Overview

Comprehensive Description

Biology

Occurs in large schools near the surface, mainly in coastal waters but as far out as over 1,000 km from the shore. Tends to move more northward and inshore in spring and summer. Juveniles associate with drifting seaweed (Ref. 12114, 12115). Feeds on copepods, but also on other small crustaceans, molluscan larvae, fish eggs and larvae and diatoms. Marketed fresh and salted, processed into fishmeal and oil (Ref. 12484).
  • Whitehead, P.J.P., G.J. Nelson and T. Wongratana 1988 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (Suborder Clupeoidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/2):305-579. Rome: FAO. (Ref. 189)   http://www.fishbase.org/references/FBRefSummary.php?id=189&speccode=4 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Gazi Bay, Kenya, Mauritius, Mozambique, North Pacific, South Africa (country), Tanzania
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Pacific: southern Sakhalin Islands, Sea of Japan and Pacific coasts of Japan, and south to almost Canton/Taiwan; rare records (seems to represent stray fishes) off the coasts of Luzon and Western Mindanao, Philippines and from Manado and Ujung Pandang, Sulawesi, Indonesia (Ref. 189).
  • Whitehead, P.J.P., G.J. Nelson and T. Wongratana 1988 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (Suborder Clupeoidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/2):305-579. Rome: FAO. (Ref. 189)   http://www.fishbase.org/references/FBRefSummary.php?id=189&speccode=4 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Pacific; western Indian Ocean may be a separate species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 12 - 14; Analspines: 0; Analsoft rays: 13 - 18
  • Whitehead, P.J.P., G.J. Nelson and T. Wongratana 1988 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (Suborder Clupeoidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/2):305-579. Rome: FAO. (Ref. 189)   http://www.fishbase.org/references/FBRefSummary.php?id=189&speccode=4 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 160 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

18.0 cm TL (male/unsexed; (Ref. 56527)); max. published weight: 45.0 g (Ref. 56527); max. reported age: 4 years (Ref. 56527)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Differs very little from the European anchovy (see E. encrasicolus) and can be identified from that description. Of other anchovies found in the southern part of its distribution, only species of Encrasicholina and Stolephorus are of similar appearance, but all have small spine-like pre-pelvic scutes (usually 2 to 7 scutes). Thryssa have compressed bodies and a keel of scutes along belly.
  • Whitehead, P.J.P., G.J. Nelson and T. Wongratana 1988 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (Suborder Clupeoidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/2):305-579. Rome: FAO. (Ref. 189)   http://www.fishbase.org/references/FBRefSummary.php?id=189&speccode=4 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

pelagic-neritic; oceanodromous (Ref. 51243); marine; depth range 0 - 400 m (Ref. 50550)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 230 specimens in 2 taxa.
Water temperature and chemistry ranges based on 66 samples.

Environmental ranges
  Depth range (m): 20 - 407
  Temperature range (°C): 8.140 - 18.855
  Nitrate (umol/L): 1.823 - 22.399
  Salinity (PPS): 34.593 - 35.361
  Oxygen (ml/l): 3.463 - 5.408
  Phosphate (umol/l): 0.496 - 1.687
  Silicate (umol/l): 4.542 - 17.735

Graphical representation

Depth range (m): 20 - 407

Temperature range (°C): 8.140 - 18.855

Nitrate (umol/L): 1.823 - 22.399

Salinity (PPS): 34.593 - 35.361

Oxygen (ml/l): 3.463 - 5.408

Phosphate (umol/l): 0.496 - 1.687

Silicate (umol/l): 4.542 - 17.735
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 200m.
Recorded at 200 meters.

Habitat: pelagic. Occurs in large schools near the surface, mainly in coastal waters but as far out as over 1,000 km from the shore. Tends to move more northward and inshore in spring and summer. Juveniles associate with drifting seaweed (Ref. 12114, 12115). Feeds on copepods, but also on other small crustaceans, molluscan larvae, fish eggs and larvae and diatoms. Spawns throughout the year. Matures mainly during the second year. Eggs are ellipsoidal, hatching in about 30 hrs. at 20-25°C, or 48 hrs. at 18°C.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Occurs near the surface, mainly coastal, but to over 1000 km from the shore, forming large schools, tending to move northward and inshore (into bays and inlets) in spring and summer, but without well-defined migrations. Feeds on plants and zooplankton (Ref. 5398). Also in Ref. 9137. Young fish feed on zooplankton such as copepod and adults on phytoplankton (Ref. 39882). Employs both filter- and particular-feeding modes on zooplankton (Ref. 42392).
  • Whitehead, P.J.P., G.J. Nelson and T. Wongratana 1988 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (Suborder Clupeoidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/2):305-579. Rome: FAO. (Ref. 189)   http://www.fishbase.org/references/FBRefSummary.php?id=189&speccode=4 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Known predators

Engraulis japonicus (Engraulis japonica (adult)) is prey of:
Trachiurus japonica
Engraulis japonicus
Todarodes pacificus
Scomber japonicus
Homo sapiens

Based on studies in:
Japan (Brackish water, epipelagic zone)

This list may not be complete but is based on published studies.
  • K. Hogetsu, Biological productivity of some coastal regions of Japan. In: Marine Production Mechanisms, M. J. Dunbar, Ed. (International Biological Programme Series, no. 20, Cambridge Univ. Press, Cambridge, England, 1979), pp. 71-87, from p. 74.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Engraulis japonicus (Engraulis japonica (adult)) preys on:
Calanus pacificus
Paracalanus parvus
Engraulis japonicus

Based on studies in:
Japan (Brackish water, epipelagic zone)

This list may not be complete but is based on published studies.
  • K. Hogetsu, Biological productivity of some coastal regions of Japan. In: Marine Production Mechanisms, M. J. Dunbar, Ed. (International Biological Programme Series, no. 20, Cambridge Univ. Press, Cambridge, England, 1979), pp. 71-87, from p. 74.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Engraulis japonicus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGGCAATTACACGTTGATTTTTCTCAACAAATCACAAAGACATTGGCACCCTATATCTTATTTTCGGTGCCTGAGCAGGAATGGTAGGGACAGCACTTAGCCTCCTTATTCGAGCAGAACTAAGCCAACCAGGAGCACTCCTGGGGGACGATCAAATTTATAACGTAATCGTTACTGCTCACGCATTCGTAATAATCTTTTTTATGGTAATGCCCATCCTAATCGGTGGGTTCGGGAATTGATTGGTTCCTCTTATACTAGGGGCCCCAGACATGGCATTCCCCCGAATGAACAATATGAGCTTTTGACTCCTTCCCCCTTCTTTCCTTCTCCTCTTAGCATCATCTGGTGTTGAAGCAGGAGCCGGGACAGGATGAACAGTCTACCCCCCTCTAGCAGGAAACCTTGCCCACGCCGGAGCGTCAGTAGATTTAACAATCTTCTCTCTTCACCTGGCAGGGATTTCATCAATCCTAGGTGCCATTAATTTCATTACTACCATCATTAATATGAAACCACCTGCTATTTCACAATACCAGACACCTCTATTTGTCTGAGCTGTATTAATCACGGCAGTACTTTTACTTCTTTCACTACCCGTTCTAGCTGCTGGGATTACTATGCTTCTTACAGACCGAAACCTAAATACTACTTTCTTCGACCCAGCAGGGGGAGGAGACCCAATTCTTTATCAACACCTATTCTGATTCTTCGGGCACCCCGAAGTCTATATTCTTATTCTTCCCGGATTCGGGATGATCTCCCACATTGTAGCTTACTACGCCGGTAAAAAGGAACCTTTCGGGTACATGGGTATGGTCTGAGCTATGATGGCTATCGGACTACTAGGGTTCATTGTATGAGCCCACCACATGTTCACAGTTGGTATGGACGTAGACACTCGAGCATACTTCACATCTGCAACAATGATTATTGCCATCCCCACAGGAGTAAAAGTCTTTAGCTGACTCGCCACCCTGCACGGAGGGGCTATTAAGTGAGAAACCCCTATGCTTTGAGCACTAGGCTTTATCTTCTTATTTACAGTCGGCGGTCTAACAGGTATTGTTCTAGCGAATTCATCTCTAGACATTGTTCTCCATGACACATACTATGTAGTAGCACACTTCCACTACGTCCTCTCAATGGGTGCAGTATTTGCCATCGTTGCAGGATTTGTGCACTGATTCCCGCTATTTACAGGATACACCCTTCACAGCACCTGAACAAAAATCCACTTTGGTGTTATGTTCGTGGGGGTAAATCTTACATTCTTCCCTCAACACTTCCTAGGACTAGCAGGAATGCCTCGACGGTACTCCGACTACCCAGACGCGTACACTCTTTGAAACACAGTATCCTCAATCGGCTCTCTAATCTCCCTTGTCGCAGTAATTATGTTCTTGTTTATTATTTGAGAAGCATTCGCCGCCAAACGAGAAGTAGCATCAGTAGAGCTAACTATTACTAACGTAGAATGACTTCACGGATGCCCTCCCCCTTATCACACCTTTGAGGAACCAGCTTTCGTTCAAGTTAAATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Engraulis japonicus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 14
Specimens with Barcodes: 20
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: highly commercial; aquaculture: commercial; bait: usually; price category: low; price reliability: reliable: based on ex-vessel price for this species
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Japanese anchovy

Japanese anchovy (Engraulis japonicus) is a schooling fish of the family Engraulidae. It is common in the Pacific Ocean south from the Sea of Okhotsk, widespread in the Sea of Japan, Yellow Sea, and East China Sea, and near the coasts of Japan. They live up to 2–3 years, similar to European anchovy. They spawn from Taiwan to southern Sakhalin.

Dried Japanese Anchovy (Engraulis japonica) at the market

Source

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!