Overview

Comprehensive Description

Biology

Found in mangrove swamps and estuaries (Ref. 9840). Feeds on shellfish (Ref. 6871). Ovoviviparous (Ref. 50449).
  • Mould, B. 1994 A world list of rays. The scientific nomenclature and distribution of the recent Batoidea (Batoidea, Elasmobranchii, Chondrichthyes). University of Nottingham, [UK]. 82 p. (Ref. 8630)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Dasyatis fluviorum has a subtropical to tropical distribution in Australian waters from New South Wales (NSW) north to at least the central Queensland coast, and west from Cape York in Queensland to Darwin in the Northern Territory. Its occurrence north of Proserpine (around 20°30'S) to Cape York, Queensland, requires verification (Pogonoski et al. 2002, Jeff Johnson, pers. comm.). It is also recorded from southern New Guinea, off both Papua New Guinea and Indonesian Irian Jaya. Its occurrence off the northern coast of New Guinea has not been verified (Last and Stevens 1994). This species is reported from FAO Fisheries Areas 71 (Western Central Pacific) and 81 (Southwest Pacific). As well as being reported from marine and estuarine waters, it is known to ascend rivers to beyond the tidal limit (Whitley 1940). Historically, the southern extent of its range in NSW was Botany Bay and Port Jackson (33°51'S), however it has not been reported there since the 1880s (Pogonoski et al. 2002). Its southern range extent is uncertain, but may now be Forster (32°10'S) (Last and Stevens 1994). Although Gray et al. (1990) report the species from the Hawkesbury River (33º34'S), this report can not be verified (J. Pogonoski, pers. comm.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Pacific: New Guinea and from the Northern Territory to northern New South Wales in Australia.
  • Mould, B. 1994 A world list of rays. The scientific nomenclature and distribution of the recent Batoidea (Batoidea, Elasmobranchii, Chondrichthyes). University of Nottingham, [UK]. 82 p. (Ref. 8630)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Australia and New Guinea: in brackish estuaries and coastal mangroves.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Maximum size: 1300 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

130 cm TL (male/unsexed; (Ref. 9840)); max. published weight: 6,120 g (Ref. 40637)
  • IGFA 2001 Database of IGFA angling records until 2001. IGFA, Fort Lauderdale, USA. (Ref. 40637)
  • Last, P.R. and L.J.V. Compagno 1999 Dasyatididae. Stingrays. p. 1479-1505. In K.E. Carpenter and V.H. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 3. Batoid fishes, chimaeras and bony fishes part 1 (Elopidae to Linophrynidae). FAO, Rome.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is reported from mangrove-fringed rivers and estuaries, and offshore to at least 28 m depth, but more commonly in shallow inshore waters (Last and Stevens 1994, Pogonsoki et al. 2002). As well as being reported from marine and estuarine waters, it is known to ascend rivers to beyond the tidal limit (Whitley 1940). However, the species appears to be rather habitat specific, and appears to be common only at a number of suitable locations. Dasyatis fluviorum is reported to reach a disc width (DW) of 120 cm. Young are born at 11 cm DW (Last and Stevens 1994). The species is reported to be a major predator of shellfish, including farmed oysters (Whitley 1940, Last and Stevens 1994) however, detailed dietary assessments are unavailable. Individuals move over mudflats with the incoming tide to feed, and in Moreton Bay, southern Queensland, have been found to consume numerous soldier crabs (Mictyris longicarpus) (P. Kyne, pers. obs).

While published estimates of size at sexual maturity are lacking, of 12 males examined from Moreton Bay, the smallest mature individual was 45 cm DW. All individuals of greater size than this were mature. The smallest mature female from seven individuals examined was 43 cm DW (unpublished data). Sexual maturity was determined by methods outlined in Bass et al. (1973). There is no available information on the reproductive biology (including fecundity or gestational period), age and growth, natural mortality or detailed behavioural ecology of this species.

Systems
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

benthopelagic; brackish; marine
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 409 - 409
  Temperature range (°C): 14.370 - 14.370
  Nitrate (umol/L): 10.045 - 10.045
  Salinity (PPS): 35.210 - 35.210
  Oxygen (ml/l): 4.304 - 4.304
  Phosphate (umol/l): 0.816 - 0.816
  Silicate (umol/l): 6.018 - 6.018
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Found in mangrove swamps and estuaries. Feeds on shellfish.
  • Mould, B. 1994 A world list of rays. The scientific nomenclature and distribution of the recent Batoidea (Batoidea, Elasmobranchii, Chondrichthyes). University of Nottingham, [UK]. 82 p. (Ref. 8630)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Exhibit ovoviparity (aplacental viviparity), with embryos feeding initially on yolk, then receiving additional nourishment from the mother by indirect absorption of uterine fluid enriched with mucus, fat or protein through specialised structures (Ref. 50449). Distinct pairing with embrace (Ref. 205).
  • Breder, C.M. and D.E. Rosen 1966 Modes of reproduction in fishes. T.F.H. Publications, Neptune City, New Jersey. 941 p. (Ref. 205)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Dasyatis fluviorum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATTTAATCTTTGGTGCATGGGCGGGGATAGTGGGTACTGGTCTTAGTCTATTAATCCGGACAGAGTTAAGCCAACCAGGCGCATTATTGGGTGATGACCAAATCTATAATGTAATTGTTACCGCCCACGCCTTCGTAATAATTTTCTTCATGGTGATGCCAATTATAATCGGAGGGTTTGGTAATTGACTAGTTCCCTTAATAATTGGTGCTCCAGATATGGCCTTTCCCCGACTAAATAATATGAGTTTTTGACTCCTTCCCCCATCTTTCCTGCTACTCCTAGCCTCAGCGGGAGTAGAGGCCGGGGCAGGTACAGGATGAACCGTTTATCCTCCATTAGCCGGTAATCTTGCACATGCCGGGGCTTCCGTAGATCTTGCTATCTTTTCTCTCCACTTAGCCGGTATTTCCTCCATCTTGGCATCCATTAACTTTATCACAACAATTATTAATATAAAACCTCCTGCAATCTCCCAATATCAAACACCTCTTTTTGTTTGATCTATTCTTATTACAACTGTTCTCCTTTTACTATCACTTCCAGTTCTAGCAGCGGGCATTACTATGCTTCTCACAGATCGAAATCTCAACACAACTTTCTTCGACCCAGCAGGTGGAGGAGACCCTATTCTCTATCAACATCTCNNN
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Dasyatis fluviorum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A2bcd+3cd+4bcd

Version
3.1

Year Assessed
2003
  • Needs updating

Assessor/s
Kyne, P.M., Pollard, D.A. & Bennett, M.B. (SSG Australia & Oceania Regional Workshop, March 2003)

Reviewer/s
Cavanagh, R.D. (Shark Red List Authority) & Pogonoski, J.

Contributor/s

Justification
Dasyatis fluviorum is recorded from the east and north coasts of Australia and the southern coast of New Guinea. Very little is known of its biology and ecology. Once common, there is considerable anecdotal evidence of a significant range contraction and decline in abundance for this species in the waters of New South Wales and southern Queensland, Australia. Historic accounts report that D. fluviorum was an extremely common species in the bays and estuaries of southern Queensland and New South Wales. It has not been reported from Port Jackson and Botany Bay, New South Wales, where it was once common, since the 1880s and is now uncommon anywhere along the central and northern coast of New South Wales. The southern limit of the species is uncertain. The species also appears to be declining in the estuaries of southern Queensland, where it was also once common. This decline is probably the combined result of a number of threatening processes, including, bycatch in commercial fisheries, persecution by shellfish farmers, destruction of incidental catches by recreational fishers and during some commercial fishing activities, and habitat degradation and loss due to foreshore development. The species appears particularly vulnerable to such human activities due to its reliance on shallow tidal and mangrove habitats, particularly within estuaries and rivers. D. fluviorum is assessed as Vulnerable (VU A2bcd+3cd+4bcd) given its decline in range and abundance, decline in quality of habitat and continuing threats. Habitat protection, fisher education and research are priorities for its recovery.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Once common, there is considerable anecdotal evidence of a significant contraction and decline in abundance for this species in the waters of NSW and southern Queensland. A number of threatening processes can be identified as acting on the species, which have, and still are, probably combining to cause the current population trend. While Dasyatis fluviorum is not utilized commercially (Last and Compagno 1999), it is taken as bycatch in inshore commercial fisheries, including demersal prawn trawl fisheries in NSW and Queensland (P. Kyne, pers. obs.). The species readily takes cut fish baits and is therefore prone to capture by inshore line fishing (recreational and commercial). Incidental capture by recreational fishers is also likely to be a significant threat to the species as fishers often destroy any stingray catches (Pogonoski et al. 2002, P. Kyne, pers. obs.). Decline in southern Queensland waters is also thought to be a result of the reclamation of large areas of shallow muddy tidal bays and mangroves for the development of urban areas, canal estates and marinas. For example, over 20% of the original mangrove habitat of Moreton Bay in southern Queensland has been lost to such development since European settlement (Greenwood 1993).

This stingray has been reported to feed voraciously on farmed oysters (Whitley 1940, Last and Stevens 1994), and subsequent persecution by commercial shellfish farmers in NSW and southern Queensland estuaries has probably been another factor contributing to the species' apparent decline. Furthermore, the practice of "spiking" incidentally caught stingrays (using a metal bar or stick with a sharpened point attached to pierce the animal's chondrocranium and remove it from nets, sorting trays, etc.) continues in many commercial fishing situations and may be a potentially significant source of mortality.

No information is available on the species' current status in New Guinean waters, although in that locality it is likely to face pressure from subsistence fishing activities and the effects of pollution from mining and other land-based activities.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Vulnerable (VU) (A2bcd+3cd+4bcd)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Dasyatis fluviorum is listed as Near Threatened, using the previous IUCN Red List system in the Conservation Overview and Action Plan for Australian threatened and potentially threatened marine and estuarine fishes published by Environment Australia (Pogonoski et al. 2002). This report emphasises, however, that there is significant concern for this species and that it needs to be closely monitored to ensure that its conservation status is not raised into the Vulnerable category in the near future (Pogonoski et al. 2002). Here, however, the species meets the criteria for a Vulnerable listing.

Pogonoski et al. (2002) recognise critical habitat for D. fluviorum as relatively shallow mangrove and estuarine areas and suggest that habitat protection is required as a recovery objective. While D. fluviorum is likely to occur in a number of Marine Protected Areas in NSW and Queensland waters, the zoning plans for these parks and reserves restrict fishing activities in only small areas and do not generally protect sufficient areas of the habitat of this species.

The species is still relatively common in some southern Queensland estuaries and bays (Hervey Bay, parts of Moreton Bay), and these areas may be important for habitat protection (they are however, also heavily fished both commercially and recreationally and face development pressure).

Education of commercial fishers, aquaculturists and recreational fishers is a priority to halt the destruction of incidental catches of the species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; price category: low; price reliability: very questionable: based on ex-vessel price for species in this family
  • Ahmad, A., A.A. Abdul Haris Hilmi, A.C. Gambang, S. Ahemad and A.R. Solahuddin (eds.) 2004 Elasmobranch resources, utilization, trade and management in Malaysia. Marine Fishery Resources Development and Management Department, Southeast Asian Fisheries Development Center. (Ref. 53392)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Estuary stingray

The estuary stingray (Dasyatis fluviorum), also called the estuary stingaree or brown stingray, is a species of stingray in the family Dasyatidae. Endemic to eastern Australia, it typically inhabits shallow, mangrove-lined tidal rivers, estuaries, and bays in southern Queensland and New South Wales. This yellow-brown to olive ray grows to at least 93 cm (37 in) across. It has a diamond-shaped pectoral fin disc and a mostly smooth, whip-like tail bearing both dorsal and ventral fin folds. It can additionally be identified by its long, narrow nostrils and the row of thorns along the midline of its back.

While the estuary stingray has gained infamy for consuming farmed shellfish such as oysters, it mainly feeds on crustaceans and polychaete worms. It is aplacental viviparous, with the unborn young sustained to term by maternal histotroph ("uterine milk"). Once common, this species has apparently declined across much of its range, likely from a combination of habitat degradation, mortality from commercial and recreational fishing, and persecution by shellfish farmers. As a result, the International Union for Conservation of Nature (IUCN) has assessed it as Vulnerable.

Taxonomy[edit]

The first reference to the estuary stingray in scientific literature was probably a record by 19th-century English naturalist William Saville-Kent of a "Trygon pastinaca" feeding on oysters in a Queensland estuary.[3] This species was formally described by Australian ichthyologist James Douglas Ogilby in a 1908 volume of Proceedings of the Royal Society of Queensland, based on a specimen collected from the Brisbane River. The specific epithet fluviorum means "of the rivers" in Latin.[4]

Description[edit]

The estuary stingray has a diamond-shaped pectoral fin disc about as wide as long, with gently convex anterior margins and broadly rounded outer corners. The snout is wide and triangular, and tapers to a point. The small, widely spaced eyes are immediately followed by the spiracles. Between the long and narrow nostrils, there is a short and broad "skirt" of skin with a weakly fringed posterior margin. The small, bow-shaped mouth is surrounded by deep furrows and contains a row of five papillae across the floor, with the outermost pair tiny and set apart from the others. The teeth are small and arranged into pavement-like surfaces. There are five pairs of gill slits beneath the disc. The pelvic fins are relatively large.[2]

The tail measures twice as long as the disc, and is broad and flattened at the base. On its upper surface is at least one, often two serrated stinging spines. Past the spines, the tail quickly tapers to become whip-like and bears a well-developed keel above and a long, low fin fold beneath. There are wide patches of small dermal denticles with flattened crowns between the eyes and over the middle of the back, along with a midline row of enlarged thorns that become progressively longer until they reach the base of the sting. Aside from the thorns at the base, the tail is smooth. This species is yellowish to greenish brown above, lightening towards the disc margins and darkening past the tail spine, and white below. It grows to at least 93 cm (37 in) across, and possibly reaches a width of 1.2 m (3.9 ft).[2] Its maximum recorded weight is 6.1 kg (13 lb).[5]

Distribution and habitat[edit]

The estuary stingray inhabits shallow waters with fine sediment.

The range of the estuary stingray spans approximately 1,700 km (1,100 mi) along Australia's eastern coast, from Repulse Bay in Queensland to the Hacking River in New South Wales. It is most common in southern Queensland, including in Hervey Bay and Moreton Bay.[6] This species was formerly suspected to have disappeared from Botany Bay and Port Jackson in the 1880s,[1] but recent observations have shown this is not the case. Additional species records from the Cape York Peninsula, Northern Territory, New Guinea, and the South China Sea probably represent misidentifications of other stingrays, primarily the freshwater whipray (Himantura dalyensis) and the Merauke stingray (D. longicauda).[2][6][7]

The habitat requirements of the estuary stingray appear to be rather stringent, as significant numbers are only found at particular locations.[1] It prefers tidal rivers and the intertidal flats of estuaries and bays, which are lined with mangroves and have sandy to muddy bottoms. This species is rarely found outside these sheltered areas, though it has been recorded to a depth of 28 m (92 ft) in offshore waters. It inhabits marine and brackish waters, and may be able to tolerate fresh water as well as it has been known to swim upriver beyond the limit of high tide. Surface water temperatures within its range vary from 24–29 °C (75–84 °F) in the north to 17–23 °C (63–73 °F) in the south.[6] This species seems to segregate by size and sex.[8]

Biology and ecology[edit]

The soldier crab is an important prey species of the estuary stingray.

Despite its reputation for preying voraciously on oysters and other farmed shellfish, the estuary stingray's diet in fact consists mainly of crustaceans and polychaete worms.[1][2] In Moreton Bay, an important prey species is the soldier crab (Mictyris longicarpus). This ray has been observed entering mudflats with the rising tide to forage for food.[1] Known parasites of the estuary stingray include the tapeworms Heterocotyle chin and Shirleyrhynchus aetobatidis,[9][10] the nematode Echinocephalus overstreeti,[11] and the monogeneans Empruthotrema dasyatidis and Neoentobdella cribbi.[12][13]

Like other stingrays, the estuary stingray exhibits aplacental viviparity, with the developing embryos sustained initially by yolk and later by histotroph ("uterine milk") produced by the mother. Females probably produce offspring every year.[14] Courtship, in which the male follows the female and bites her disc, has been observed at night in water approximately 80 cm (31 in) deep in Hays Inlet from July to October.[8] The newborns measure around 11 cm (4.3 in) across and 35 cm (14 in) long.[2] Young rays have been caught in the Nerang and Macleay Rivers and in Hays Inlet; such fresh or brackish environments may serve as nurseries.[8] Males mature at around 41 cm (16 in) across and seven years of age, and females mature at around 63 cm (25 in) across and 13 years of age.[14] This disparity in maturation size between the sexes is among the widest known for stingrays.[8] The maximum lifespan is estimated to be 16 years for males and 23 years for females.[14]

Human interactions[edit]

Historical and anecdotal evidence strongly suggest that the once-abundant estuary stingray has declined substantially across its range.[1] Although it is not commercially utilized, it faces a number of other threats. This species is captured incidentally by commercial bottom trawl and gillnet fisheries; bycatch mortality is exacerbated by the practice of "spiking", in which the ray's cranium is pierced with a metal bar or sharpened stick so as to move it. It is also readily caught, and often killed, by recreational anglers.[1] Surveys in Moreton Bay have found fishing-related effects, such as embedded hooks and mutilated tails, in over 10% of the population.[14] Habitat degradation is another major threat to the estuary stingray, especially given its habitat specificity. Its range encompasses some of the most urbanized areas in Australia, where there is extensive land reclamation, water pollution, and construction of flood mitigation barriers on rivers.[6] Finally, this ray's reputation for damaging shellfish has led to persecution by commercial shellfish farmers.[1]

The estuary stingray's diminished population and susceptibility to multiple threats have led the International Union for Conservation of Nature (IUCN) to assess it as Vulnerable.[1] Demographic modelling has shown that it is likely to become Endangered without intervention.[14] Several Marine Protected Areas (MPAs) are located within its range, but at present they lack adequate protection from fishing. As this ray remains locally abundant in Hervey Bay and parts of Moreton Bay, these areas may become important centers for preserving the species.[1] The Queensland government has listed the estuary stingray on the Back on Track species prioritisation framework, to facilitate the development of conservation measures.[15]

References[edit]

  1. ^ a b c d e f g h i j Kyne, P.M.; Pollard, D.A.; Bennett, M.B. (2003). "Dasyatis fluviorum". IUCN Red List of Threatened Species. Version 2011.1. International Union for Conservation of Nature. Retrieved 6 November 2011. 
  2. ^ a b c d e f Last, P.R.; Stevens, J.D. (2009). Sharks and Rays of Australia (second ed.). Harvard University Press. pp. 435–436. ISBN 0-674-03411-2. 
  3. ^ Last, P.R. (2002). "Freshwater and Estuarine Elasmobranchs of Australia". In Fowler, S.L., T.M. Reed and F.A. Dipper. Elasmobranch Biodiversity, Conservation and Management. IUCN. pp. 185–193. ISBN 2-8317-0650-5. 
  4. ^ Ogilby, J.D. (25 August 1908). "On new genera and species of fishes". Proceedings of the Royal Society of Queensland 21: 1–26. 
  5. ^ Froese, Rainer and Pauly, Daniel, eds. (2010). "Dasyatis fluviorum" in FishBase. January 2010 version.
  6. ^ a b c d Pierce, S.J.; Bennett, M.B. (15 March 2010). "Distribution of the estuary stingray (Dasyatis fluviorum) in Australia". Memoirs of the Queensland Museum 55 (1): 89–97. 
  7. ^ Last, P.R.; White, W.T. (2013). "Two new stingrays (Chondrichthyes: Dasyatidae) from the eastern Indonesian Archipelago". Zootaxa 3722 (1): 1–21. doi:10.11646/zootaxa.3722.1.1. 
  8. ^ a b c d Pierce, S.J.; Scott-Holland, T.B.; Bennett, M.B. (April 2011). "Community Composition of Elasmobranch Fishes Utilizing Intertidal Sand Flats in Moreton Bay, Queensland, Australia". Pacific Science 65 (2): 235–247. doi:10.2984/65.2.235. 
  9. ^ Chisholm, L.A.; Whittington, I.D. (November 1996). "A revision of Heterocotyle (Monogenea: Monocotylidae) with a description of Heterocotyle capricornensis n. sp. from Himantura fai (Dasyatididae) from Heron Island, Great Barrier Reef, Australia". International Journal for Parasitology 26 (11): 1169–1190. doi:10.1016/S0020-7519(96)00113-0. PMID 9024861. 
  10. ^ Beveridge, I.; Campbell, R.A. (January 1998). "Reexamination of the trypanorhynch cestode collections of A.E. Shipley, J. Hornell and T. Southwell, with the erection of a new genus, Trygonicola, and redescriptions of seven species". Systematic Parasitology 39 (1): 1–34. doi:10.1023/A:1005852507995. 
  11. ^ Moravec, F.; Justine, J.L. (2006). "Three nematode species from elasmobranchs off New Caledonia". Systematic Parasitology 64 (2): 131–145. doi:10.1007/s11230-006-9034-x. PMID 16773474. 
  12. ^ Whittington, I.D.; Kearn, G.C. (July 1992). "Empruthotrema dasyatidis n. sp. (Monogenea: Monocotylidae) from the olfactory sacs of Dasyatis fluviorum (Rajiformes: Dasyatidae) from Moreton Bay, Queensland". Systematic Parasitology 22 (3): 159–165. doi:10.1007/BF00009663. 
  13. ^ Whittington, I.D. and G.C. Kearn (2009). "Two new species of Neoentobdella (Monogenea: Capsalidae: Entobdellinae) from the skin of Australian stingrays (Dasyatidae)". Folia Parasitologica 56 (1): 29–35. PMID 19391329. 
  14. ^ a b c d e Pierce, S.J.; Bennett, M.B. (2010). "Destined to decline? Intrinsic susceptibility of the threatened estuary stingray to anthropogenic impacts". Marine and Freshwater Research 61 (12): 1468–1481. doi:10.1071/MF10073. 
  15. ^ Estuary stingray (31 August 2007). Queensland Department of Environment and Resource Management. Retrieved 6 November 2011.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!