Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Occurs in large schools near the surface, mainly in coastal waters but as far out as over 1,000 km from the shore. Tends to move more northward and inshore in spring and summer. Juveniles associate with drifting seaweed (Ref. 12114, 12115). Feeds on copepods, but also on other small crustaceans, molluscan larvae, fish eggs and larvae and diatoms. Marketed fresh and salted, processed into fishmeal and oil (Ref. 12484).
  • Whitehead, P.J.P., G.J. Nelson and T. Wongratana 1988 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (Suborder Clupeoidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/2):305-579. Rome: FAO. (Ref. 189)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Western Pacific: southern Sakhalin Islands, Sea of Japan and Pacific coasts of Japan, and south to almost Canton/Taiwan; rare records (seems to represent stray fishes) off the coasts of Luzon and Western Mindanao, Philippines and from Manado and Ujung Pandang, Sulawesi, Indonesia (Ref. 189).
  • Whitehead, P.J.P., G.J. Nelson and T. Wongratana 1988 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (Suborder Clupeoidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/2):305-579. Rome: FAO. (Ref. 189)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Pacific; western Indian Ocean may be a separate species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 12 - 14; Analspines: 0; Analsoft rays: 13 - 18
  • Whitehead, P.J.P., G.J. Nelson and T. Wongratana 1988 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (Suborder Clupeoidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/2):305-579. Rome: FAO. (Ref. 189)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 160 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

18.0 cm TL (male/unsexed; (Ref. 56527)); max. published weight: 45.0 g (Ref. 56527); max. reported age: 4 years (Ref. 56527)
  • Fadeev, N.S. 2005 Guide to biology and fisheries of fishes of the North Pacific Ocean. Vladivostok, TINRO-Center. 366 p. (Ref. 56527)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Differs very little from the European anchovy (see E. encrasicolus) and can be identified from that description. Of other anchovies found in the southern part of its distribution, only species of Encrasicholina and Stolephorus are of similar appearance, but all have small spine-like pre-pelvic scutes (usually 2 to 7 scutes). Thryssa have compressed bodies and a keel of scutes along belly.
  • Whitehead, P.J.P., G.J. Nelson and T. Wongratana 1988 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (Suborder Clupeoidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/2):305-579. Rome: FAO. (Ref. 189)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

pelagic-neritic; oceanodromous (Ref. 51243); marine; depth range 0 - 400 m (Ref. 50550)
  • Fedorov, V.V., I.A. Chereshnev, M.V. Nazarkin, A.V. Shestakov and V.V. Volobuev 2003 Catalog of marine and freswater fishes of the northern part of the Sea of Okhotsk. Vladivostok: Dalnauka, 2003. 204 p. (Ref. 50550)
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 230 specimens in 2 taxa.
Water temperature and chemistry ranges based on 66 samples.

Environmental ranges
  Depth range (m): 20 - 407
  Temperature range (°C): 8.140 - 18.855
  Nitrate (umol/L): 1.823 - 22.399
  Salinity (PPS): 34.593 - 35.361
  Oxygen (ml/l): 3.463 - 5.408
  Phosphate (umol/l): 0.496 - 1.687
  Silicate (umol/l): 4.542 - 17.735

Graphical representation

Depth range (m): 20 - 407

Temperature range (°C): 8.140 - 18.855

Nitrate (umol/L): 1.823 - 22.399

Salinity (PPS): 34.593 - 35.361

Oxygen (ml/l): 3.463 - 5.408

Phosphate (umol/l): 0.496 - 1.687

Silicate (umol/l): 4.542 - 17.735
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 200m.
Recorded at 200 meters.

Habitat: pelagic. Occurs in large schools near the surface, mainly in coastal waters but as far out as over 1,000 km from the shore. Tends to move more northward and inshore in spring and summer. Juveniles associate with drifting seaweed (Ref. 12114, 12115). Feeds on copepods, but also on other small crustaceans, molluscan larvae, fish eggs and larvae and diatoms. Spawns throughout the year. Matures mainly during the second year. Eggs are ellipsoidal, hatching in about 30 hrs. at 20-25°C, or 48 hrs. at 18°C.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Occurs near the surface, mainly coastal, but to over 1000 km from the shore, forming large schools, tending to move northward and inshore (into bays and inlets) in spring and summer, but without well-defined migrations. Feeds on plants and zooplankton (Ref. 5398). Also in Ref. 9137. Young fish feed on zooplankton such as copepod and adults on phytoplankton (Ref. 39882). Employs both filter- and particular-feeding modes on zooplankton (Ref. 42392).
  • Whitehead, P.J.P., G.J. Nelson and T. Wongratana 1988 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (Suborder Clupeoidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/2):305-579. Rome: FAO. (Ref. 189)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Known predators

Engraulis japonicus (Engraulis japonica (adult)) is prey of:
Trachiurus japonica
Engraulis japonicus
Todarodes pacificus
Scomber japonicus
Homo sapiens

Based on studies in:
Japan (Brackish water, epipelagic zone)

This list may not be complete but is based on published studies.
  • K. Hogetsu, Biological productivity of some coastal regions of Japan. In: Marine Production Mechanisms, M. J. Dunbar, Ed. (International Biological Programme Series, no. 20, Cambridge Univ. Press, Cambridge, England, 1979), pp. 71-87, from p. 74.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Engraulis japonicus (Engraulis japonica (adult)) preys on:
Calanus pacificus
Paracalanus parvus
Engraulis japonicus

Based on studies in:
Japan (Brackish water, epipelagic zone)

This list may not be complete but is based on published studies.
  • K. Hogetsu, Biological productivity of some coastal regions of Japan. In: Marine Production Mechanisms, M. J. Dunbar, Ed. (International Biological Programme Series, no. 20, Cambridge Univ. Press, Cambridge, England, 1979), pp. 71-87, from p. 74.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Engraulis japonicus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGGCAATTACACGTTGATTTTTCTCAACAAATCACAAAGACATTGGCACCCTATATCTTATTTTCGGTGCCTGAGCAGGAATGGTAGGGACAGCACTTAGCCTCCTTATTCGAGCAGAACTAAGCCAACCAGGAGCACTCCTGGGGGACGATCAAATTTATAACGTAATCGTTACTGCTCACGCATTCGTAATAATCTTTTTTATGGTAATGCCCATCCTAATCGGTGGGTTCGGGAATTGATTGGTTCCTCTTATACTAGGGGCCCCAGACATGGCATTCCCCCGAATGAACAATATGAGCTTTTGACTCCTTCCCCCTTCTTTCCTTCTCCTCTTAGCATCATCTGGTGTTGAAGCAGGAGCCGGGACAGGATGAACAGTCTACCCCCCTCTAGCAGGAAACCTTGCCCACGCCGGAGCGTCAGTAGATTTAACAATCTTCTCTCTTCACCTGGCAGGGATTTCATCAATCCTAGGTGCCATTAATTTCATTACTACCATCATTAATATGAAACCACCTGCTATTTCACAATACCAGACACCTCTATTTGTCTGAGCTGTATTAATCACGGCAGTACTTTTACTTCTTTCACTACCCGTTCTAGCTGCTGGGATTACTATGCTTCTTACAGACCGAAACCTAAATACTACTTTCTTCGACCCAGCAGGGGGAGGAGACCCAATTCTTTATCAACACCTATTCTGATTCTTCGGGCACCCCGAAGTCTATATTCTTATTCTTCCCGGATTCGGGATGATCTCCCACATTGTAGCTTACTACGCCGGTAAAAAGGAACCTTTCGGGTACATGGGTATGGTCTGAGCTATGATGGCTATCGGACTACTAGGGTTCATTGTATGAGCCCACCACATGTTCACAGTTGGTATGGACGTAGACACTCGAGCATACTTCACATCTGCAACAATGATTATTGCCATCCCCACAGGAGTAAAAGTCTTTAGCTGACTCGCCACCCTGCACGGAGGGGCTATTAAGTGAGAAACCCCTATGCTTTGAGCACTAGGCTTTATCTTCTTATTTACAGTCGGCGGTCTAACAGGTATTGTTCTAGCGAATTCATCTCTAGACATTGTTCTCCATGACACATACTATGTAGTAGCACACTTCCACTACGTCCTCTCAATGGGTGCAGTATTTGCCATCGTTGCAGGATTTGTGCACTGATTCCCGCTATTTACAGGATACACCCTTCACAGCACCTGAACAAAAATCCACTTTGGTGTTATGTTCGTGGGGGTAAATCTTACATTCTTCCCTCAACACTTCCTAGGACTAGCAGGAATGCCTCGACGGTACTCCGACTACCCAGACGCGTACACTCTTTGAAACACAGTATCCTCAATCGGCTCTCTAATCTCCCTTGTCGCAGTAATTATGTTCTTGTTTATTATTTGAGAAGCATTCGCCGCCAAACGAGAAGTAGCATCAGTAGAGCTAACTATTACTAACGTAGAATGACTTCACGGATGCCCTCCCCCTTATCACACCTTTGAGGAACCAGCTTTCGTTCAAGTTAAATAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Engraulis japonicus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 15
Specimens with Barcodes: 21
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: highly commercial; aquaculture: commercial; bait: usually; price category: low; price reliability: reliable: based on ex-vessel price for this species
  • Food and Agriculture Organization of the United Nations 1992 FAO yearbook 1990. Fishery statistics. Catches and landings. FAO Fish. Ser. (38). FAO Stat. Ser. 70:(105):647 p. (Ref. 4931)
  • Masuda, H., K. Amaoka, C. Araga, T. Uyeno and T. Yoshino 1984 The fishes of the Japanese Archipelago. Vol. 1. Tokai University Press, Tokyo, Japan. 437 p. (text). (Ref. 559)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Japanese anchovy

Japanese anchovy (Engraulis japonicus) is a schooling fish of the family Engraulidae. It is common in the Pacific Ocean south from the Sea of Okhotsk, widespread in the Sea of Japan, Yellow Sea, and East China Sea, and near the coasts of Japan. They live up to 2–3 years, similar to European anchovy. They spawn from Taiwan to southern Sakhalin.

Dried Japanese Anchovy (Engraulis japonica) at the market

Source[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!