Sardinella fimbriata — Details

Lesser Sardine learn more about names for this taxon

Overview

Comprehensive Description

Biology

Learn more about this article

Forms schools in coastal waters. Misidentifications (especially with S. gibbosa in Indian waters and S. albella in the western Indian Ocean) make published biological data potentially unreliable. Marketed fresh, dried-salted, boiled or made into fish balls.

Whitehead, P.J.P. 1985 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (suborder Clupeioidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/1):1-303. Rome: FAO. (Ref. 188) http://www.fishbase.org/references/FBRefSummary.php?id=188&speccode=24

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Distribution

Learn more about this article

Indo-West Pacific: southern India and Bay of Bengal to the Philippines, also eastern tip of Papua New Guinea. Often confused with Sardinella gibbosa in Indian waters.

Whitehead, P.J.P. 1985 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (suborder Clupeioidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/1):1-303. Rome: FAO. (Ref. 188) http://www.fishbase.org/references/FBRefSummary.php?id=188&speccode=24

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Indo-West Pacific.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Physical Description

Morphology

Learn more about this article

Dorsal spines (total): 0; Dorsal soft rays (total): 13 - 21; Analspines: 0; Analsoft rays: 12 - 23

Whitehead, P.J.P. 1985 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (suborder Clupeioidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/1):1-303. Rome: FAO. (Ref. 188) http://www.fishbase.org/references/FBRefSummary.php?id=188&speccode=24

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Size

Learn more about this article

Maximum size: 130 mm SL

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Max. size

Learn more about this article

13.0 cm SL (male/unsexed; (Ref. 188))

Whitehead, P.J.P. 1985 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (suborder Clupeioidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/1):1-303. Rome: FAO. (Ref. 188) http://www.fishbase.org/references/FBRefSummary.php?id=188&speccode=24

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Diagnostic Description

Learn more about this article

Body somewhat compressed but variable; total number of scutes 29 to 33. Vertical striae on scales not meeting at center, hind part of scales with a few perforations and (in Indian Ocean specimens) somewhat produced posteriorly. A dark spot at dorsal fin origin.

Whitehead, P.J.P. 1985 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (suborder Clupeioidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/1):1-303. Rome: FAO. (Ref. 188) http://www.fishbase.org/references/FBRefSummary.php?id=188&speccode=24

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Ecology

Habitat

Environment

Learn more about this article

pelagic-neritic; brackish; marine; depth range 0 - 50 m (Ref. 188)

Whitehead, P.J.P. 1985 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (suborder Clupeioidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/1):1-303. Rome: FAO. (Ref. 188) http://www.fishbase.org/references/FBRefSummary.php?id=188&speccode=24

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Trophic Strategy

Learn more about this article

Eggs and pro-larvae occur only in marine. Certain post larval and early juvenile stages occur occasionally in mangrove estuaries. Adults mainly marine.

Jeyaseelan, M.J.P. 1998 Manual of fish eggs and larvae from Asian mangrove waters. United Nations Educational, Scientific and Cultural Organization. Paris. 193 p. (Ref. 43081) http://www.fishbase.org/references/FBRefSummary.php?id=43081&speccode=1295

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Diseases and Parasites

Learn more about this article

Rhapidascaris Disease (larvae). Parasitic infestations (protozoa, worms, etc.)

Arthur, J.R. and A.B.A. Ahmed 2002 Checklist of the parasites of fishes of Bangladesh. FAO Fish. Tech. Paper (T369/1), 77 p. (Ref. 42533) http://www.fishbase.org/references/FBRefSummary.php?id=42533&speccode=10132

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Quimperia Disease (larvae). Parasitic infestations (protozoa, worms, etc.)

Arthur, J.R. and A.B.A. Ahmed 2002 Checklist of the parasites of fishes of Bangladesh. FAO Fish. Tech. Paper (T369/1), 77 p. (Ref. 42533) http://www.fishbase.org/references/FBRefSummary.php?id=42533&speccode=10132

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Neoechinorhynchus Disease. Parasitic infestations (protozoa, worms, etc.)

Arthur, J.R. and A.B.A. Ahmed 2002 Checklist of the parasites of fishes of Bangladesh. FAO Fish. Tech. Paper (T369/1), 77 p. (Ref. 42533) http://www.fishbase.org/references/FBRefSummary.php?id=42533&speccode=10132

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Contracaecum Disease. Parasitic infestations (protozoa, worms, etc.)

Arthur, J.R. and A.B.A. Ahmed 2002 Checklist of the parasites of fishes of Bangladesh. FAO Fish. Tech. Paper (T369/1), 77 p. (Ref. 42533) http://www.fishbase.org/references/FBRefSummary.php?id=42533&speccode=10132

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sardinella fimbriata

Learn more about this article

The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 5 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CTTGAGCTGGAATGGTCGGAACCGCCCTAAGCCTTCTAATTCGAGCTGAGCTGAGCCAACCCGGGGCCCTCCTTGGGGACGACCAGATTTACAACGTCATCGTCACTGCACATGCCTTCGTAATGATTTTCTTCATGGTTATGCCAATCCTGATTGGGGGATTCGGAAACTGACTTGTCCCTCTAATAATTGGGGCTCCAGACATGGCATTCCCACGAATGAATAACATGAGCTTTTGACTTCTTCCCCCTTCTTTTCTTCTTCTCCTGGCCTCTTCAGGGGTAGAAGCCGGGGCAGGAACAGGGTGAACAGTCTATCCTCCACTGGCAGGAAACCTAGCCCATGCCGGAGCCTCTGTTGACCTGACTATTTTCTCTCTTCACTTGGCAGGTATCTCGTCAATCCTAGGAGCAATTAACTTTATTACTACGATTATCAACATGAAGCCTCCTGCAATCTCGCAGTACCAGACACCGCTATTCGTCTGAGCTGTCCTTGTAACTGCCGTTTTACTCCTTCTCTCCCTTCCCGTACTAGCCGCTGGGATCACTATGCTGCTAACAGACCGAAACCTAAATACAACATTCTTCGACCCCGCAGGTGGGGGAGACCCAATTCTATATCAACACCTATTCTGATTCTTCGGTCAC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Statistics of barcoding coverage: Sardinella fimbriata

Learn more about this article

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 7
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Conservation

Threats

Learn more about this article

Not Evaluated

IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006. http://www.fishbase.org/references/FBRefSummary.php?id=57073

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Relevance to Humans and Ecosystems

Benefits

Importance

Learn more about this article

fisheries: commercial

Coppola, S.R., W. Fischer, L. Garibaldi, N. Scialabba and K.E. Carpenter 1994 SPECIESDAB: Global species database for fishery purposes. User's manual. FAO Computerized Information Series (Fisheries). No. 9. Rome, FAO. 103 p. (Ref. 171) http://www.fishbase.org/references/FBRefSummary.php?id=171&speccode=2534

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Wikipedia

Fringescale Sardinella

Learn more about this article

Fringescale Sardinella (Sardinella fimbriata) is a species of ray-finned fish in the genus Sardinella.

Footnotes

Froese, Rainer, and Daniel Pauly, eds. (2006). "Sardinella fimbriata" in FishBase. April 2006 version.

This Clupeiformes article is a stub. You can help Wikipedia by expanding it.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!