Overview
Comprehensive Description
Biology
Inhabits sandy areas of clear lagoon and seaward reefs (Ref. 9710, 48637). Occurs in pairs and use burrows as refuge. Monogamous (Ref. 52884). The burrow is shallow, only a few cm, and made under large pieces of rubble. May be found on dark volcanic sand such as those in the Philippines, Indonesia, and the northern Mariana Is. Also Ref. 58652.
-
Hoese, D.F. and H.K. Larson 1994 Revision of the Indo-Pacific gobiid fish genus Valenciennea, with descriptions of seven new species. Indo-Pac. Fish. (23):71 p. (Ref. 8527)
http://www.fishbase.org/references/FBRefSummary.php?id=8527&speccode=12606
Trusted
Distribution
Indo-Pacific: Red Sea to Samoa, north to southern Japan, south to the Great Barrier Reef and New Caledonia.
-
Hoese, D.F. and H.K. Larson 1994 Revision of the Indo-Pacific gobiid fish genus Valenciennea, with descriptions of seven new species. Indo-Pac. Fish. (23):71 p. (Ref. 8527)
http://www.fishbase.org/references/FBRefSummary.php?id=8527&speccode=12606
Trusted
Cargados Carajos, Chagos, Comores, East Africa, Madagascar, Mauritius, Red Sea, Seychelles
-
Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=5909
-
Randall, J.E. (1992). Red Sea Reef Fishes. Immel Publishing.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=6091
-
Anon. (2000). FishBase 2000 [CD-ROM]. ICLARM: Los Baños, Laguna, Philippines. 4 cd-roms pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=6542
Trusted
Red Sea, Indo-West Pacific: East Africa, Seychelles, Madagascar, Mauritius (Mascarenes) and Maldives east to Tonga and Samoa, north to southern Japan, south to Western Australia, Queensland (Australia) and New Caledonia.
Trusted
Physical Description
Morphology
Dorsal spines (total): 7; Dorsal soft rays (total): 112; Analspines: 1; Analsoft rays: 11 - 12
-
Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
http://www.fishbase.org/references/FBRefSummary.php?id=1602&speccode=4306
Trusted
Size
Max. size
20.0 cm SL (male/unsexed; (Ref. 48637))
-
Kuiter, R.H. and T. Tonozuka 2001 Pictorial guide to Indonesian reef fishes. Part 3. Jawfishes - Sunfishes, Opistognathidae - Molidae. Zoonetics, Australia. p. 623-893. (Ref. 48637)
http://www.fishbase.org/references/FBRefSummary.php?id=48637&speccode=4748
Trusted
Diagnostic Description
Description
Lives over moderately fine sands, and seems to be abundant in depths from 10 to 30 m; in sheltered areas in depths as shallow as 2 m. Occurs in pairs and use burrows as refuge. The burrow is shallow, only a few cm, and made under large pieces of rubble. May be found on dark volcanic sand such as those in the Philippines, Indonesia, and the northern Mariana Islands.
-
Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=5909
Trusted
Ecology
Habitat
Environment
reef-associated; marine; depth range 2 - 30 m (Ref. 8527), usually 10 - 30 m (Ref. 8527)
-
Hoese, D.F. and H.K. Larson 1994 Revision of the Indo-Pacific gobiid fish genus Valenciennea, with descriptions of seven new species. Indo-Pac. Fish. (23):71 p. (Ref. 8527)
http://www.fishbase.org/references/FBRefSummary.php?id=8527&speccode=12606
Trusted
Depth range based on 29 specimens in 1 taxon.
Water temperature and chemistry ranges based on 12 samples.
Environmental ranges
Depth range (m): 2 - 37
Temperature range (°C): 22.496 - 28.905
Nitrate (umol/L): 0.027 - 0.895
Salinity (PPS): 32.613 - 35.552
Oxygen (ml/l): 4.130 - 5.079
Phosphate (umol/l): 0.073 - 0.359
Silicate (umol/l): 0.906 - 5.009
Graphical representation
Depth range (m): 2 - 37
Temperature range (°C): 22.496 - 28.905
Nitrate (umol/L): 0.027 - 0.895
Salinity (PPS): 32.613 - 35.552
Oxygen (ml/l): 4.130 - 5.079
Phosphate (umol/l): 0.073 - 0.359
Silicate (umol/l): 0.906 - 5.009
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 12 samples.
Environmental ranges
Depth range (m): 2 - 37
Temperature range (°C): 22.496 - 28.905
Nitrate (umol/L): 0.027 - 0.895
Salinity (PPS): 32.613 - 35.552
Oxygen (ml/l): 4.130 - 5.079
Phosphate (umol/l): 0.073 - 0.359
Silicate (umol/l): 0.906 - 5.009
Graphical representation
Depth range (m): 2 - 37
Temperature range (°C): 22.496 - 28.905
Nitrate (umol/L): 0.027 - 0.895
Salinity (PPS): 32.613 - 35.552
Oxygen (ml/l): 4.130 - 5.079
Phosphate (umol/l): 0.073 - 0.359
Silicate (umol/l): 0.906 - 5.009
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Depth: 2 - 30m.
From 2 to 30 meters.
Habitat: reef-associated. Maiden goby. (Tomiyama, 1956) Attains 14 cm. White with diagonal orange-yellow bars or elongate spots on back ( with small fainter dots between ) and an orange-yellow band faintly edged in pale blue on side of body ( which may contain more intense spots of orange ); oblong pale blue spots on cheek and opercle. Caudal fin rounded, it's length approximately length of the head. Builds a burrow in sand under rocks by transporting mouthfuls of sand out of it's burrow. East Africa, Red Sea to Samoa and Marshall Islands.
From 2 to 30 meters.
Habitat: reef-associated. Maiden goby. (Tomiyama, 1956) Attains 14 cm. White with diagonal orange-yellow bars or elongate spots on back ( with small fainter dots between ) and an orange-yellow band faintly edged in pale blue on side of body ( which may contain more intense spots of orange ); oblong pale blue spots on cheek and opercle. Caudal fin rounded, it's length approximately length of the head. Builds a burrow in sand under rocks by transporting mouthfuls of sand out of it's burrow. East Africa, Red Sea to Samoa and Marshall Islands.
Trusted
Trophic Strategy
Inhabits sandy areas of clear lagoon and seaward reefs (Ref. 9710). Occurs in pairs and use burrows as refuge. The burrow is shallow, only a few cm, and made under large pieces of rubble. May be found on dark volcanic sand such as those in the Philippines, Indonesia, and the northern Mariana Is.
-
Lieske, E. and R. Myers 1994 Collins Pocket Guide. Coral reef fishes. Indo-Pacific & Caribbean including the Red Sea. Haper Collins Publishers, 400 p. (Ref. 9710)
http://www.fishbase.org/references/FBRefSummary.php?id=9710&speccode=13770
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Valenciennea puellaris
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 8 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 8 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
CCTCTATTTAGTATTTGGTGCCTGGGCCGGGATGGTAGGAACTGCATTAAGCCTGCTAATTCGAGCTGAGCTAAGCCAACCCGGGGCATTACTCGGCGATGACCAAATTTATAATGTAATCGTTACTGCGCATGCATTCGTAATAATTTTCTTTATAGTGATGCCAATCATGATTGGCGGCTTTGGAAATTGACTAATTCCCCTAATGATCGGAGCCCCCGATATGGCCTTTCCTCGAATGAACAATATGAGCTTCTGACTTCTACCCCCTTCTTTCCTACTACTCCTGGCCTCTTCCGGAGTTGAAGCTGGGGCTGGTACAGGATGAACCGTCTATCCCCCTCTTGCCGGGAATCTGGCCCATGCAGGAGCTTCCGTGGATCTTACCATCTTCTCCCTTCATTTAGCAGGTATCTCATCGATTCTTGGCGCAATTAACTTCATTACTACAATTTTAAATATGAAGCCCCCCGCTATTTCCCAGTATCAAACCCCTCTATTTGTGTGGGCAGTATTAATTACTGCCGTCCTTCTCCTTCTATCTCTCCCTGTACTTGCCGCCGGCATTACAATGCTTCTTACAGACCGAAACCTTAACACTACATTTTTCGACCCTGCAGGAGGGGGGGACCCAATCCTTTATCAACACCTA
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Valenciennea puellaris
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 12
Species With Barcodes: 1
Public Records: 8
Specimens with Barcodes: 12
Species With Barcodes: 1
Trusted
Conservation
Threats
Not Evaluated
-
IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
http://www.fishbase.org/references/FBRefSummary.php?id=57073
Trusted
Relevance to Humans and Ecosystems
Benefits
Importance
aquarium: commercial
-
Burgess, W.E., H.R. Axelrod and R.E. Hunziker III 1990 Dr. Burgess's atlas of marine aquarium fishes. T.F.H. Publications, Inc., Neptune City, New Jersey. 768 p.
http://www.fishbase.org/references/FBRefSummary.php?id=9210
Trusted
Wikipedia
Valenciennea puellaris
Valenciennea puellaris, also known as the orange spotted diamond, diamond watchman, and maiden, is a goby from the Indo-Pacific. It occasionally makes its way into the aquarium trade. It grows to a size of 20 centimetres (7.9 in) in length.
References
- Froese, Rainer, and Daniel Pauly, eds. (2008). "Valenciennea puellaris" in FishBase. December 2008 version.
| This Gobiidae-related article is a stub. You can help Wikipedia by expanding it. |
Unreviewed
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!



