Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Brief Summary

Description

The graceful manta ray is a stunning member of the devil ray family, if only for its sheer size. These large rays have a distinctive body shape with triangular pectoral 'wings' and paddle-like lobes extending in front of their mouths (2). They are generally dark on the upper surface, ranging from black to greyish-blue and brown, with pale undersides; individuals have a unique pattern of blotches and scars that can be used to identify them (2). The large, cavernous mouth is situated at the front of the body and contains 18 rows of teeth on the lower jaw (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Comprehensive Description

Biology

Mainly in near-shore waters, near coral and rocky reefs; sometimes found over deep water (Ref. 12951). Reported along productive coastlines with regular upwelling, oceanic island groups and offshore pinnacles and seamounts (Ref. 82755). Penetrates shallow muddy bays and the intertidal and occurs off river mouths (Ref. 9911). Pelagic (Ref. 58302). Occurs singly or in loose aggregations (Ref. 12951). Mainly plankton feeders, but may feed on small and moderate-sized fishes as well (Ref. 9911). Leaps out the water mainly in spring and autumn, possibly as part of mating behavior (Ref. 31742). Easily approached (Ref. 9911). Ovoviviparous (Ref. 6902). Commonly caught by tuna gillnet and harpoon fisheries. Utilized for its gill filter plates (very high value), meat, cartilage and skin (Ref.58048). Liver yields oil and skin used as abrasive (Ref. 6902). World's largest ray (Ref. 37816).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Common names: manta (English), mantarraya (Espanol), manta (Espanol)
 
Manta birostris (Walbaum, 1792)


Manta,     Giant manta



Head relatively wide, projecting with a pair of paddle-like extensions; large triangular "wings" (pectoral fin flaps); mouth at front of head, relatively wide; teeth in lower jaw only; tail long and whip-like, without spines; disc above and below covered with small denticles.



Dark grey to black above, sometimes with white patches on shoulders; white on underside.


Size: to at least 8 m disc width and over two tons in weight.

Habitat: inshore and offshore pelagic.

Depth: 0-30 m.

Circumtropical; throughout our region except the northern Gulf of California.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Circumglobal, tropical to temperate: in the Northern Hemisphere, as far north as southern California and Rhode Island on the United States west and east coasts, Mutsu Bay, Aomori, Japan, the Sinai Peninsula, Egypt and the Azores Islands; in the Southern Hemisphere, as far south as Peru, Uruguay, South Africa and New Zealand. Insome locations, including Mozambique, it is sympatric with Manta alfredi.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Circumglobal in tropical and temperate waters, this species has a widespread distribution. The Giant Manta Ray has been documented to occur as far north as southern California and New Jersey on the United States west and east coasts, respectively, Mutsu Bay, Aomori, Japan, the Sinai Peninsula, Egypt and the Azores Islands in the Northern Hemisphere and as far south as Peru, Uruguay, South Africa and New Zealand in the Southern Hemisphere.

In a few locations, including Mozambique, the Giant Manta Ray is sympatric with the Reef Manta Ray. When they occur together these species typically exhibit different habitat use and movement patterns (Marshall et al. 2009, Kashiwagi et al. 2011).

The Giant Manta Ray appears to be a seasonal visitor to coastal or offshore sites. While this species seems more solitary than the Reef Manta Ray, Giant Manta Rays are often seen aggregating in large numbers to feed, mate, or clean. Sightings of these giant rays are often seasonal or sporadic but in a few locations their presence is a more common occurrence. Observations of the Giant Manta Ray at aggregation sites such as the Similan Islands, Thailand; northeast North Island, New Zealand; Laje de Santos Marine Park, Brazil; Isla de la Plata, Ecuador; and Isla Holbox, Mexico, indicate that this species is a regular seasonal visitor, with sightings only during specific, predictable times of the year (Duffy and Abbott 2003, Luiz et al. 2009, A. Marshall pers. obs. 2011).

Observations of the Giant Manta Ray frequenting remote seamounts in Isla Socorro, Mexico, Malpelo, Columbia and off some remote islands (Cocos Island, Costa Rica; Galápagos, Ecuador; Laje de Santos, Brazil) show a degree of philopatry to these sites but also indicate that these mantas make migrations away from these areas during parts of the year (Rubin 2002, Luiz et al. 2009, A. Marshall unpubl. data 2011). In other areas, such as southern Mozambique, the Giant Manta Ray is seen sporadically throughout the year although individuals are not commonly re-sighted over time (Marshall 2009).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Manta rays are found in tropical and warm temperate coastal regions of the world's oceans, generally between 35 degrees north and south latitude, including the coasts of southern Africa, ranging from southern California to northern Peru, North Carolina to southern Brazil, and the Gulf of Mexico.

Biogeographic Regions: indian ocean (Native ); atlantic ocean (Native ); pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Gulf of Maine to Brazil, and occasionaly further north
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Azores Exclusive Economic Zone, Chagos, Djibouti, European waters (ERMS scope), Gulf of Maine, Gulf of Mexico, Kenya, Mauritius, Mozambique, North West Atlantic, Reunion, Seychelles, Somalia, South Africa (country)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Southeastern Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Circumglobal in tropical through warm temperate water (including Red Sea, Mascarenes, Hawaiian Islands).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Atlantic from middle Brazil to the Carolinas, rarely to southern New England and Georges Bank; Bermuda; Madeira; tropical West Africa.
  • Bigelow, H. B. and Schroeder,W.C.,1953 ; Michael, S.W., 1993 ; Compagno, L.J.V., 1997 ; Compagno, L.J.V., D.A. Ebert and M.J. Smale, 1989 ; Grove, J.S. and R.J. Lavenberg, 1997 ; Homma, K., T. Maruyama, T. Itoh, H. Ishihara and S. Uchida, 1999.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth

Depth Range (m): 0 (F) - 30 (F)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific


 
Global Endemism: All species, TEP non-endemic, Circumtropical ( Indian + Pacific + Atlantic Oceans), "Transpacific" (East + Central &/or West Pacific), All Pacific (West + Central + East), East Pacific + Atlantic (East +/or West), Transisthmian (East Pacific + Atlantic of Central America), East Pacific + all Atlantic (East+West)

Regional Endemism: All species, Eastern Pacific non-endemic, Tropical Eastern Pacific (TEP) non-endemic, Continent + Island (s), Continent, Island (s)

Residency: Resident

Climate Zone: North Temperate (Californian Province &/or Northern Gulf of California), Northern Subtropical (Cortez Province + Sinaloan Gap), Northern Tropical (Mexican Province to Nicaragua + Revillagigedos), Equatorial (Costa Rica to Ecuador + Galapagos, Clipperton, Cocos, Malpelo), South Temperate (Peruvian Province )

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Manta rays are easily reconized in the ocean by their large pectoral "wings." Manta birostris have no dorsal or caudal fins. They have two cephalic lobes that extend from the front of the head and a broad, rectangular, terminal mouth containing small teeth exclusively in the lower jaw. The gills are located on the underside of the body. Manta rays also have a short, whip-like tail that, unlike many rays, has no sharp barb. Atlantic manta ray pups weigh 11 kg at birth and their growth is rapid, with pups virtually doubling the body width from birth through the first year of life. Manta rays show little dimorphism between the sexes with wingspan in males ranging from 5.2 - 6.1 meters and females ranging from 5.5 - 6.8 meters. The largest ever recorded was 9.1 meters. One of the distinct features of manta rays, and of the class Chondrichthyes, is that the entire skeleton is made of cartilage, which allows for a wide range of motion. These rays vary in color from black to grayish blue along the back, and a white underside with grayish blotchs that have been used to identify individual rays. The skin of manta rays is rough and scaly, like that of most sharks.

Range mass: 1200 to 1400 kg.

Other Physical Features: ectothermic ; bilateral symmetry

Sexual Dimorphism: female larger

  • 1989. Manta Rays. Pp. 582-583 in Wildlife of the World Encyclopedia, vol. 10 (Rav-Slo). New York: Cavendish Publishing.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length max (cm): 800.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 7000 mm WD
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

910 cm WD (male/unsexed; (Ref. 58048)); max. published weight: 3,000.0 kg (Ref. 5377); max. reported age: 20 years (Ref. 31742)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

to 800 cm WD; max. weight: 3,000 kg.
  • Bigelow, H. B. and Schroeder,W.C.,1953 ; Michael, S.W., 1993 ; Compagno, L.J.V., 1997 ; Compagno, L.J.V., D.A. Ebert and M.J. Smale, 1989 ; Grove, J.S. and R.J. Lavenberg, 1997 ; Homma, K., T. Maruyama, T. Itoh, H. Ishihara and S. Uchida, 1999.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

A giant ray having an extremely broad head with long head fins, and a terminal mouth; upper surface of disc covered with denticles, and tail usually without a spine (Ref. 5578). Blackish above, sometimes with white shoulder patches; white below, with grey edging on disc (Ref. 5578). Tail whiplike but short (Ref. 7251).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Mainly oceanic (Ref. 7251) but also encountered in surface or mid-waters of lagoons, shallow muddy bays, off river mouths, and seaward reefs. Occurs singly or in small groups (Ref. 1602). Mainly plankton feeders, but may feed on small and moderate-sized fishes as well (Ref. 9911). Mantas are not aggresive but are dangerous because of their rough skin and huge size which has led to the deaths of deep-sea divers whose airlines have been entangled with these creatures. May be captured by means of the harpon. Leaps out the water every once in a while.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; oceanodromous (Ref. 51243); marine; depth range 0 - 120 m (Ref. 58302), usually 0 - ? m (Ref. 55255)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
The Giant Manta Ray occurs in tropical, sub-tropical and temperate waters of the Atlantic, Pacific and Indian Oceans. Commonly sighted along productive coastlines with regular upwelling, oceanic island groups and particularly offshore pinnacles and seamounts. The Giant Manta Ray is commonly encountered on shallow reefs while being cleaned or is sighted feeding at the surface inshore and offshore. It is also occasionally observed in sandy bottom areas and seagrass beds.

A global investigation of major aggregation sites revealed that the Giant Manta Ray may be a more oceanic and a more migratory species than the Reef Manta Ray (A. Marshall et al. unpubl. data). Rare or seasonal sightings of the Giant Manta Ray at locations such as northern New Zealand (Duffy and Abbott 2003), southern Brazil (Luiz et al. 2009) and Uruguay (Milessi and Oddone 2003), the Azores Islands, the Similan Islands, Thailand (A. Marshall unpubl. data 2011) and the eastern coast of the United States (Bigelow and Schroeder 1953), suggests that this species undergoes significant seasonal migrations.

Despite these data, preliminary satellite tracking studies and international photo-identification matching projects have suggested a high degree of fragmentation between regional populations of this species, suggesting that movements across ocean basins may be rare. Satellite tracking results have been able to reveal that the Giant Manta Ray is capable of large migrations (over 1,100 km straight line distance) and have monitored individual movements across international borders, across large bodies of water, and into international waters (A. Marshall et al. unpubl. data 2011, R. Rubin pers. comm. 2009). Satellite tracking studies using archival PAT tags have registered movements of the Giant Manta Ray from Mozambique to South Africa (a distance of 1,100 km), from Ecuador to Peru (190 km), from the Yucatan, Mexico into the Gulf of Mexico (448 km). This species is capable of deep dives and has been both seen at depth and tracked down to depths exceeding 1,000 metres (A. Marshall et al. unpubl. data 2011).

The Giant Manta Ray reaches disc widths (DW) of at least 700 cm, with anecdotal reports up to 910 cm DW (Compagno 1999, Alava et al. 2002). Size at maturity for the Giant Manta Ray may vary slightly throughout its range, but males in southern Mozambique mature at approximately 400 cm DW while females appear to mature well over 400 cm DW (Marshall 2009). In Indonesia, data from fisheries dissections suggest that in that region male Giant Manta Rays mature at 375 cm DW, while females may mature by approximately 410 cm DW (White et al. 2006).

The Giant Manta Ray appears to be a relatively long-lived species. Although the actual longevity of the species remains unknown, photographic databases have re-sighted individuals up to a 20 year period (Rubin 2002, G. Kodja unpubl. data 2010). Natural mortality is thought to be low (other than in juveniles), although limited predation from large sharks does occur (Marshall 2009).

Generation time is suspected to be 25 years based on conservative estimates of life history parameters from the Reef Manta Ray. Female mantas are thought to mature at 8–10 years of age and longevity is estimated to be at least 40 years. Generation time is the average age of adults which can be approximated as halfway between age at first maturity and maximum age. Thus female mantas may be actively breeding for 30 years and the age at which 50% of total reproductive output is achieved would be approximately 24–25 years.

Copulation has been documented off the Ogasawara Islands, Japan and is believed to occur in the summer months (Yano et al. 1999b). Two pregnant individuals have been registered and photographed in southern Mozambique although a breeding season at this location has not been established (Marshall 2009). There is little information on the reproductive biology or ecology of this species although reports of litter size are consistently of a single offspring (Coles 1916, Beebe and Tee-Van 1941, Bigelow and Schroeder 1953).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Manta birostris, unlike most other rays, are found near the surface of the ocean and to depths of 120 meters. Atlantic manta rays stay closer to shore in the warmer waters where food sources are more abundant, but occasionally can be found further from shore.

Range depth: 0 to 120 m.

Habitat Regions: tropical ; saltwater or marine

Aquatic Biomes: pelagic ; reef ; coastal

  • Acker (MRBH), B. 2001. "Manta facts" (On-line). Manta Ray Bay Hotel and Yap Divers. Accessed 11/01/04 at http://www.mantaray.com.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Found to depths of 24 m, mainly in nearshore waters, around coral reefs .
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

nektonic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 251 specimens in 1 taxon.
Water temperature and chemistry ranges based on 191 samples.

Environmental ranges
  Depth range (m): 0 - 62
  Temperature range (°C): 7.367 - 27.844
  Nitrate (umol/L): 0.286 - 3.963
  Salinity (PPS): 31.835 - 36.255
  Oxygen (ml/l): 4.406 - 7.040
  Phosphate (umol/l): 0.083 - 0.635
  Silicate (umol/l): 0.777 - 4.599

Graphical representation

Depth range (m): 0 - 62

Temperature range (°C): 7.367 - 27.844

Nitrate (umol/L): 0.286 - 3.963

Salinity (PPS): 31.835 - 36.255

Oxygen (ml/l): 4.406 - 7.040

Phosphate (umol/l): 0.083 - 0.635

Silicate (umol/l): 0.777 - 4.599
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 24m.
Recorded at 24 meters.

Habitat: pelagic. Manta.  Donndorff, 1798 Colour reddish or greenish brown to black above, often with black patches on shoulders; underside white, edged with grey. One of the largest of fishes, attains at least 6,7m disc width and over 2 tons in weight. Possibly circumtropical, from the Cape eastwards. Harmless plankton feeders, "flying" slowly through the water but capable of high speed. Often  cartwheeling at the surface or leaping entirely out of the water and landing with a crash which can be heard for k ilometres Inshore and sometimes far out to sea. Occasionally harpooned for "sport", but not easily landed, towing boats for miles and sometimes crashing down onto the boat.  Many give Donndorff 1789 as author, but see Ref. 26282 for justification of Walbaum.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pelagic; marine; depth range 0 - 24 m. Nearshore waters, around coral and rocky reefs; sometimes found in deeper water. Shallow muddy bays and near river mouths. Occurs singly or in loose aggregations.
  • Bigelow, H. B. and Schroeder,W.C.,1953 ; Michael, S.W., 1993 ; Compagno, L.J.V., 1997 ; Compagno, L.J.V., D.A. Ebert and M.J. Smale, 1989 ; Grove, J.S. and R.J. Lavenberg, 1997 ; Homma, K., T. Maruyama, T. Itoh, H. Ishihara and S. Uchida, 1999.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Inhabits nearshore waters, often near to coral reefs; these rays are seen near to the surface of the water or in the middle of the water column (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Salinity: Marine, Brackish

Inshore/Offshore: Offshore, In & Offshore, Inshore

Water Column Position: Surface, Near Surface, Water column only

Habitat: Reef associated (reef + edges-water column & soft bottom), Estuary, Water column

FishBase Habitat: Pelagic
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Common on coastal waters (Ref. 9137). One of the best areas to view them is around Sangalaki Island, off the northeastern coast of Kalimantan (Indonesian Borneo), (Ref. 54301). Mainly in near-shore waters, near coral and rocky reefs; sometimes found over deep water (Ref. 12951). Penetrates shallow muddy bays and the intertidal and occurs off river mouths (Ref. 9911). Pelagic (Ref. 58302). Occurs singly or in loose aggregations (Ref. 12951). Mainly plankton feeders, but may feed on small and moderate-sized fishes as well (Ref. 9911). A carnivore (Ref. 9137). Leaps out the water mainly in spring and autumn, possibly as part of mating behavior (Ref. 31742). Easily approached (Ref. 9911).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Manta rays are filter feeders and primarily planktivores. They often slowly swim in vertical loops. Some researchers suggest this is done to keep the rays prey within the area while feeding. Their large, gaping mouths and cephalic lobes unfurled are used to corral planktonic crustaceans and small schooling fish. Manta rays filter water through their gills and organisms in the water are trapped by a filtering device, which consists of plates in the back of the mouth that are made of pinkish-brown tissue that span between the support structures of the gills. The teeth of Manta birostris are nonfunctional during feeding.

Animal Foods: fish; aquatic crustaceans; zooplankton

Foraging Behavior: filter-feeding

Primary Diet: carnivore (Eats non-insect arthropods)

  • 1992. Manta Rays. Pp. 1512-1514 in Encyclopedia of the Animal, vol. 8 (Ott-Rhe). New York: Boy Books.
  • Perlmutter, A. 1961. Guide to Marine Fishes. New York: New York University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Planktivorous, sometimes feeding on small and moderate-sized fishes as well.
  • Bigelow, H. B. and Schroeder,W.C.,1953 ; Michael, S.W., 1993 ; Compagno, L.J.V., 1997 ; Compagno, L.J.V., D.A. Ebert and M.J. Smale, 1989 ; Grove, J.S. and R.J. Lavenberg, 1997 ; Homma, K., T. Maruyama, T. Itoh, H. Ishihara and S. Uchida, 1999.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Feeding

Feeding Group: Planktivore

Diet: Pelagic crustacea, zooplankton, pelagic fish eggs, bony fishes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Exhibit ovoviparity (aplacental viviparity), with embryos feeding initially on yolk, then receiving additional nourishment from the mother by indirect absorption of uterine fluid enriched with mucus, fat or protein through specialised structures (Ref. 50449). Bears up to 2 young (Ref. 5578); born at 122-127 cm WD (Ref.58048). A female of 550 cm width and weighing 1050 kg was collected in the Galapagos in June and was carrying a well-developed embryo of 12.7 kg (Ref. 28023). Size at partuition might be from 1.1 to 1.3 m and from 9.1 to 1.14 kg (Ref. 31742).Yano et al (1999) (Ref. 35892) describe the mating behavior of manta rays based on observations off Ogasawara Islands, Japan, in the following sequence:1) 'chasing', the male rapidly follows behind the tail of the female and attacks her several times;2) 'nipping', the male nips the tip of the pectoral fin of the female and then moves to the ventral surface of the female;3) 'copulating', the male inserts a clasper into the cloacaof the female and copulates abdomen-to-abdomen, up to 123 seconds;4) 'post-copulating';5) 'separating'. (Ref. 49562).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: captivity:
20 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Manta birostris are sexually mature at 5 years of age. The mating season of sexually mature manta rays occurs from early December to late April. Mating takes place in tropical waters (26-29 degrees Celsius), and around rocky reef areas from 10-20 meters in depth. Manta rays gather in large numbers during this season, where several males will court a single female. The males swim closely behind the tail of the female at faster than usual speeds (9-12km/h). This courtship will last for about 20-30 minutes at which point the female decreases her swimming speed and a male will grasp one side of the female's pectoral fin by biting it. He arranges his body under that of the females. The male will then insert his clasper in the cloaca of the female and insert his sperm, this usually lasting around 90-120 seconds. The male will then swim away rapidly and the next male will repeat this same process. However, after the second male the female usually swims away leaving behind the other courting males. The gestation period of Manta birostris is 13 months, after which females give birth to 1 or 2 live young. Pups are born wrapped up by their pectoral fins, but soon after become free swimmers and fend for theirselves. Manta ray pups are between 1.1 and 1.4 meters when they are born.

Key Reproductive Features: iteroparous ; seasonal breeding ; sexual ; fertilization (Internal ); viviparous

Average age at sexual or reproductive maturity (female)

Sex: female:
2190 days.

  • Yano, K., F. Sato, T. Tomoko. 1999. Observations of mating behavior of the manta ray, Manta birostris, at the Ogasawara Islands, Japan. Ichthyological Research, 46: 289-296.
  • Acker (MRBH), B. 2001. "Manta facts" (On-line). Manta Ray Bay Hotel and Yap Divers. Accessed 11/01/04 at http://www.mantaray.com.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ovoviviparous .Bears up to 2 young. Harmless to humans.
  • Bigelow, H. B. and Schroeder,W.C.,1953 ; Michael, S.W., 1993 ; Compagno, L.J.V., 1997 ; Compagno, L.J.V., D.A. Ebert and M.J. Smale, 1989 ; Grove, J.S. and R.J. Lavenberg, 1997 ; Homma, K., T. Maruyama, T. Itoh, H. Ishihara and S. Uchida, 1999.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Egg Type: Live birth, No pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Fins funnel food: manta ray
 

The mouth of manta rays filter feeds more efficiently because food is funneled via extendable, flaplike fins on either side of the mouth.

   
  "The manta is the largest living ray, up to 6.7 metres across and 1360 kg in weight. Surprisingly, it feeds on small crustaceans and plankton, trapped on its gill rakers. Unlike most rays, its mouth extends across the front of its body, and the large mobile pale-coloured cephalic fins on either side of the mouth can be extended vertically. It has been suggested that these may form a scoop or funnel leading to the mouth while feeding." (Foy and Oxford Scientific Films 1982:188)
  Learn more about this functional adaptation.
  • Foy, Sally; Oxford Scientific Films. 1982. The Grand Design: Form and Colour in Animals. Lingfield, Surrey, U.K.: BLA Publishing Limited for J.M.Dent & Sons Ltd, Aldine House, London. 238 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Manta birostris

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTACTTGATCTTTGGTGCATGAGCAGGGATAGTGGGAACTGGCCTTAGTTTGCTGATTCGAACGGAATTAAGCCAACCAGGGGCTTTATTAGGTGATGATCAGATCTATAATGTAGTCGTTACTGCCCATGCTTTCGTAATAATTTTCTTTATGGTCATACCTATTATAATTGGTGGATTCGGTAATTGACTGGTTCCCTTGATAATTGGTGCTCCGGACATGGCCTTTCCGCGAATAAATAACATAAGCTTTTGACTTCTTCCTCCATCTTTCCTTCTATTATTAGCTTCAGCAGGGGTAGAAGCTGGGGCTGGAACCGGATGAACCGTTTACCCTCCTCTAGCTGGCAACCTGGCACATGCTGGAGCTTCTGTAGATCTTACTATCTTTTCCCTACACTTAGCAGGGGTCTCCTCCATTTTAGCATCAATCAATTTTATTACTACAATTATTAATATGAAACCACCTGCAATCTCTCAGTATCAAACACCCTTATTCGTTTGATCAATTCTAATCACAACTGTCCTTCTCTTATTATCCCTCCCCGTCCTAGCAGCAGGCATTACTATACTCCTTACAGATCGTAATCTTAATACAACCTTCTTTGACCCAGCAGGTGGTGGTGATCCTATCCTCTACCAACATCTCTTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Manta birostris

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A2abd+3bd+4abd

Version
3.1

Year Assessed
2011

Assessor/s
Marshall, A., Bennett, M.B., Kodja, G., Hinojosa-Alvarez, S., Galvan-Magana, F., Harding, M., Stevens, G. & Kashiwagi, T.

Reviewer/s
Ebert, D.A. & Kyne, P.M.

Contributor/s

Justification
The Giant Manta Ray (Manta birostris), the largest living ray, has a circumtropical and also semi-temperate distribution throughout the world’s major oceans, however within this broad range, actual populations appear to be sparsely distributed and highly fragmented. This is likely due to the specific resource and habitat needs of this species. Overall population size is unknown, but subpopulations appear to be small (about 100–1,000 individuals). Only recently separated from the Reef Manta Ray (M. alfredi), little is currently known about this ray except that it is elusive and potentially highly migratory.

The degree of interchange of individuals between subpopulations is unclear but is assumed to be low as there are currently no data that support such interchange despite active efforts to do so. As such, the decline of these small subpopulations may result in regional depletions or extinctions with the reduced possibility of successful recolonization. To aggravate this situation, this species has a very conservative life history with an extremely low reproductive output (one pup per litter). These biological constraints would also contribute to its slow or lack of recovery from population reductions.

Currently this species has a high value in international trade and directed fisheries exist that target this species in what is certain to be unsustainable numbers. Artisanal fisheries also exist that target this species for food and medicine. Individuals are also taken as bycatch in everything from large-scale fisheries to shark control programs/bather protection nets.

The rate of population reduction appears to be high in several regions, as much as 80% over the last three generations (approximately 75 years), and globally a decline of >30% is strongly suspected. Sustained pressure from fishing (both directed and bycatch) has been isolated as the main cause of these declines. Certain monitored subpopulations appear to have been depleted, such as in the Philippines, Indonesia, and parts of Mexico and are believed to be decreasing in other areas such as India and Sri Lanka as a result of sustained pressure from fishing. Of particular concern is the targeting of this species at critical habitats or well-known aggregation sites where numerous individuals can be targeted with relatively low catch-per-unit-effort.

Dive tourism involving this species is a growing industry and it has been demonstrated that sustainable tourism significantly enhances the economic value of such species in comparison to short-term returns from fishing. Tourism related industries can also negatively impact individual behaviour, entire populations and critical habitat for this species, thus the responsible development of these industries is recommended.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population sizes of Manta birostris are unknown. Because of their slow reproductive rate, they are very vulnerable to overfishing. However, there does not appear to be commercial harvesting at this time. The IUCN lists this species as "Data Deficient," meaning they don't have enough information to assess its conservation status.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Near Threatened (NT) on the IUCN Red List (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List: Listed, Near threatened

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is not regularly encountered in large numbers and, unlike the Reef Manta Ray do not often appear in large schools (>30 individuals) when feeding. Overall they are encountered with far less frequency than the smaller Manta species, the Reef Manta Ray, despite having a larger distribution across the globe.

Due to the global nature of their individual distributions, absolute population sizes will always be difficult to assess. Currently, the overall total global population sizes of both these species are unknown, but subpopulations appear, in most cases, to be small (less than 1,000 individuals). The degree of interchange of individuals between subpopulations is unclear but is assumed to be low, as there are currently no data that support such interchange, despite active efforts to do so (A. Marshall et al. unpubl. data 2011).

Photo-identification studies at major aggregation sites in southern Mozambique (Marshall 2009); southern Brazil (Luiz et al. 2009); Revillagigedo Islands, Mexico (Rubin 2002); the Ogasawara Islands, Japan (Yano et al. 1999a, Kashiwagi et al. 2010); the Maldives (G. Stevens unpubl. data 2011); Isla Holbox, Mexico (S. Hinojosa-Alvarez unpubl. data 2010); Isla de la Plata, Ecuador (M. Harding unpubl. data 2010) have databases of less than 300 individuals, with many of these studies having been underway for the last 10–20 years. A semi-exhaustive study of Japan-wide photographic records confirmed that the known main aggregation in Ogasawara Islands (42 known individuals during 1995–1998 study) represents a part of a fairly isolated population (Kashiwagi et al. 2010).

A mark-recapture population study in southern Mozambique over five years from 2003 to 2008 estimated the local population during that time to be 600 individuals (Marshall 2009). Flight surveys and re-sightings data of individuals at Isla Holbox, Mexico have estimated that roughly 100 manta rays use this area during every season (S. Hinojosa-Alvarez unpubl. data 2010).

While the Giant Manta Ray is widely distributed and appears to be a migratory species, regional populations appear to be small considering the scale of their habitat. Individuals most commonly show a degree of site fidelity to specific regions, as well as critical habitats within them, such as cleaning stations and feeding sites. Preliminary satellite tracking studies and international photo-identification matching projects have suggested a low degree of interchange between populations.

While there is a distinct paucity of information on population numbers or trends, local populations are likely to be in decline in areas where they are fished, or are under threat from anthropogenic influences e.g., India/Sri Lanka (Pillai 1998, Anderson et al. 2010), Indonesia (White et al. 2006), Philippines (Alava et al. 2002) and the west coast of Mexico where encounter rates have dropped significantly over the last five years or anthropogenic mortality has been elevated.

Overall, the rate of population reduction appears to be high in several regions, up to as much as 80% over the last three generations (approximately 75 years), and globally a decline of >30% is strongly suspected.

Historical fisheries data and reported declines in population numbers:

A study in the Pamilacan Island, Philippines reported that up to 1,000 rays, particularly manta rays (Giant Manta Ray) and a few species of the genus Mobula, were harvested per year in directed fisheries. Over 35 villages reportedly participated in this fishery. Seasons that started in September and went through until May or June the following year, peaked in the November and December months. Manta rays were fished with gaff hooks, hand spears, harpoons, and gillnets. Although these targeted fisheries were reported to have been active for generations (some claiming since the 1800s and others since the mid 1950s), interviewed fishermen noted that the catch-per-unit-effort (CPUE) and overall number of rays in the area has declined significantly in recent times. Record landings were reported in the 1960s (Alava et al. 2002).

Japanese sports divers suggest that the population of manta rays at one site in the Sulu Sea, Philippines (probably part of the same population fished at Pamilacan Island, Philippines) fell by one half to two-thirds in seven years from the end of the 1980s (M. Nishitani pers. comm.). Fishermen from this region reported a decrease in their CPUE and number of landings since the 1960s.

The Giant Manta Ray once occurred in large numbers along the west coast of Mexico and Baja California. The species appears to be rare after several decades of fishing. Manta rays were commonly used as shark bait, for local consumption and for export as ‘fake scallops’ (Booda 1984, Rubin 2002). A specific study of the fisheries (predominately gillnets, harpoons and baited hooks from engine powered fibreglass boats) in La Paz from 1981–1984 targeting rays in waters from 10–200 m revealed that 94% of the catch were mobulid rays, including manta rays in small numbers (Notarbartolo-di-Sciara 1987).

In the Yucatan Peninsula, Central America, manta rays were used as bait for shark fisheries, but recent legislation has prohibited this use. These actions have seemingly prevented the continued decrease of the species in Mexican Caribbean waters.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Vulnerable (VU) (A2abd+3bd+4abd)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
The main threat to both Manta species is fishing, whether targeted or incidental. Manta rays are currently killed or captured by a variety of methods including harpooning, netting and trawling. These rays are easy to target because of their large size, slow swimming speed, aggregative behaviour, predictable habitat use, and lack of human avoidance.

Manta species have a high value in international trade markets. Their gill rakers are particularly sought after and are used in Asian medicinal products. This market has resulted in directed fisheries for manta rays which are currently targeting these rays in unsustainable numbers. Over 1,000 manta rays are caught per year in some areas (Alava et al. 2002, Dewar 2002, White et al. 2006, C. Anderson and G. Stevens pers. obs.). Artisanal fisheries also target both species for food and local products (Essumang 2010, Marshall et al. 2011).

Aside from directed fisheries, manta rays are also incidentally caught as bycatch in both large-scale fisheries and small netting programs such as shark control bather protection nets (Carlson and Lee 2000, Young 2001). In some populations, such as the ones identified at Isla de la Plata, Ecuador, Laje de Santos, Brazil, and the Similan Islands, Thailand, high percentages of all individuals encountered or identified have evidence of entanglement or are dragging lines or nets (A. Marshall unpubl. data 2011).

As a result of sustained pressure from fishing (both directed and bycatch) certain monitored subpopulations appear to have been rapidly depleted (e.g., Gulf of California, Mexico; Indonesia; and, Philippines (Anon 1997, Alava et al. 2002, White et al. 2006)). Targeting either species of Manta at critical habitats or aggregation sites, where individuals can be caught in large numbers in a short time frame, is a particular threat. Regional populations of both species appear to be small, and localized declines are unlikely to be mitigated by immigration. This situation is exacerbated by the conservative life history of these rays, which constrain their ability to recover from a depleted state.

Cryptic threats such as mooring line entanglement and boat strikes can also wound manta rays, decrease fitness or contribute to non-natural mortality (Deakos et al. 2011). Many other threats have been postulated and identified such as habitat degradation, climate change, pollution (e.g., from oil spills), ingestion of micro plastics and irresponsible tourism practices.

Known directed fisheries:

Reported World Catch
Manta and devil ray catches increased from 900 tonnes to over 3,300 tonnes between 2000–2007 (FAO 2009, Lack and Sant 2009).

Trade-driven Fisheries
Manta rays, predominately the Giant Manta Ray, are currently taken in fisheries that have transitioned from bycatch fisheries to directed fisheries, with the birth of a market for manta ray products in Asia.

Chondrichthyan landings from drift gillnets were examined at four different sites (a total of 263 sampling days) in Indonesia from 2001 until 2005. Mobulid rays including manta rays were commonly represented in the catch, which was estimated to be approximately 4,110 individuals annually, a biomass of approximately 544 tonnes of which manta rays (Giant Manta Ray) comprised 13.7% (White et al. 2006). Individual manta rays were worth up to $200 in the early 2000s. Dried filter plates were being exported to Hong Kong, Taiwan and Singapore (for up to US$30 per dry kilo) (White et al. 2006).

Manta rays (predominately the Giant Manta Ray) are taken in significant numbers as bycatch in the Pakistani, Indian and Sri Lankan gillnet fisheries, where they are used as shark bait, for human consumption and their branchial filaments are sold to Asian buyers (Anderson et al. 2010, P. Hilton pers. comm. 2011, G. Stevens unpubl. data 2010).

Artisanal Fisheries
Manta rays are caught in artisanal fisheries in Tanzania on longlines and in trawls. The meat is typically dried and consumed (Bianchi 1985, Iddawi and Stanley 1999, N. Iddawi, S. Yahya and S. Semesi pers. comm. 2010, A. Marshall unpubl. data 2011).

Both species of Manta (but predominately the Reef Manta Ray) are caught in artisanal fisheries in southern Mozambique for consumption. Manta rays are typically harpooned but also caught in nets with motorized boats. Approximately 50 individuals are taken per annum from a 50 km stretch of coastline (A. Marshall unpubl. data).

Isolated reports of fishing for mantas have continued in the Gulf of California. Artisanal pelagic gillnet fishermen throughout the Gulf of California have been observed to retain mantas as bait as well as utilize landed specimens for personal consumption and sale.

There is a seasonal fishery for manta rays along the Ghanaian coastline, particularly in Dixcove. Manta rays are targeted in this region for local food (Essumang 2010).

Bycatch fisheries
Manta rays are caught in gillnet and purse seine fisheries as well as netting programs throughout their distribution. Specific cases are outlined below:

Giant Manta Rays are caught in small numbers as bycatch in the European purse seine tuna fishery operating in the Atlantic Ocean. Observer data from 2003-2007, which corresponded to 2.9% coverage, recorded 11 individuals landed, a number that represented 17.8% of the total ray bycatch (Amande et al. 2010).

Incidental catches of manta rays in the protective shark nets off the beaches of KwaZulu-Natal, South Africa, peak in the summer months (49% of the total annual catch), although manta rays are caught throughout the year (Young 2001). Manta rays (both species but predominately the Reef Manta Ray) comprised 16.9% of the total historical batoid catches from these nets, with a mean annual catch of 60 individuals and an overall 33.7% mortality rate (Young 2001).

Giant Manta Rays are caught as bycatch or are killed in fisheries along the west coast of Thailand and Myanmar, including within the Similans National Park where evidence suggests that a high proportion of individuals visiting the area have been entangled by fishing line or nets. Incidental kills have also been reported in fishing nets, tackle and ghost nets (A. Marshall unpubl. data 2011).

Giant Manta Rays are not generally directly targeted in Ecuador, although shark and ray catch data collected by the Subsecretaria de Recursos Pesqueros show occasional incidental capture and one small directed fishery since the mid-eighties. Many manta rays in the aggregation site around Isla de la Plata show damage received from fishing equipment, which occurs when artisanal fishermen use trawling tackle illegally within the Machalillia National Park boundaries to fish for seasonal aggregations of Wahoo (Acanthocybium solandri) which coincide with the seasonal aggregation of Giant Manta Rays (M. Harding unpubl. data 2010).

Although manta rays are not directly targeted by fisheries in southeastern Brazil, several reports of Giant Manta Rays being captured as bycatch show that local fishing poses a threat to manta rays (Zerbini and Kotas 1998). The Brazilian government is currently promoting a policy to boost commercial fisheries in the area, through financial incentives, raising concerns on the future of that manta ray population. Reports of individuals entangled within discarded fishing gear (e.g., ‘ghost nets’) are not uncommon (G. Kodja unpubl. data 2010). The main aggregation site for the Giant Manta Ray is located close to the Port of Santos, Latin America’s largest seaport, increasing the risk of ship strikes.

Surveys made of the bycatch from 52 sets from the shark drift net fishery off Georgia and east Florida, USA from 1992–1995 included 148 rays, 14 of which were recorded as being the Giant Manta Ray (Trent et al. 1997). Another study of the bycatch in the directed shark drift gillnet fishery off the east coast of Florida and Georgia, which was set 4.8 km offshore in EEZ waters from 1998–1999, revealed that manta rays are still occasionally caught in this fishery (Carlson and Lee 2000).

Fisheries bycatch data collected from the U.S. tuna purse seine fishery in the central-western Pacific in 1999 listed the Giant Manta Ray amongst the species caught with a set frequency of 1.5%. A total of 18 mantas were caught (1.14 t) during the observed period, 100% of which was discarded (Coan et al. 2000).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Manta rays were traditionally harvested for their oil-rich livers and for their skins, which were used as an abrasive (3); these practices centred on eastern Australia and the Gulf of California (2). The small litter size and yearly intervals between births means that populations are particularly vulnerable to exploitation and in the 1990s fisheries in the Philippines and Mexico decimated local populations (2). These ocean dwellers are also at risk from accidental catch by the fishing industry although the extent of this pressure is unknown (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
United States: In 2009, the Governor of Hawaii signed House Bill 366 creating Act 092(09) establishing criminal penalties and administrative fines for knowingly killing or capturing manta rays within State waters. This makes Hawaii the first state in the US union to protect manta rays. There have never been fisheries for manta rays in Hawaii, but this bill will protect all Manta species living in or passing through the island group from future fishing pressure.

Republic of Maldives: Since June 1995 there has been an export ban on all ray species and their body parts, effectively preventing any commercial fisheries from arising in this country, which has never targeted manta rays for local use in significant numbers. Furthermore, in June 2009 the Maldivian Government announced the creation of two new marine protected areas (MPAs), specifically identified for protection because of their importance as areas of critical habitats for the Maldives population of Reef Manta Ray and the occasional transient Giant Manta Ray.

Philippines: Fishing of manta rays was banned in 1998, but this ban was lifted in 1999 due to pressure from fishermen and lack of data on the fishery. During a year-long survey, from March 2002 to March 2003, 156 manta rays (the Giant Manta Ray) were caught, mostly in the months from November to January. Since the study, the ban has been re-established for manta rays. Mantas are now reported to be rare in the Philippines, especially around the Bohol Sea where the fishery was focused.

Mexico: Fishing was banned in Mexico in 2007, when the Mexican Government issued “NOM-029 - PESCA RESPONSABLE DE TIBURONES Y RAYAS. ESPECIFICACIONES PARA SU APROVECHAMIENTO” (The Mexican Official Standard Rules that Regulate the Shark and Ray Fisheries in Mexican Waters). This made it illegal to capture or kill Giant Manta Rays in Mexican waters. NOM 029 provides specific protection for mantas and mobulids in all Mexican waters and prohibits their possession and trade (Norma Oficial Mexicana Nom-029-Pesc-2006, pesca responsable de tiburones y rayas. Especificaciones para su aprovechamiento, 2005). Mantas are protected in MPAs within Mexican waters, primarily in the Revillagigedo biosphere, following enforcement of a fishing closure, which began in early 2002. Enforcement for this protection has been somewhat suspect as many fishing boats have been observed and caught deploying longlines, gillnets and seines within the biosphere, which extends as a 12 mile buffer around each of the islands in the archipelago. Meanwhile, since 2004, in the Yum Balam protected area (Isla Holbox, Mexico) manta rays have been protected under strict no fishing laws. The Giant Manta Ray is only used here for tourism purposes, although this new activity could also be affecting the population, with many individuals exhibiting boat injuries.

Brazil: There is no legal action concerning manta ray captures in Brazil. The local population is benefited by the fact that their best-known aggregation site happens to be inside an established MPA. However, it is a tiny fraction of the range of this species, as they migrate during most of the year and other unprotected aggregation sites are likely to exist. The rise of a local NGO (Instituto Laje Viva), dedicated to protect them, had eventually culminated in the first efforts to gather formal scientific data from Brazilian manta rays. The manta ray is a highly promoted flagship species for dive tourism in the region and best practices for responsible tourism have been largely advocated.

Ecuador: On 26 August 2010, the Subsecretaria de Recursos Pesqueros declared “Acuerdo 093”, a new law prohibiting all fishing of Manta and Mobula in Ecuador, that states 1). directed fishing for the Giant Manta Ray, and several mobulid species is now illegal via any form of fishing method whatsoever; 2). in the event of incidental capture any individuals must be returned immediately to their natural environment; 3). the species mentioned cannot be retained alive or dead, whole or in part, nor can they be kept for human consumption or owned, sold or transported. The law came in response to pressure to close a newly created directed fishery for Mobula that had arisen in a very short period via Peruvian buyers who were ordering the product for export.

Western Australia: Manta rays whilst not targeted, are protected from any fishing (Fisheries Act) and disturbance or harassment (DEC Act) within marine parks only.

New Zealand: Absolutely protected under the Wildlife Act 1953.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Tourism industries have sprung up in areas regularly visited by this graceful giant, which may help to preserve numbers. These practices carry their own risks however; manta rays may be distressed by close contact and can develop lesions on their skin if touched (2). Regulation of this industry will be important in allowing people to safely observe these awe-inspiring fish in the wild.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; price category: medium; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

Manta birostris have no adverse affects on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

In the past, Manta birostris was commercially hunted from small boats. Currently this species is rarely hunted. The biggest impact that the manta ray currently has comes from tourism, with dive industries being created for tourists who want to swim along side these gentle giants. Inquisitive mantas will approach and even solicit attention from divers, apparently enjoying the stimulation provided by human contact and the bubbles from scuba exhaust. Although, it has been recorded that manta rays that frequently encounter humans will shy away from contact with humans.

Positive Impacts: ecotourism

  • McCormick, H., T. Allen, W. Young. 1963. Shadows of the Sea. Philadelphia: Chilton Company.
  • Colla (oceanlight), P., R. Martin. 1998. "Giant Pacific Manta Ray Photos/On the Biology of the Manta Ray" (On-line). Phillip Colla Photography. Accessed 11/01/04 at http://www.oceanlight.com/html/manta_birostris.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Giant oceanic manta ray

Female scuba diver swims with a young male manta ray

The giant oceanic manta ray (Manta birostris), is a species of ray in the family Mobulidae, and the largest type of ray in the world. The largest recorded specimen was more than 7.6 metres (25 ft) across, with a weight of about 2,400 kilograms (5,300 lb). They are circumglobal and are typically found in tropical and subtropical waters, and can also be found in temperate waters.[3] Oceanic mantas reside in deepwater, pelagic zones, making periodic visits to cleaning stations at seamounts and coastal reefs. Minimal concrete information exists on oceanic manta movements, but they are generally believed to be more transient and migratory than the smaller Reef Manta Ray, which tend to be resident to shallower coastal habitats. Manta rays have the largest brain-to-body ratio of any animal of their kin, with ratios rivaling what is expected in amniotes rather than in fish.[4]

See also

References

  1. ^ Sepkoski, Jack (2002). "A compendium of fossil marine animal genera (Chondrichthyes entry)". Bulletins of American Paleontology 364: 560. Retrieved 2008-01-09. 
  2. ^ Marshall, A., Bennett, M.B., Kodja, G., Hinojosa-Alvarez, S., Galvan-Magana, F., Harding, M., Stevens, G. & Kashiwagi, T. (2011). "Manta birostris". IUCN Red List of Threatened Species. Version 2011.2. International Union for Conservation of Nature. Retrieved 30 January 2011. 
  3. ^ "Mantas at a Glance". The Manta Trust. 2011. Retrieved 2012-04-04. 
  4. ^ "Manta Rays". The Hawaii Association for Marine Education and Research, Inc. 2005. Retrieved 2007-12-09. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!