Overview

Comprehensive Description

Biology

Adults inhabit inshore and offshore coral reefs; also in harbors and protected outer reef slopes and current prone habitats. Form schools in harbors in depths from near surface to about 25 m (Ref. 48636). Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Indo-West Pacific: Red Sea and East Africa to the Philippines, north to southern Japan, south to northern Australia and Melanesia (except Fiji).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

East Africa, Kenya, Mozambique, Red Sea, Seychelles, South Africa (country)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Red Sea, Indo-West Pacific: East Africa to Philippines and Vanuatu, north to southern Japan, south to Western Australia, Queensland (Australia) and New Caledonia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 13; Dorsal soft rays (total): 11 - 12; Analspines: 2; Analsoft rays: 11 - 12
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 70 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

10.0 cm TL (male/unsexed; (Ref. 48636))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Indonesian fish metallic green to black with a distinctive white spot at end on dorsal fin base (Ref. 48636).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Inhabits inshore and offshore coral reefs. Also, occurs in harbors and protected outer reef slopes.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; non-migratory; marine; depth range 5 - 30 m (Ref. 4391)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 24 specimens in 1 taxon.
Water temperature and chemistry ranges based on 17 samples.

Environmental ranges
  Depth range (m): 2 - 57.9
  Temperature range (°C): 25.702 - 28.749
  Nitrate (umol/L): 0.043 - 1.008
  Salinity (PPS): 32.279 - 35.264
  Oxygen (ml/l): 4.427 - 4.802
  Phosphate (umol/l): 0.129 - 0.350
  Silicate (umol/l): 0.900 - 4.452

Graphical representation

Depth range (m): 2 - 57.9

Temperature range (°C): 25.702 - 28.749

Nitrate (umol/L): 0.043 - 1.008

Salinity (PPS): 32.279 - 35.264

Oxygen (ml/l): 4.427 - 4.802

Phosphate (umol/l): 0.129 - 0.350

Silicate (umol/l): 0.900 - 4.452
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 5 - 30m.
From 5 to 30 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Occurs inshore (Ref. 75154).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Neopomacentrus cyanomos

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 11 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTTTATCTAGTCTTCGGTGCATGAGCTGGAATAGTAGGCACGGCTTTAAGCCTTCTTATTCGGGCAGAACTAAGCCAACCAGGCGCACTCCTAGGGGACGACCAAATTTATAATGTTATTGTCACTGCACATGCTTTCGTGATGATTTTCTTTATAGTAATACCAATTCTAATTGGTGGTTTCGGGAACTGATTAGTCCCCCTTATGCTTGGCGCCCCTGACATAGCATTCCCCCGAATAAATAATATAAGCTTCTGACTTCTCCCCCCATCATTCCTACTTCTGCTCGCCTCCTCTGGAGTTGAAGCAGGGGCTGGTACAGGCTGAACTGTTTACCCCCCTCTATCCGGGAATCTCGCTCATGCAGGAGCTTCAGTTGACCTAACCATCTTCTCCCTGCACCTAGCCGGTATTTCTTCAATCCTAGGGGCAATCAACTTTATTACTACTATTATTAACATGAAACCTCCTGTAATAACTCAATACCAAACTCCTCTATTCGTCTGAGCCGTACTAATTACTGCTGTCCTCCTTCTTCTATCGCTTCCTGTGCTAGCTGCCGGCATTACCATGCTACTTACAGACCGAAATCTTAACACCACATTCTTCGACCCCGCTGGAGGAGGAGACCCGATTCTCTACCAGCATCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Neopomacentrus cyanomos

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!