Overview

Comprehensive Description

Biology

Inhabits shallow reefs or rocky areas. Found in loose aggregations (Ref. 9710). Mainly diurnal. Ingests sand when feeding on algae (Ref. 13442). The spine on both sides of the caudal peduncle may inflict painful wounds (Ref. 5217). Minimum depth reported from Ref. 27115. Larvae are planktonic (Ref. 47377). At Fernando de Noronha Archipelago in southwestern Atlantic, juveniles hold cleaning stations together with the blue tang (Acanthurus coeruleus) and sergeant major (Abudefduf saxatilis) and graze algae as well as pick molted skin and parasites from green turtles (Chelonia mydas). This behavior is preceded by a characteristic inspection usually followed by feeding nips on the turtles’ skin (head, limbs, and tail), as well as on the carapace. The most inspected and cleaned body parts are the flippers (Ref. 51385).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Western Atlantic: Massachusetts (USA), Bermuda, and the northern Gulf of Mexico to São Paulo, Brazil. Eastern Atlantic: Senegal.
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Acanthurus chirurgus is found from South Carolina, USA (juveniles are found to Massachusetts, it is rare north of Florida), Bermuda, and the northern Gulf of Mexico to São Paulo, Brazil. It also occurs on the tropical and subtropical coast of West Africa. Records from West Africa are probably misidentifications of A. monroviae (L. Rocha pers. comm. 2010).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic: Massachusetts (USA), Bermuda, and the northern Gulf of Mexico to São Paulo, Brazil. Eastern Atlantic: Senegal.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 9; Dorsal soft rays (total): 24 - 25; Analspines: 3; Analsoft rays: 22 - 23
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 350 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

39.0 cm TL (male/unsexed; (Ref. 47377)); max. published weight: 5,100 g (Ref. 40637)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Caudal fin slightly emarginate (Ref. 13442). Body gray, with 10 well-spaced, narrow, darker gray vertical bars on side (Ref. 26938).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Acanthurus chirurgus inhabits coral reefs and inshore rocky areas with sand and deep sponge bottoms from 2-70 m. Juveniles use seagrass beds and mangroves as nurseries. It grazes on many species of benthic algae, occasionally on seagrass. It also feeds on the film of algae on the surface of sand undisturbed by surge. Contents of digestive tract includes from 25 to 75% inorganic material, including sand and gravel to 5 mm diameter, Halimeda fragments and sponge spicules. In Abrolhos Bank eastern Brazil, it was recorded to have foraged more frequently over sand bottoms (Francino-Filho et al. 2009).

Pelagic larval stage duration range from 45 to 71 days (M. Bergenius in Rocha et al. 2002), it then settles on reefs when 26.9 mm (Robertson 1992). In Bermuda, juveniles settle onto lagoonal reefs and migrate to the outer reefs as adults (Mutz 2006). The sexes are separate among the acanthurids and there is no evidence of sexual dimorphism. First maturity is at about 17 cm (FL) (Reeson, 1983).

Growth

A. chirurgus displays the highly characterized pattern of asymptotic growth. Terminal size was reached at around age four, and most of the growth occurred within the first 10% of the lifespan, and approximately 85% of somatic size was attained within the first year. The mean maximum age fluctuated from 7 years in Belize to 16 years in Bermuda with a maximum longevity of 30 years in Bermuda (Mutz 2006). Maximum age recorded from San Blas was 13 years (Choat and Robertson 2002). This species has high turnover rates (J.H. Choat pers. comm. 2010).

There are strongly contrasting patterns of habitat variation in demography at five sites studied by Robertson et al. (2005a): In most locations fish settle inshore, grow to about asymptotic size and then, when two to six years old, relocate permanently to outer reefs, where they can reach 30 years. At Venezuela, fish grow very rapidly and do not show asymptotic growth but have shorter life spans of 16 years.

Cleaning Behaviour

At Fernando de Noronha Archipelago in southwestern Atlantic, juveniles hold cleaning stations together with the Blue Tang (Acanthurus coeruleus) and Sergeant Major (Abudefduf saxatilis) and graze algae as well as pick molted skin and parasites from Green Turtles (Chelonia mydas). This behaviour is preceded by a characteristic inspection usually followed by feeding nips on the turtles' skin (head, limbs, and tail), as well as on the carapace. The most inspected and cleaned body parts are the flippers (Sazima et al. 2004).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

reef-associated; marine; depth range 2 - 25 m (Ref. 7345), usually 2 - 15 m (Ref. 27115)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 1374 specimens in 1 taxon.
Water temperature and chemistry ranges based on 928 samples.

Environmental ranges
  Depth range (m): 0 - 800
  Temperature range (°C): 23.535 - 28.503
  Nitrate (umol/L): 0.024 - 3.505
  Salinity (PPS): 34.217 - 37.169
  Oxygen (ml/l): 4.285 - 4.899
  Phosphate (umol/l): 0.026 - 0.344
  Silicate (umol/l): 0.805 - 5.080

Graphical representation

Depth range (m): 0 - 800

Temperature range (°C): 23.535 - 28.503

Nitrate (umol/L): 0.024 - 3.505

Salinity (PPS): 34.217 - 37.169

Oxygen (ml/l): 4.285 - 4.899

Phosphate (umol/l): 0.026 - 0.344

Silicate (umol/l): 0.805 - 5.080
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 2 - 25m.
From 2 to 25 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Inhabits shallow reefs or rocky areas. Found in loose aggregations (Ref. 9710). Mainly diurnal. Ingests sand when feeding on algae (Ref. 13442). The spine on both sides of the caudal peduncle may inflict painful wounds (Ref. 5217). Minimum depth reported from Ref. 27115. Also cleaned by Thalassoma noronhanum observed at Fernando de Noronha Archipelago off northeastern Brazil (Ref. 36301), by Elacatinus figaro observed off the coast of São Paulo, southeastern Brazil (Ref. 40102), and by Pomacanthus paru observed at the reefs of the Abrolhos Archipelago, off eastern Brazil (Ref. 40094).Showed selection for sand and chlorophytes (Ref. 55789). Roving herbivore (Ref. 57616). Also Ref. 33499.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Acanthurus chirurgus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 27
Specimens with Barcodes: 50
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Acanthurus chirurgus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 23 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATTTAGTATTTGGTGCTTGAGCTGGGATAGTAGGAACGGCTTTAAGCCTTCTAATCCGAGCAGAATTAAGCCAACCAGGCGCCCTCCTAGGGGATGACCAGATTTATAATGTAATTGTTACAGCACATGCTTTCGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGTGGATTTGGAAACTGATTAATTCCACTAATGATTGGARCCCCCGACATAGCATTTCCACGAATAAACAATATGAGCTTCTGACTCCTGCCACCATCTTTCCTACTCCTACTTGCATCTTCTGCAGTAGAATCTGGTGCTGGTACAGGATGAACAGTTTACCCCCCTCTAGCTGGTAATCTAGCACACGCAGGAGCATCTGTAGACCTAACTATTTTCTCCCTTCACCTTGCAGGTATTTCCTCAATTCTTGGAGCTATTAATTTTATTACAACAATTATTAATATGAAACCTCCCGCTACCTCCCAATACCAAACCCCTCTATTTGTATGAGCAGTACTAATTACTGCTGTCTTACTTCTTCTCTCACTTCCTGTTCTCGCCGCTGGTATTACAATACTACTTACAGACCGAAATTTAAATACTACCTTCTTTGATCCTGCAGGCGGAGGAGATCCTATTCTGTATCAACACTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
Rocha, L.A., Myers, R., Abesamis, R., Clements, K.D., Choat, J.H., McIlwain, J., Nanola, C., Russell, B. & Stockwell, B.

Reviewer/s
Floeter, S., Edgar, G., Davidson, L. & Kulbicki, M.

Contributor/s

Justification
Acanthurus chirurgus is widely distributed in the Atlantic. It is common and abundant throughout its range. It is harvested in subsistence fisheries and is a targeted food fish in parts of its distribution. There are localized declines in areas where this species is heavily fished (Jamaica), however, there is no indication of global population declines. It is found in a number of marine protected areas in parts of its range. It is therefore listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Acanthurus chirurgus is the most abundant surgeonfish in the western Atlantic (L. Rocha pers. comm. 2010). Densities were recorded at 0.05 ind m-2 from Abrolhos Bank, eastern Brazil. It showed higher densities within the no-take area of Timbebas (Francino-Filho et al. 2009). This species had greater abundances in unfished areas than fished areas in Saba Marine Park (Netherlands Antilles) and in Hol Chan Marine Reserve, Belize (Polunin and Roberts 1993). There were order of magnitude differences in biomass among six Caribbean islands studied on which fishing pressure ranged from non existent in Bonaire, increasing through Saba, Puerto Rico, St. Lucia and Dominica and reaching very high intensities in Jamaica, with biomass declining as fishing intensity increased (Hawkins and Roberts 2004).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Acanthurus chirurgus is heavily fished in parts of its range (Haiti and Jamaica).

Surgeonfishes show varying degrees of habitat preference and utilization of coral reef habitats, with some species spending the majority of their life stages on coral reef while others primarily utilize seagrass beds, mangroves, algal beds, and /or rocky reefs. The majority of surgeonfishes are exclusively found on coral reef habitat, and of these, approximately 80% are experiencing a greater than 30% loss of coral reef area and degradation of coral reef habitat quality across their distributions. However, more research is needed to understand the long-term effects of coral reef habitat loss and degradation on these species' populations. Widespread coral reef loss and declining habitat conditions are particularly worrying for species that recruit into areas with live coral cover, especially as studies have shown that protection of pristine habitats facilitate the persistence of adult populations in species that have spatially separated adult and juvenile habitats (Comeros-Raynal et al. 2012).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species-specific conservation measures in place for this species. Its distribution overlaps several marine protected areas in parts of its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial; price category: medium; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Doctorfish tang

Acanthurus chirurgus, commonly called doctorfish or doctorfish tang in English and barbero rayado or cirujano rayado in Spanish, is a tropical marine fish common in the Atlantic Ocean.

Description[edit]

Reaching a maximum size of 39 cm and 5.1 kg, Acanthurus chirurgus gets its common name for the structures called "scalpels", which are found on either side of the caudal peduncle. The "scalpel" is used during fights with other doctorfish and as a defense mechanism against predators. Its coloration generally varies from blue-gray to dark brown. 10 to 12 vertical bars are always present, but often faint. The edges of the caudal, dorsal, and anal fins are blue. There is also a faint blue ring that can be seen encircling the "scalpel" on either side.

There is a black morph, as well, but it is neither a subspecies nor a regional mutation. It has only been documented a limited number of times.

Range and habitiat[edit]

The fish is typically found among rocky outcrops and coral reefs.

Its distribution includes the Atlantic from Massachusetts to Brazil, and the tropical west coast of Africa. It has the largest distribution of its genus of 38 species.

Off the coast of the Yucatán Peninsula

Behavior[edit]

Acanthurus chirurgus spends its daylight hours grazing on algae and organic detritus. Its teeth are specially shaped for scraping algae and plant matter from rocks. Because it swallows its food whole, it has a gizzard-like organ in the intestine filled with particles of sand which help to grind food before it starts the digestive process.

Spawning occurs during evening hours in a group event. Each egg is less than a millimeter in diameter and contains a small amount of oil for flotation. The translucent, plankton-like larvae hatch within 24 hours of fertilization. They are laterally compressed and diamond-shaped with large eyes and pectoral fins. Many body parts, such as scales and the dorsal and anal fins, do not develop until the larvae have reached 2–6 mm in length. The "scalpel" does not appear until they are about 13 mm long. As the "scalpel" grows, the anal and dorsal spines shrink. Once the fish reaches around 25 mm in length, it moves to the bottom where it continues to grow, eventually reaching sexual maturity in roughly nine months.

References[edit]

  • Acanthurus chirurgus, Doctorfish. Marinebio.org. Retrieved September 11, 2007.
  • FishBase
  • Humann, P. and N. Deloach. Reef Fish Identification - Florida, Caribbean, Bahamas. New World Publications Inc., Jacksonville. pp 34–35.
  • Rocha, L. A., et al. 2012. Acanthurus chirurgus. In: IUCN 2012. IUCN Red List of Threatened Species. Version 2012.2. Downloaded on 02 June 2013.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!