Table of Contents
Overview
Comprehensive Description
Biology
Occurs in large schools near the surface, mainly in coastal waters but as far out as over 1,000 km from the shore. Tends to move more northward and inshore in spring and summer. Juveniles associate with drifting seaweed (Ref. 12114, 12115). Feeds on copepods, but also on other small crustaceans, molluscan larvae, fish eggs and larvae and diatoms. Marketed fresh and salted, processed into fishmeal and oil (Ref. 12484).
-
Whitehead, P.J.P., G.J. Nelson and T. Wongratana 1988 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (Suborder Clupeoidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/2):305-579. Rome: FAO. (Ref. 189)
http://www.fishbase.org/references/FBRefSummary.php?id=189&speccode=4
© FishBase
Source:
FishBase
Trusted
Distribution
Gazi Bay, Kenya, Mauritius, Mozambique, North Pacific, South Africa (country), Tanzania
-
Anon. (2000). FishBase 2000 [CD-ROM]. ICLARM: Los Baños, Laguna, Philippines. 4 cd-roms pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=6542
-
Gillespie, G. E. 1993. An updated list of the fishes of British Columbia, and those of interest in adjacent waters, with numeric code designations. Can. Tech. Rep. Fish. Aquat. Sci. 1918: 116 p.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=155121
-
Hemminga, M.A.; Gwada, P.; Slim, F.J.; Dekoeyer, P.; Kazungu, J. (1995). Leaf production and nutrient contents of the seagrass Thalassodendron ciliatum in the proximity of a mangrove forest (Gazibay, Kenya). Aquat. Bot. 50(2): 159-170.
http://www.vliz.be/vmdcdata/mangroves/aphia.php?p=sourcedetails&id=166297
-
Huxham, Mark, Kimani, E and Augley, J (2004) Mangrove fish: a comparison of community structure between forested and cleared habitats. Estuarine Coastal and Shelf Science, 60 (4). pp. 637-647.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=166298
© WoRMS for SMEBD
Source:
World Register of Marine Species
Trusted
Western Pacific: southern Sakhalin Islands, Sea of Japan and Pacific coasts of Japan, and south to almost Canton/Taiwan; rare records (seems to represent stray fishes) off the coasts of Luzon and Western Mindanao, Philippines and from Manado and Ujung Pandang, Sulawesi, Indonesia (Ref. 189).
-
Whitehead, P.J.P., G.J. Nelson and T. Wongratana 1988 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (Suborder Clupeoidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/2):305-579. Rome: FAO. (Ref. 189)
http://www.fishbase.org/references/FBRefSummary.php?id=189&speccode=4
© FishBase
Source:
FishBase
Trusted
Western Pacific; western Indian Ocean may be a separate species.
© FishWise Professional
Source:
FishWise Professional
Trusted
Physical Description
Morphology
Dorsal spines (total): 0; Dorsal soft rays (total): 12 - 14; Analspines: 0; Analsoft rays: 13 - 18
-
Whitehead, P.J.P., G.J. Nelson and T. Wongratana 1988 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (Suborder Clupeoidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/2):305-579. Rome: FAO. (Ref. 189)
http://www.fishbase.org/references/FBRefSummary.php?id=189&speccode=4
© FishBase
Source:
FishBase
Trusted
Size
Max. size
18.0 cm TL (male/unsexed; (Ref. 56527)); max. published weight: 45.0 g (Ref. 56527); max. reported age: 4 years (Ref. 56527)
-
Fadeev, N.S. 2005 Guide to biology and fisheries of fishes of the North Pacific Ocean. Vladivostok, TINRO-Center. 366 p. (Ref. 56527)
http://www.fishbase.org/references/FBRefSummary.php?id=56527&speccode=50376
© FishBase
Source:
FishBase
Trusted
Diagnostic Description
Differs very little from the European anchovy (see E. encrasicolus) and can be identified from that description. Of other anchovies found in the southern part of its distribution, only species of Encrasicholina and Stolephorus are of similar appearance, but all have small spine-like pre-pelvic scutes (usually 2 to 7 scutes). Thryssa have compressed bodies and a keel of scutes along belly.
-
Whitehead, P.J.P., G.J. Nelson and T. Wongratana 1988 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (Suborder Clupeoidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/2):305-579. Rome: FAO. (Ref. 189)
http://www.fishbase.org/references/FBRefSummary.php?id=189&speccode=4
© FishBase
Source:
FishBase
Trusted
Ecology
Habitat
Environment
pelagic-neritic; oceanodromous (Ref. 51243); marine; depth range 0 - 400 m (Ref. 50550)
-
Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
http://www.fishbase.org/references/FBRefSummary.php?id=51243&speccode=4683
-
Fedorov, V.V., I.A. Chereshnev, M.V. Nazarkin, A.V. Shestakov and V.V. Volobuev 2003 Catalog of marine and freswater fishes of the northern part of the Sea of Okhotsk. Vladivostok: Dalnauka, 2003. 204 p. (Ref. 50550)
http://www.fishbase.org/references/FBRefSummary.php?id=50550&speccode=4633
© FishBase
Source:
FishBase
Trusted
Depth range based on 230 specimens in 2 taxa.
Water temperature and chemistry ranges based on 66 samples.
Environmental ranges
Depth range (m): 20 - 407
Temperature range (°C): 8.140 - 18.855
Nitrate (umol/L): 1.823 - 22.399
Salinity (PPS): 34.593 - 35.361
Oxygen (ml/l): 3.463 - 5.408
Phosphate (umol/l): 0.496 - 1.687
Silicate (umol/l): 4.542 - 17.735
Graphical representation
Depth range (m): 20 - 407
Temperature range (°C): 8.140 - 18.855
Nitrate (umol/L): 1.823 - 22.399
Salinity (PPS): 34.593 - 35.361
Oxygen (ml/l): 3.463 - 5.408
Phosphate (umol/l): 0.496 - 1.687
Silicate (umol/l): 4.542 - 17.735
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 66 samples.
Environmental ranges
Depth range (m): 20 - 407
Temperature range (°C): 8.140 - 18.855
Nitrate (umol/L): 1.823 - 22.399
Salinity (PPS): 34.593 - 35.361
Oxygen (ml/l): 3.463 - 5.408
Phosphate (umol/l): 0.496 - 1.687
Silicate (umol/l): 4.542 - 17.735
Graphical representation
Depth range (m): 20 - 407
Temperature range (°C): 8.140 - 18.855
Nitrate (umol/L): 1.823 - 22.399
Salinity (PPS): 34.593 - 35.361
Oxygen (ml/l): 3.463 - 5.408
Phosphate (umol/l): 0.496 - 1.687
Silicate (umol/l): 4.542 - 17.735
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Depth: 0 - 200m.
Recorded at 200 meters.
Habitat: pelagic. Occurs in large schools near the surface, mainly in coastal waters but as far out as over 1,000 km from the shore. Tends to move more northward and inshore in spring and summer. Juveniles associate with drifting seaweed (Ref. 12114, 12115). Feeds on copepods, but also on other small crustaceans, molluscan larvae, fish eggs and larvae and diatoms. Spawns throughout the year. Matures mainly during the second year. Eggs are ellipsoidal, hatching in about 30 hrs. at 20-25°C, or 48 hrs. at 18°C.
Recorded at 200 meters.
Habitat: pelagic. Occurs in large schools near the surface, mainly in coastal waters but as far out as over 1,000 km from the shore. Tends to move more northward and inshore in spring and summer. Juveniles associate with drifting seaweed (Ref. 12114, 12115). Feeds on copepods, but also on other small crustaceans, molluscan larvae, fish eggs and larvae and diatoms. Spawns throughout the year. Matures mainly during the second year. Eggs are ellipsoidal, hatching in about 30 hrs. at 20-25°C, or 48 hrs. at 18°C.
© FishWise Professional
Source:
FishWise Professional
Trusted
Migration
Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
-
Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
http://www.fishbase.org/references/FBRefSummary.php?id=51243&speccode=4683
© FishBase
Source:
FishBase
Trusted
Trophic Strategy
Occurs near the surface, mainly coastal, but to over 1000 km from the shore, forming large schools, tending to move northward and inshore (into bays and inlets) in spring and summer, but without well-defined migrations. Feeds on plants and zooplankton (Ref. 5398). Also in Ref. 9137. Young fish feed on zooplankton such as copepod and adults on phytoplankton (Ref. 39882). Employs both filter- and particular-feeding modes on zooplankton (Ref. 42392).
-
Whitehead, P.J.P., G.J. Nelson and T. Wongratana 1988 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (Suborder Clupeoidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/2):305-579. Rome: FAO. (Ref. 189)
http://www.fishbase.org/references/FBRefSummary.php?id=189&speccode=4
© FishBase
Source:
FishBase
Trusted
Associations
Known predators
Engraulis japonicus (Engraulis japonica (adult)) is prey of:
Trachiurus japonica
Engraulis japonicus
Todarodes pacificus
Scomber japonicus
Homo sapiens
Based on studies in:
Japan (Brackish water, epipelagic zone)
This list may not be complete but is based on published studies.
Trachiurus japonica
Engraulis japonicus
Todarodes pacificus
Scomber japonicus
Homo sapiens
Based on studies in:
Japan (Brackish water, epipelagic zone)
This list may not be complete but is based on published studies.
- K. Hogetsu, Biological productivity of some coastal regions of Japan. In: Marine Production Mechanisms, M. J. Dunbar, Ed. (International Biological Programme Series, no. 20, Cambridge Univ. Press, Cambridge, England, 1979), pp. 71-87, from p. 74.
© SPIRE project
Source:
SPIRE
Trusted
Known prey organisms
Engraulis japonicus (Engraulis japonica (adult)) preys on:
Calanus pacificus
Paracalanus parvus
Engraulis japonicus
Based on studies in:
Japan (Brackish water, epipelagic zone)
This list may not be complete but is based on published studies.
Calanus pacificus
Paracalanus parvus
Engraulis japonicus
Based on studies in:
Japan (Brackish water, epipelagic zone)
This list may not be complete but is based on published studies.
- K. Hogetsu, Biological productivity of some coastal regions of Japan. In: Marine Production Mechanisms, M. J. Dunbar, Ed. (International Biological Programme Series, no. 20, Cambridge Univ. Press, Cambridge, England, 1979), pp. 71-87, from p. 74.
© SPIRE project
Source:
SPIRE
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Engraulis japonicus
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There are 9 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 9 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
GTGGCAATTACACGTTGATTTTTCTCAACAAATCACAAAGACATTGGCACCCTATATCTTATTTTCGGTGCCTGAGCAGGAATGGTAGGGACAGCACTTAGCCTCCTTATTCGAGCAGAACTAAGCCAACCAGGAGCACTCCTGGGGGACGATCAAATTTATAACGTAATCGTTACTGCTCACGCATTCGTAATAATCTTTTTTATGGTAATGCCCATCCTAATCGGTGGGTTCGGGAATTGATTGGTTCCTCTTATACTAGGGGCCCCAGACATGGCATTCCCCCGAATGAACAATATGAGCTTTTGACTCCTTCCCCCTTCTTTCCTTCTCCTCTTAGCATCATCTGGTGTTGAAGCAGGAGCCGGGACAGGATGAACAGTCTACCCCCCTCTAGCAGGAAACCTTGCCCACGCCGGAGCGTCAGTAGATTTAACAATCTTCTCTCTTCACCTGGCAGGGATTTCATCAATCCTAGGTGCCATTAATTTCATTACTACCATCATTAATATGAAACCACCTGCTATTTCACAATACCAGACACCTCTATTTGTCTGAGCTGTATTAATCACGGCAGTACTTTTACTTCTTTCACTACCCGTTCTAGCTGCTGGGATTACTATGCTTCTTACAGACCGAAACCTAAATACTACTTTCTTCGACCCAGCAGGGGGAGGAGACCCAATTCTTTATCAACACCTATTCTGATTCTTCGGGCACCCCGAAGTCTATATTCTTATTCTTCCCGGATTCGGGATGATCTCCCACATTGTAGCTTACTACGCCGGTAAAAAGGAACCTTTCGGGTACATGGGTATGGTCTGAGCTATGATGGCTATCGGACTACTAGGGTTCATTGTATGAGCCCACCACATGTTCACAGTTGGTATGGACGTAGACACTCGAGCATACTTCACATCTGCAACAATGATTATTGCCATCCCCACAGGAGTAAAAGTCTTTAGCTGACTCGCCACCCTGCACGGAGGGGCTATTAAGTGAGAAACCCCTATGCTTTGAGCACTAGGCTTTATCTTCTTATTTACAGTCGGCGGTCTAACAGGTATTGTTCTAGCGAATTCATCTCTAGACATTGTTCTCCATGACACATACTATGTAGTAGCACACTTCCACTACGTCCTCTCAATGGGTGCAGTATTTGCCATCGTTGCAGGATTTGTGCACTGATTCCCGCTATTTACAGGATACACCCTTCACAGCACCTGAACAAAAATCCACTTTGGTGTTATGTTCGTGGGGGTAAATCTTACATTCTTCCCTCAACACTTCCTAGGACTAGCAGGAATGCCTCGACGGTACTCCGACTACCCAGACGCGTACACTCTTTGAAACACAGTATCCTCAATCGGCTCTCTAATCTCCCTTGTCGCAGTAATTATGTTCTTGTTTATTATTTGAGAAGCATTCGCCGCCAAACGAGAAGTAGCATCAGTAGAGCTAACTATTACTAACGTAGAATGACTTCACGGATGCCCTCCCCCTTATCACACCTTTGAGGAACCAGCTTTCGTTCAAGTTAAATAA
-- end --
-- end --
Download FASTA File
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage: Engraulis japonicus
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 14
Specimens with Barcodes: 20
Species With Barcodes: 1
Public Records: 14
Specimens with Barcodes: 20
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Conservation
Threats
Not Evaluated
-
IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
http://www.fishbase.org/references/FBRefSummary.php?id=57073
© FishBase
Source:
FishBase
Trusted
Relevance to Humans and Ecosystems
Benefits
Importance
fisheries: highly commercial; aquaculture: commercial; bait: usually; price category: low; price reliability: reliable: based on ex-vessel price for this species
-
Food and Agriculture Organization of the United Nations 1992 FAO yearbook 1990. Fishery statistics. Catches and landings. FAO Fish. Ser. (38). FAO Stat. Ser. 70:(105):647 p. (Ref. 4931)
http://www.fishbase.org/references/FBRefSummary.php?id=4931&speccode=228
-
Masuda, H., K. Amaoka, C. Araga, T. Uyeno and T. Yoshino 1984 The fishes of the Japanese Archipelago. Vol. 1. Tokai University Press, Tokyo, Japan. 437 p. (text). (Ref. 559)
http://www.fishbase.org/references/FBRefSummary.php?id=559&speccode=7
© FishBase
Source:
FishBase
Trusted
Wikipedia
Japanese anchovy
Japanese anchovy (Engraulis japonicus) is a schooling fish of the family Engraulidae. It is common in the Pacific Ocean south from the Sea of Okhotsk, widespread in the Sea of Japan, Yellow Sea, and East China Sea, and near the coasts of Japan. They live up to 2–3 years, similar to European anchovy. They spawn from Taiwan to southern Sakhalin.
Source
 | This Clupeiformes article is a stub. You can help Wikipedia by expanding it. |
Source:
Wikipedia
Unreviewed
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!
