely make a second attempt in the event that prey escape.

Upon sighting prey, northern anchovy larvae assumes an S-shaped posture and advances toward the prey by sculling its pectoral fins and undulating the fin fold, while maintaining the S-posture. Larval anchovies maintain prey in the center of their visual field via slight adjustments in the position of its head and body. When prey are within striking distance, a larva opens its mouth and straightens its body. This causes the body to project forward, and the prey is ingested. The entire process takes about 1 to 2 seconds.

Animal Foods: zooplankton

Plant Foods: phytoplankton

Foraging Behavior: filter-feeding

Primary Diet: planktivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Feeding

Feeding Group: Planktivore

Diet: phytoplankton, zooplankton, pelagic fish eggs, pelagic fish larvae
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Northern anchovies are an important primary and secondary consumer within the epipelagic food web of the Pacific coast. It is a critical source of food for a great variety of organisms, such as larger fish, marine mammals, and marine birds. Larvae are an important component of the spring ichthyoplankton assemblage in coastal California. Northern anchovies are host to numerous endoparasites, including protists (e.g., myxosporidian protozoan), flatworms (e.g., hemiurid trematodes and didymozoid trematodes, and digenean flatworms), and roundworms (e.g., Anisakis and Hysterothylacium).

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Northern anchovy larvae, while transparent, fall prey to a number of invertebrate and vertebrate planktivores. As juveniles they acquire pelagic coloration, and are extremely vulnerable to piscivores such as albacore and chub mackeral. A wide variety of fish, seabirds, and marine mammals feed on northern anchovies. They form large schools for protection against predators, and their coloration may help camouflage them from potential predators. Humans are probably the most significant predator of northern anchovies.

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Engraulis mordax (northern anchovy) is prey of:
Sebastes miniatus
Scorpaena guttata
Zalophus californianus
Scorpaenichthys marmoratus
Cephalopoda
Genyonemus lineatus

Based on studies in:
USA: California, Southern California (Marine, Sublittoral)

This list may not be complete but is based on published studies.
  • T. A. Clark, A. O. Flechsig, R. W. Grigg, Ecological studies during Project Sealab II, Science 157(3795):1381-1389, from p. 1384 (1967).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Engraulis mordax (northern anchovy) preys on:
detritus

Based on studies in:
USA: California, Southern California (Marine, Sublittoral)

This list may not be complete but is based on published studies.
  • T. A. Clark, A. O. Flechsig, R. W. Grigg, Ecological studies during Project Sealab II, Science 157(3795):1381-1389, from p. 1384 (1967).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Little is known of communication and perception in this species. However, northern anchovies use vision and chemoreception through nares and the lateral line system to perceive their environment and communicate with conspecifics.

Communication Channels: visual ; chemical

Perception Channels: visual ; vibrations

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Spawns from British Colombia south to Magdalena Bay, Baja California, but most abundantly between Point Conception and Point San Juanico. There are two major spawning areas: 1) off southern California and northern Baja California and 2) off central and southern Baja California. Oviparous (Ref. 35602). Spawns either in inlets or offshore, throughout the year but mainly in winter and early spring, depending on hydrological conditions (preferably at 10 to 23.3° C in upper water layers and around 22.00 hours). Spawning occurs at night between 2000 and 0400 hour (Ref. 6882).
  • Whitehead, P.J.P., G.J. Nelson and T. Wongratana 1988 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (Suborder Clupeoidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/2):305-579. Rome: FAO. (Ref. 189)   http://www.fishbase.org/references/FBRefSummary.php?id=189&speccode=4 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Development

During the larval period and throughout development, integument and lateral line system of northern anchovies develop gradually. Their eyes migrate from a binocular orientation to the sides of the head, and the digestive tract gradually becomes able to digest proteins. The swim bladder develops expansive capability via muscle differentiation, and trunk musculature differentiates and develops into two muscle fiber types. Organs development in northern anchovies can be characterized as initial differentiation followed by continued development of specialized cell and tissue types. A complete review of embryological development is provided in O'Connel, 1981.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Little information is available concerning the average lifespan of northern anchovies. In the wild, most live between 4 and 7 years, with an average lifespan of 5 years.

Average lifespan

Status: wild:
7 years.

Typical lifespan

Status: wild:
4 to 7 years.

Average lifespan

Status: wild:
5 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Northern anchovies are promiscuous, as both sexes spawn indiscriminately with multiple partners during breeding season.

Mating System: polygynandrous (promiscuous)

Northern anchovies breed during late winter and spring, however, some research suggests that they spawn throughout the year, with peak activity occurring from February to April. Spawning usually occurs within 95 km of the coast, but has been recorded up to 480 km offshore. There are approximately 574 eggs per gram, and fertilized eggs hatch 2 to 4 days after spawning. Northern anchovies perform seasonal migrations, usually moving to deeper, offshore waters during winter, and returning to shallow, coastal waters for spring. Males and females become sexually mature at about 2 years of age.

Breeding season: Throughout the year, with peaks between February to April.

Range number of offspring: 20,000 to 30,000.

Range time to hatching: 2 to 4 days.

Average age at sexual or reproductive maturity (female): 2 years.

Average age at sexual or reproductive maturity (male): 2 years.

Key Reproductive Features: year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); broadcast (group) spawning; oviparous

Northern anchovies are broadcast spawners, and therefore, parental care is nonexistent in this species.

Parental Investment: no parental involvement

  • Hewitt, R. 1985. The 1984 spawning biomass of the northern anchovy. CalCOFI Report, XXVII: 16-24. Accessed May 11, 2011 at http://calcofi.ucsd.edu/newhome/publications/CalCOFI_Reports/v27/pdfs/Vol_27_Bindman.pdf.
  • Hunter, R., S. Goldberg. 1979. Spawning incidence and batch fecundity in northern anchovy, Engraulis mordax. Fishery Bulletin, 77 No. 3: 641-652. Accessed May 11, 2011 at http://swfsc.noaa.gov/publications/CR/1980/8036.PDF.
  • Miller, D., R. Lea. 1972. Guide to the Coastal Marine Fishes of California: California Fish Bulletin Number 157. California: Division of Agriculture and Natural Resources.
  • Picquelle, S., R. Hewitt. 1983. The northern anchovy spawning biomass for the 1982-83 California Fishing season. Northern Anchovy spawning biomass, XXIV: 16-28.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Egg Type: Pelagic, Pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Engraulis mordax

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 17 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTGGCACCCTATATCTTATTTTCGGTGCCTGAGCAGGAATAGTAGGAACAGCACTTAGCCTCCTTATTCGAGCAGAATTAAGCCAACCAGGAGCACTTCTGGGAGACGATCAGATTTATAACGTAATCGTAACTGCTCACGCATTCGTAATAATCTTTTTTATGGTAATACCCATCCTAATCGGTGGGTTCGGGAACTGACTGGTCCCTCTAATACTAGGGGCCCCAGACATGGCATTCCCCCGAATGAACAACATGAGCTTTTGACTCCTCCCTCCTTCATTCCTTCTTCTTCTCGCATCATCTGGTGTTGAAGCAGGAGCTGGAACCGGGTGAACGGTTTACCCGCCTCTAGCAGGAAACCTGGCCCATGCAGGAGCATCAGTAGATTTAACAATCTTCTCCCTCCACTTAGCCGGGATTTCATCAATCCTAGGTGCAATCAATTTTATCACCACCATCATTAATATGAAGCCGCCTGCCATTTCACAATACCAGACACCTTTATTTGTCTGAGCTGTGTTAATCACGGCAGTACTTTTACTTCTTTCACTCCCAGTTCTAGCCGCTGGTATTACTATGCTTCTTACAGACCGAAATCTTAACACTACTTTCTTCGACCCGGCAGGAGGAGGAGACCCAATCCTTTACCAACACCTATTCTGATTCTTCGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Engraulis mordax

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 18
Specimens with Barcodes: 20
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Iwamoto, T., Eschmeyer, W., Alvarado, J.

Reviewer/s
Carpenter, K., Polidoro, B., Livingstone, S. (Global Marine Species Assessment Team)

Contributor/s

Justification
This species has a wide distribution and occurs in Marine Protected Areas. Although this species has been overfished in the past, the large distribution should mitigate this threat. Therefore this species is listed as Least Concern. This species should be monitored in the future to ensure that the fisheries do not cause declines in the population.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Based on research by California Department of Fish and Game (CDFG), northern anchovy landings and exploitation rates since 1983 have been decreasing. While biomass estimates are unavailable for recent years, CDFG believes the stock is currently stable at a modest biomass level. Northern anchovies are classified as a species of least concern on the IUCN's Red List of Threatened Species. Although current populations are thought to be stable, overfishing presents a potential threat to the longterm persistence of this species.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
It is a very common species within its range. This species has been overfished, and harvest was restricted by law solely as a baitfish in California from 1949 to 1955, but it has since been used in British Colombia in the 1940s, when it was very abundant, for canning or processing into fishmeal or oil. There have been wide fluctuations in populations, partly in relation to hydrology, but complicated by the relation with the also fluctuating populations of the California pilchard (Sardinops caeruleus). The recorded catch in 1982 was 294,859 t (247,997 t by Mexico). It was fished with lampara nets, but after about 1946 mainly by purse seines. The total catch reported for this species to the FAO for 1999 was 11,137 t. The countries with the largest harvests were Mexico (5,814 t) and USA (5,323 t) (FAO-FIGIS 2001).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
This species has been overfished. The countries with the largest harvests were Mexico (5,814 t) and USA (5,323 t) (FAO-FIGIS 2001).


This species is important in commercial fisheries, and the harvesting sites for fisheries are mainly in Mexico in FAO fishing area 77 - from 10,000 to 50,000 t. Seines are the main method used to harvest this species. It is then processed into fishmeal, used as bait for tuna and other fishes, and occasionally canned (Whitehead and Rodríguez-Sánchez 1995).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no known conservation measures for this species. However, this species' distribution includes a number of Marine Protected Areas in the tropical eastern Pacific region. Monitoring of harvest levels and the population trend are recommended for this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; bait: usually
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

There are no known adverse effects of Engraulis mordax on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Northern anchovies support a number of commercial fisheries and live-bait fisheries in the United States, Canada, and Mexico. They are commonly consumed by humans and are sold live to anglers as bait. They are often converted into feed for fish hatcheries and farms and are a source of industrial fish meal and oil. From 1916 to 1967, catches averaged 325 metric tons per year. Total population biomass for northern anchovies was estimated to be 432,000 tons in 1994. Currently, California does not have an active fishery for this species.

Positive Impacts: food ; source of medicine or drug ; produces fertilizer

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Californian anchovy

Engraulis mordax[1] , the California anchovy or Northern anchovy, is a species of anchovy found in the Pacific Ocean, ranging from Mexico to British Columbia.[2]

Commercial Fishing [edit]

As sardine populations declined in the Pacific during the 1940's and 50's, fish packers in America started canning the more abundant local anchovies. Total hauls increased over this time from 960 tons in 1946 to 9,464 tons in 1947 and peaking at almost 43,000 tons in 1953. From 1949 to 1955, they were restricted for all uses but bait fish in California.[3] In 2010, reported American hauls totaled 2,100 metric tons. Most Californian anchovies today are fished for use in animal feed and as bait fish.[4]

References [edit]

  1. ^ "Engraulis mordax". The IUCN Red List of Threatened Species. International Union for Conservation of Nature and Natural Resources. Retrieved 6 September 2012. 
  2. ^ "Seafood Handbook - Anchovy". SeafoodSource.com. 
  3. ^ "Engraulis mordax". The IUCN Red List of Threatened Species. International Union for Conservation of Nature and Natural Resources. Retrieved 6 September 2012. 
  4. ^ "Northern Anchovy". NOAA FishWatch. Retrieved 6 September 2012. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!