Overview

Comprehensive Description

Biology

Adults prefer exposed deep reefs and rocky outcroppings (Ref. 7251). Eggs are incubated orally by both parents (Ref. 240). This is the only species in the genus Apogon with mouthbrooding done by males and females (Ref. 85456).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Western Central Atlantic: southern Florida, USA and Bahamas to Venezuela; reported to reach Suriname (Ref. 13608). Eastern Central Atlantic: Gulf of Guinea. Reported from Cape Verde (Ref. 27000).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western and eastern Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 7; Dorsal soft rays (total): 9; Analspines: 2; Analsoft rays: 9
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 110 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

11.0 cm TL (male/unsexed; (Ref. 9626))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type for Chilodipterus affinis
Catalog Number: USNM 37416
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): F. Poey
Locality: Cuba, Greater Antilles, Caribbean Sea, Atlantic
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 20 - 300 m (Ref. 7321), usually 20 - 90 m (Ref. 7251)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 24 specimens in 1 taxon.
Water temperature and chemistry ranges based on 15 samples.

Environmental ranges
  Depth range (m): 2.1 - 219
  Temperature range (°C): 22.767 - 27.601
  Nitrate (umol/L): 0.424 - 4.761
  Salinity (PPS): 34.217 - 36.676
  Oxygen (ml/l): 3.782 - 4.687
  Phosphate (umol/l): 0.081 - 0.326
  Silicate (umol/l): 1.759 - 5.012

Graphical representation

Depth range (m): 2.1 - 219

Temperature range (°C): 22.767 - 27.601

Nitrate (umol/L): 0.424 - 4.761

Salinity (PPS): 34.217 - 36.676

Oxygen (ml/l): 3.782 - 4.687

Phosphate (umol/l): 0.081 - 0.326

Silicate (umol/l): 1.759 - 5.012
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 20 - 300m.
From 20 to 300 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Biparental mouthbrooders (Ref. 240, 58875). Spawning may occur throughout the year (Ref. 39366). Distinct pairing during courtship and spawning (Ref. 205). This is the only species in the genus Apogon with mouthbrooding done by males and females (Ref. 85456).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Apogon affinis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Apogon affinis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTGGTATTCGGTGCCTGAGCTGGAATGATCGGAACGGCCCTCAGCCTACTCATTCGAGCAGAATTAAGCCAGCCTGGGGCTCTCCTTGGCGACGACCAAATCTACAACGTAATTGTTACAGCGCATGCCTTCGTAATGATTTTCTTTATAGTAATGCCAATCATGATTGGAGGCTTCGGAAACTGACTAATCCCACTAATGATTGGGGCCCCTGACATAGCATTCCCCCGAATGAACAATATGAGCTTCTGACTTCTCCCTCCCTCTTTCATTCTTCTCCTTGCCTCCTCAGGTGTGGAGGCCGGGGCAGGTACCGGGTGAACAGTTTATCCCCCTCTTGCCGGGAATCTCGCCCATGCAGGAGCCTCCGTCGATTTAACTATCTTTTCCCTCCACTTAGCCGGTATTTCCTCCATCCTTGGTGCAATTAATTTTATTACTACCATCACAAACATGAAACCTCCCGGGATTACCCAATACCAAACCCCCCTATTCGTCTGAGCTGTCCTAATCACTGCCGTCCTTCTTCTCCTGTCTCTCCCTGTCTTAGCCGCCGGAATCACAATGCTCCTCACCGACCGAAACTTAAACACGACCTTTTTCGACCCTGCAGGAGGAGGGGACCCAATCCTGTACCAGCACTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Apogon affinis

The bigtooth cardinalfish (Apogon affinis) is a species of marine fish in the Apogonidae family. It is found around the Central Atlantic. It is pale orange in colour.[1]

Range[edit]

The bigtooth cardinalfish lives in the Western Central Atlantic. Specifically it is found in southern Florida, USA and from the Bahamas to Venezuela. It has been sighted as far as Suriname. This species also is found in the Eastern Central Atlantic and the Gulf of Guinea and has been reported as far as Cape Verde.[2]

Habitat[edit]

Apogon affinis is found in coral reefs at a depth range 20 - 300 m.[3] It prefers exposed deep reefs and rocky outcroppings.[4]

References[edit]

  • Pamela Charney, Oral Brooding in the Cardinal-Fishes Phaeoptyx conklini and Apogon maculatus from the Bahamas, Copeia, Vol. 1976, No. 1 (Mar. 12, 1976), pp. 198-200.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!