Overview

Comprehensive Description

Biology

Inhabits sandy areas of clear lagoon and seaward reefs (Ref. 9710, 48637). Occurs in pairs and use burrows as refuge. Monogamous (Ref. 52884). The burrow is shallow, only a few cm, and made under large pieces of rubble. May be found on dark volcanic sand such as those in the Philippines, Indonesia, and the northern Mariana Is. Also Ref. 58652.
  • Hoese, D.F. and H.K. Larson 1994 Revision of the Indo-Pacific gobiid fish genus Valenciennea, with descriptions of seven new species. Indo-Pac. Fish. (23):71 p. (Ref. 8527)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Indo-Pacific: Red Sea to Samoa, north to southern Japan, south to the Great Barrier Reef and New Caledonia.
  • Hoese, D.F. and H.K. Larson 1994 Revision of the Indo-Pacific gobiid fish genus Valenciennea, with descriptions of seven new species. Indo-Pac. Fish. (23):71 p. (Ref. 8527)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red Sea, Indo-West Pacific: East Africa, Seychelles, Madagascar, Mauritius (Mascarenes) and Maldives east to Tonga and Samoa, north to southern Japan, south to Western Australia, Queensland (Australia) and New Caledonia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 7; Dorsal soft rays (total): 112; Analspines: 1; Analsoft rays: 11 - 12
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 170 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

20.0 cm SL (male/unsexed; (Ref. 48637))
  • Kuiter, R.H. and T. Tonozuka 2001 Pictorial guide to Indonesian reef fishes. Part 3. Jawfishes - Sunfishes, Opistognathidae - Molidae. Zoonetics, Australia. p. 623-893. (Ref. 48637)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Characterized by pale grey body color for Pacific fish with row of large orange spots on side, a series of dash-like markings below, smaller orange spots on back and blue to whitish streaks or spots on head; Indian Ocean fish with pale blue-grey body color with orange stripe across lower head, cheeks with blue markings and orange bars on side connected to pale orange stripe on lower half; third dorsal spine, longest, filamentous in juveniles under 40 mm SL; rounded caudal fin, 3.0-4.2 in SL; longitudinal scale series 79-91; ctenoid body scales, becoming cycloid anteriorly before first dorsal fin, on lower side, and midline of abdomen; head or midline of nape without scales; side of nape with scales extending forward to above middle of operculum; scaleless pectoral fin base; partly to fully scaled prepelvic area; depth of body 4.8-6.0 in SL (Ref. 90102).
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

Lives over moderately fine sands, and seems to be abundant in depths from 10 to 30 m; in sheltered areas in depths as shallow as 2 m. Occurs in pairs and use burrows as refuge. The burrow is shallow, only a few cm, and made under large pieces of rubble. May be found on dark volcanic sand such as those in the Philippines, Indonesia, and the northern Mariana Islands.
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 2 - 30 m (Ref. 8527), usually 10 - 30 m (Ref. 8527)
  • Hoese, D.F. and H.K. Larson 1994 Revision of the Indo-Pacific gobiid fish genus Valenciennea, with descriptions of seven new species. Indo-Pac. Fish. (23):71 p. (Ref. 8527)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 29 specimens in 1 taxon.
Water temperature and chemistry ranges based on 12 samples.

Environmental ranges
  Depth range (m): 2 - 37
  Temperature range (°C): 22.496 - 28.905
  Nitrate (umol/L): 0.027 - 0.895
  Salinity (PPS): 32.613 - 35.552
  Oxygen (ml/l): 4.130 - 5.079
  Phosphate (umol/l): 0.073 - 0.359
  Silicate (umol/l): 0.906 - 5.009

Graphical representation

Depth range (m): 2 - 37

Temperature range (°C): 22.496 - 28.905

Nitrate (umol/L): 0.027 - 0.895

Salinity (PPS): 32.613 - 35.552

Oxygen (ml/l): 4.130 - 5.079

Phosphate (umol/l): 0.073 - 0.359

Silicate (umol/l): 0.906 - 5.009
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 2 - 30m.
From 2 to 30 meters.

Habitat: reef-associated. Maiden goby.  (Tomiyama, 1956)  Attains 14 cm. White with diagonal orange-yellow bars or elongate spots on back ( with small fainter dots between ) and an orange-yellow band faintly edged in pale blue on side of body ( which may contain more intense spots of orange ); oblong pale blue spots on cheek and opercle. Caudal fin rounded, it's length approximately length of the head. Builds a burrow in sand under rocks by transporting mouthfuls of sand out of it's burrow. East Africa, Red Sea to Samoa and Marshall Islands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Inhabits sandy areas of clear lagoon and seaward reefs (Ref. 9710). Occurs in pairs and use burrows as refuge. The burrow is shallow, only a few cm, and made under large pieces of rubble. May be found on dark volcanic sand such as those in the Philippines, Indonesia, and the northern Mariana Is.
  • Lieske, E. and R. Myers 1994 Collins Pocket Guide. Coral reef fishes. Indo-Pacific & Caribbean including the Red Sea. Haper Collins Publishers, 400 p. (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Valenciennea puellaris

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATTTAGTATTTGGTGCCTGGGCCGGGATGGTAGGAACTGCATTAAGCCTGCTAATTCGAGCTGAGCTAAGCCAACCCGGGGCATTACTCGGCGATGACCAAATTTATAATGTAATCGTTACTGCGCATGCATTCGTAATAATTTTCTTTATAGTGATGCCAATCATGATTGGCGGCTTTGGAAATTGACTAATTCCCCTAATGATCGGAGCCCCCGATATGGCCTTTCCTCGAATGAACAATATGAGCTTCTGACTTCTACCCCCTTCTTTCCTACTACTCCTGGCCTCTTCCGGAGTTGAAGCTGGGGCTGGTACAGGATGAACCGTCTATCCCCCTCTTGCCGGGAATCTGGCCCATGCAGGAGCTTCCGTGGATCTTACCATCTTCTCCCTTCATTTAGCAGGTATCTCATCGATTCTTGGCGCAATTAACTTCATTACTACAATTTTAAATATGAAGCCCCCCGCTATTTCCCAGTATCAAACCCCTCTATTTGTGTGGGCAGTATTAATTACTGCCGTCCTTCTCCTTCTATCTCTCCCTGTACTTGCCGCCGGCATTACAATGCTTCTTACAGACCGAAACCTTAACACTACATTTTTCGACCCTGCAGGAGGGGGGGACCCAATCCTTTATCAACACCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Valenciennea puellaris

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 13
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
  • Burgess, W.E., H.R. Axelrod and R.E. Hunziker III 1990 Dr. Burgess's atlas of marine aquarium fishes. T.F.H. Publications, Inc., Neptune City, New Jersey. 768 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Valenciennea puellaris

Valenciennea puellaris, the Orange-spotted sleeper-goby, Orange-dashed goby, or Maiden goby, is a species of goby native to the Indian Ocean and the western Pacific Ocean. It inhabits lagoons and outer reefs where it occurs on sandy substrates with larger pieces of rubble to burrow under. It can reach a length of 20 centimetres (7.9 in) SL. It occasionally makes its way into the aquarium trade.[1] Its main diet is composed of zoo plankton and dead fish or insects.

References[edit]

  1. ^ Froese, Rainer and Pauly, Daniel, eds. (2013). "Valenciennea puellaris" in FishBase. June 2013 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!