Overview

Comprehensive Description

Biology

Inhabits sandy areas of clear lagoon and seaward reefs (Ref. 9710, 48637). Occurs in pairs and use burrows as refuge. Monogamous (Ref. 52884). The burrow is shallow, only a few cm, and made under large pieces of rubble. May be found on dark volcanic sand such as those in the Philippines, Indonesia, and the northern Mariana Is. Also Ref. 58652.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Indo-Pacific: Red Sea to Samoa, north to southern Japan, south to the Great Barrier Reef and New Caledonia.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cargados Carajos, Chagos, Comores, East Africa, Madagascar, Mauritius, Red Sea, Seychelles
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Red Sea, Indo-West Pacific: East Africa, Seychelles, Madagascar, Mauritius (Mascarenes) and Maldives east to Tonga and Samoa, north to southern Japan, south to Western Australia, Queensland (Australia) and New Caledonia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 7; Dorsal soft rays (total): 112; Analspines: 1; Analsoft rays: 11 - 12
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 170 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

20.0 cm SL (male/unsexed; (Ref. 48637))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Description

Lives over moderately fine sands, and seems to be abundant in depths from 10 to 30 m; in sheltered areas in depths as shallow as 2 m. Occurs in pairs and use burrows as refuge. The burrow is shallow, only a few cm, and made under large pieces of rubble. May be found on dark volcanic sand such as those in the Philippines, Indonesia, and the northern Mariana Islands.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 2 - 30 m (Ref. 8527), usually 10 - 30 m (Ref. 8527)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 29 specimens in 1 taxon.
Water temperature and chemistry ranges based on 12 samples.

Environmental ranges
  Depth range (m): 2 - 37
  Temperature range (°C): 22.496 - 28.905
  Nitrate (umol/L): 0.027 - 0.895
  Salinity (PPS): 32.613 - 35.552
  Oxygen (ml/l): 4.130 - 5.079
  Phosphate (umol/l): 0.073 - 0.359
  Silicate (umol/l): 0.906 - 5.009

Graphical representation

Depth range (m): 2 - 37

Temperature range (°C): 22.496 - 28.905

Nitrate (umol/L): 0.027 - 0.895

Salinity (PPS): 32.613 - 35.552

Oxygen (ml/l): 4.130 - 5.079

Phosphate (umol/l): 0.073 - 0.359

Silicate (umol/l): 0.906 - 5.009
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 2 - 30m.
From 2 to 30 meters.

Habitat: reef-associated. Maiden goby.  (Tomiyama, 1956)  Attains 14 cm. White with diagonal orange-yellow bars or elongate spots on back ( with small fainter dots between ) and an orange-yellow band faintly edged in pale blue on side of body ( which may contain more intense spots of orange ); oblong pale blue spots on cheek and opercle. Caudal fin rounded, it's length approximately length of the head. Builds a burrow in sand under rocks by transporting mouthfuls of sand out of it's burrow. East Africa, Red Sea to Samoa and Marshall Islands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Inhabits sandy areas of clear lagoon and seaward reefs (Ref. 9710). Occurs in pairs and use burrows as refuge. The burrow is shallow, only a few cm, and made under large pieces of rubble. May be found on dark volcanic sand such as those in the Philippines, Indonesia, and the northern Mariana Is.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Valenciennea puellaris

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATTTAGTATTTGGTGCCTGGGCCGGGATGGTAGGAACTGCATTAAGCCTGCTAATTCGAGCTGAGCTAAGCCAACCCGGGGCATTACTCGGCGATGACCAAATTTATAATGTAATCGTTACTGCGCATGCATTCGTAATAATTTTCTTTATAGTGATGCCAATCATGATTGGCGGCTTTGGAAATTGACTAATTCCCCTAATGATCGGAGCCCCCGATATGGCCTTTCCTCGAATGAACAATATGAGCTTCTGACTTCTACCCCCTTCTTTCCTACTACTCCTGGCCTCTTCCGGAGTTGAAGCTGGGGCTGGTACAGGATGAACCGTCTATCCCCCTCTTGCCGGGAATCTGGCCCATGCAGGAGCTTCCGTGGATCTTACCATCTTCTCCCTTCATTTAGCAGGTATCTCATCGATTCTTGGCGCAATTAACTTCATTACTACAATTTTAAATATGAAGCCCCCCGCTATTTCCCAGTATCAAACCCCTCTATTTGTGTGGGCAGTATTAATTACTGCCGTCCTTCTCCTTCTATCTCTCCCTGTACTTGCCGCCGGCATTACAATGCTTCTTACAGACCGAAACCTTAACACTACATTTTTCGACCCTGCAGGAGGGGGGGACCCAATCCTTTATCAACACCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Valenciennea puellaris

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Valenciennea puellaris

Valenciennea puellaris, also known as the orange spotted diamond, diamond watchman, and maiden, is a goby from the Indo-Pacific. It occasionally makes its way into the aquarium trade. It grows to a size of 20 centimetres (7.9 in) in length.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!