Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Brief Summary

Anguilla marmorata, known by many common names including the marbled eel, giant mottled eel and long finned eel, is one of about 19 species in its genus, the only genus in the small freshwater eel family Anguillidae. Of the angillid eels, the marbled eel has the widest distribution, found in several discrete but intermixing populations throughout the tropics and subtropics across the southwestern and central Pacific ocean, in the northwestern Pacific as far north as Japan, and in the southeastern Indian ocean to southern Africa (Wanatabe et al. 2008, 2009; Gagnaire et al. 2011).  It has been recorded in small numbers from the Galapagos (McCosker et al. 2003) though whether this is the edge of their natural range or an introduction is unclear (Vishwanath and Mailautoka 2012). 

Marbled eels, like other anguillid eels, have a complex life history, spending most of their life in the “yellow eel growth phase,” during which they inhabit the bottoms of fresh and brackish continental waters.  This can last 2-3 years in warmer regions and up to 20 years in colder northern areas.  The eels then migrate long distances as “silver eels” to spawning regions in open ocean gullies located at depths of 150-300 meters (500-1540 feet).  The spawning areas for the different marbled eel populations are not well identified, although those in the northern pacific are known to share spawning areas in the Mariana trench with the Japanese eel Anguilla marmorata (Tsukamoto 2011).  The planktonic larvae hatch at sea and develop into glass eel larvae to return to continental waters.  There they metamorphose into the pigmented elver stage whereupon they begin to feed and travel in schools to freshwater inland rivers, lakes, streams and estuaries where they complete their development.  In areas of large shallow coastal seas, they may stay as elvers without migrating upstream to fresh waters (Vishwanath and Mailautoka 2012).

Distinguished by their mottled brown, green and yellow coloration, adults reach up to 2 meters (6.6 feet) in length; one of the largest angillids.  They are usually encased in slime making them very slippery.  Nocturnal carnivores, the adult eels eat a diverse diet rich in fish, amphibians and invertebrates such as crab and shrimp (Froese and Pauly 2006).  Like other anguillid eels, the marbled eel is a sought-after commercial food fish, eaten at many of its developmental stages, and its fishery may well expand as other species of angillids decline (especially A. anguilla and A. japonica).  Currently it is listed by the IUCN as of least concern at it is common throughout its wide range, however its potential vulnerability to decline due to fisheries pressure and habitat loss is recognized as an important parameter to monitor (Vishwanath and Mailautoka 2012).

  • Froese, Rainer and Pauly, Daniel, eds. (2006). "Anguilla marmorata" in FishBase. February 2006 version. Retrieved September 18, 2013 from http://www.fishbase.org/summary/Anguilla-marmorata.html.
  • Gagnaire, P.-A., Minegishi, Y., Zenboudji, S., Valade, P., Aoyama, J. and Berrebi, P. 2011. Within-population structure highlighted by differential introgression across semipermeable barriers to gene flow in Anguilla marmorata. Evolution 65: 3413–3427
  • McCosker, J. , Bustamante, R., Wellington, G. 2003. The Freshwater Eel, Anguilla Marmorata, Discovered in Galápagos. Noticias de Galápagos 62, Available online from http://www.galapagos.org/pdf/Noticias62.pdf.
  • Tsukamoto, K., Chow, S., Otake, T., Mochioka, N., Miller, M. J., Aoyama, J., Kimura, S., Watanabe, S., Yoshinaga, T., Shinoda, A., Kuroki, M., Oya, M., Watanabe, T., Hata, K., Ijiri, S., Kazeto, Y., Nomura, K., Tanaka, H. 2011. Oceanic spawning ecology of freshwater eels in the western North Pacific. Nature Communications 2:179. doi: 10.1038/ncomms1174.
  • Vishwanath, W. & Mailautoka, K. 2012. Anguilla marmorata. In: IUCN 2013. IUCN Red List of Threatened Species. Version 2013.1. . Downloaded on 18 September 2013.
  • Watanabe, S., Aoyama, J., Miller, M.J., Ishikawa, S., Feunteun, E., and Tsukamoto, K. 2008. Evidence of population structure in the giant mottled eel, Anguilla marmorata,using total number of vertebrae. Copeia 2008: 681–689.
  • Watanabe, S., Miller, M.J., Aoyama, J., Tsukamoto, K. 2009. Morphological and meristic evaluation of the population structure of Anguilla marmorata across its range. Journal of Fish Biology 74(9): 2069–2093.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

© Dana Campbell

Supplier: Dana Campbell

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Description

  Common names: eel (English), anguilla (Espanol)
 
Anguilla marmorata Quoy and Gaimard, 1824

Giant mottled freshwater eel



Body robust; compressed at rear; mouth reaching to under rear edge of eye, lower jaw projecting; lips thick; teeth minute, in bands on jaws and a patch that conspicuously narrows in its middle on roof of mouth, jaw teeth with toothless groove separating inner and outer teeth; with large pectoral fins; dorsal fin origin well behind pectoral fin; dorsal and anal fins continuous with tail fin; lateral line complete but pores very small; small imbedded scales arranged in basket-weave pattern present in adults but not juveniles; 100-110 vertebrae.

Yellowish to olive or brown, mottled with dark greenish brown, lighter below; all fins dark.

Reaches 2 m.

0-2 m depth.

Widely distributed in the Indo-central Pacific; recently found in the Galapagos, where it evidently is a vagrant. Adults in fresh to brackish water, migrate long distances to spawning grounds in deep gyres in the open ocean; larvae marine.
   
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Live in freshwater areas as adults, estuaries and seas as young (Ref. 12693). Found in lowland rivers as well as upland tributaries (Ref. 2847). While in river, the sex gland does not develop. But in winter when they move from the stream to river mouth, the sex gland begins to develop as mature individuals go to deep sea to breed (Ref. 45563). The spawning grounds are deep sea gullies among the south of the Philippines, east of Indonesia and Papua New Guinea (Ref. 45563). Are active at night, feeding on a wide range of prey (Ref. 7248, 79840), especially crabs, frogs and fish (Ref. 7248). Thought to breed east of Madagascar where the young are wafted to the East Coast by ocean currents (Ref. 13337, 79840).
  • Castle, P.H.J. 1984 Anguillidae. p. 34-37. In J. Daget, J.-P. Gosse and D.F.E. Thys van den Audenaerde (eds.) Check-list of the freshwater fishes of Africa (CLOFFA). ORSTOM, Paris and MRAC, Tervuren. Vol. 1. (Ref. 3506)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Anguilla marmorata is the second largest species of anguillid with the widest geographical distribution across two different ocean basins (tropical and subtropical western-central Pacific and Indian Oceans). Its range covers the East Coast of Africa, east across the Indian Ocean (Ege 1939), including India and Sri Lanka, the Indo-Pacific region (including Indonesia, Philippines, Papua New Guinea) and as far East as the island chains in the central South Pacific (e.g., the Marquesas Islands, French Polynesia). Latitudinally, this species ranges from Southwestern Japan, Taiwan and southeastern China (e.g., Upper Mekong, Yangtze, Xijiang and Zhujiang rivers - Kuang 1991, Wang 1998) south through Viet Nam, Malaysia with its most southern distribution being the Southern Cape in South Africa (Watanabe et al. 2009). In Africa it is restricted to southern Africa, more common south of the Limpopo River (Skelton 2001). Individuals have recently been found in the Pacific in the Palmyra Atoll and as far east as the Galapagos Islands (McCosker et al. 2003), although it is not known if these are the result of natural migration, vagrant individuals, or introduction. The species is at the edge of its range here and inland distribution is limited (Tesch 2003).

According to Minegishi et al. (2008), the proposed North Pacific subpopulation is fully panmictic whereas the South Pacific and Indian Ocean populations have a metapopulation structure. Genetic studies have revealed the non-native occurrence of A. marmorata in Hawaii, reported in the 2006 Records of the Hawaii biological Survey (James and Suzumoto 2006).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-Pacific: East Africa, inland Mozambique and lower Zambezi River to French Polynesia, north to southern Japan.
  • Kottelat, M., A.J. Whitten, S.N. Kartikasari and S. Wirjoatmodjo 1993 Freshwater fishes of Western Indonesia and Sulawesi. Periplus Editions, Hong Kong. 221 p. (Ref. 7050)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific 
 
Global Endemism: All species, TEP non-endemic, Indo-Pacific only (Indian + Pacific Oceans), "Transpacific" (East + Central &/or West Pacific), All Pacific (West + Central + East)

Regional Endemism: All species, Tropical Eastern Pacific (TEP) non-endemic, Island (s), Island (s) only

Residency: Vagrant

Climate Zone: Equatorial (Costa Rica to Ecuador + Galapagos, Clipperton, Cocos, Malpelo)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Africa, Asia, Australia, Indo-West Pacific: South African and East African watersheds and adjacent oceanic waters (including Madagascar and Mascarenes) east to Caroline Islands (Micronesia), Mariana Islands and Marquesas Islands, north to southern Japan,
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth

Depth Range (m): 0 (S) - 2 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Vertebrae: 100 - 110
  • Smith, D.G. 1999 Anguillidae. Freshwater eels. p. 1630-1636. In K.E. Carpenter and V.H. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the WCP. Vol. 3. Batoid fishes, chimaeras and bony fishes part 1 (Elopidae to Linophrynidae). FAO, Rome. (Ref. 9828)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length max (cm): 200.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 2000 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

70.0 cm TL (male/unsexed; (Ref. 57749)); 200 cm TL (female); max. published weight: 20.5 kg (Ref. 13337); max. published weight: 15 kg; max. reported age: 40 years (Ref. 48660)
  • Bell-Cross, G. and J.L. Minshull 1988 The fishes of Zimbabwe. National Museums and Monuments of Zimbabwe, Harare, Zimbabwe. 294 p. (Ref. 13337)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Inhabits deep rocky pools and is active at night, feeding on a wide range of prey, especially crabs, frogs and fish (Ref. 7248).
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Adults have a brownish to black marbling on their back on a greyish yellow background. This coloration can fade away. White belly. Younger specimens are greyish to orange and the marbling is less visible (Ref. 48622). Body color brown speckles scattered on back, sides and fins; yellow between speckles and edge of pectoral fin; belly white or pale blue (Ref. 45563). Head rounded; snout depressed; lower jaw protruded; gill openings small; scales matted-like under skin; pectoral fin rounded; pelvic fin absent (Ref. 45563). Distinguished from all other species by the mottled color and the long dorsal fin, which begins closer to the gill opening than to the anus (Ref. 9828).
  • Smith, D.G. 1999 Anguillidae. Freshwater eels. p. 1630-1636. In K.E. Carpenter and V.H. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the WCP. Vol. 3. Batoid fishes, chimaeras and bony fishes part 1 (Elopidae to Linophrynidae). FAO, Rome. (Ref. 9828)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Zambezi River Demersal Habitat

This taxon is one of a number of demersal species in the Zambezi River system of southern Africa. Demersal river fish are found at the river bottom, feeding on benthos and zooplankton

Nutrient levels in the Zambezi River are relatively low, especially in the upper Zambezi; in that reach, above Victoria Falls, most of the catchment drains Kalahari sands, whose nutrient levels are inherently low due to their aeolian formation; moreover, agricultural fertilizer addition throughout the Zambezi watershed is low, due to the shortage of capital available to farmers of this region.

Nitrate levels (as nitrogen) in the upper Zambezi are typically in the range of .01 to .03 milligrams per liter. Correspondingly electrical conductivity of the upper Zambezi is on the order of 75 micro-S per centimeter, due to the paucity of ion content. From the Luangwa River downstream nitrate levels elevate to .10 to .18 milligrams per liter, and electrical conductivity rises to a range of two to four times the upper Zambezi levels. Not surprisingly, pH, calcium ion concentration, bicarbonate and electrical conductivity are all higher in portions of the catchment where limestone soils predominate compared to granite.

There are a total of 190 fish species present in the Zambezi River, including eel and shark taxa. The largest native demersal species present are the 117 centimeter (cm) long tiger fish (Hydrocynus vittatus), the 175 cm African mottled eel (Anguilla bengalensis labiata), the 120 cm Indonesian shortfin eel (Anguilla bicolor bicolor), the 200 cm Giant mottled eel (Anguilla marmorata), the 150 cm African longfin eel (Anguilla mossambica), the 183 cm Sampa (Heterobranchus longifilis), the 150 cm Cornish jack (Mormyrops anguilloides) and the 700 cm largetooth sawfish (Pristis microdon).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© C.Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Yangtze River Demersal Habitat

This taxon is one of a number of demersal species in the Yangtze River system. Demersal river fish are found at the river bottom, feeding on benthos and zooplankton.

The upper Yangtze basin consists chiefly of Paleozoic limestone and terrigenous sedimentary rock, with some granitic material. The most downstream element of the upper Yangtze basin is often termed the Sichuan Basin; here the Yangtze cuts through Triassic and Permian material before entering the Three Gorges. The Three Gorges area is a stretch of the Yangtze that runs approximately 660 kilometers, terminating at the site of the Three Gorges Dam. Prior to construction of the dam, the Three Gorges area was a site of exceptional natural beauty; after dam construction the gorge areas were filled with approximately 100 meters in depth of Yangtze water, and considerable amounts of the watershed were graded.

The lower Yangtze basin consists of anabranching river structures and Pleistocene coastal terraces. Prior to development of the Three Gorges Dam, the Yangtze Delta was replenished with a copious sediment load reaching the river mouth; however, the dam has now severely limited the natural flow and deposition of sediment to the delta region. Consequently, the integrity of the delta is been compromised, with scouring exceeding deposition, and the very stability of the delta is endangered.

Lower and middle basins of the Yangtze carry heavy pollutant loads. In the lower Yangtze basin nitrate levels are high, measuring at about 1000 tons per day at Datong; these levels accrue from high applications of chemical fertilizer applied and also considerable loadings of untreated sewage due to the large human population of the basin, with correspondingly little infrastructure for sewage treatment.

Heavy metal concentrations are also high in the lower Yangtze, with measurements of dissolved lead at 0.078 microgram/liter; cadmium (0.024 microgram/liter), chromium (0.57 microgram/liter), copper (1.9 microgram/liter), and nickel (0.50 microgram/liter). Levels of dissolved arsenic have been measured at 3.3 microgram/liter) and zinc at 1.5 microgram/liter), both notably higher by factors of 5.5 and 2.5 respectively than other typical large world rivers. In Yangtze River suspended sediment, arsenic comprises 31 microgram/gram, lead comprises 83 microgram/gram, and nickel comprises 52 micrograms/gram of sediment content

There are several large native demersal fish found in the Yangtze River, chiefly the 250 centimeter (cm) long endangered Yangtze sturgeon (Acipenser dabryanus), the 120 cm Chinese sturgeon (Acipenser sinensis), the 200 cm Giant mottled eel (Anguilla marmorata), the 122 cm black carp (Mylopharyngodon piceus), the 300 cm Chinese paddlefish (Psephurus gladius), and the 100 cm Silurus meridionalis. Furthermore, there are a few exceptionally large native benthopelagic fishes found in the Yangtze, namely, the 105 cm Silver carp (Hypophthalmichthys molitrix), the 200 cm Wuchang bream (Megalobrama amblycephala), the 200 cm yellowcheek (Elopichthys bambusa), the 145 cm common carp (Cyprinus carpio carpio), the 122 cm Mongolian redfin (Chanodichthys mongolicus), the 102 cm predatory carp (Chanodichthys erythropterus) and the 100 cm snakehead (Channa argus argus).. The demersal fish Silurus meridionalis also is found as a Yangtze River endemic species.

Creative Commons Attribution 3.0 (CC BY 3.0)

© C.Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Habitat and Ecology

Habitat and Ecology

Anguilla marmorata is facultatively catadromous, being found in freshwater, brackish and saline habitats during its continental growth stages (Briones et al. 2007, Lin et al. 2012). The yellow eel growth stage may be as short as two to three years in warm productive habitats, but about six to 20 years or more in more northerly latitudes, e.g. in the Pearl River, China (Williamson and Boëtius 1994). Maturing silver eels migrate to deep oligotrophic sea regions, spawning at depths of 150 to 300 m.

Spawning occurs in the same oceanic areas as other anguillids, such as Anguilla japonica (Kuroki et al. 2009a, Pous et al. 2010, Tsukamoto et al. 2011). The spawning areas of the other proposed subpopulations in this species have not been well identified yet (Réveillac et al. 2008, Robinet et al. 2008, Pous et al. 2010, Kuroki et al. 2008, E. Feunteun pers. comm. 2012), except for the north Pacific population, where adult spawners were found west of the Mariana Islands (Chow et al. 2009) and the early-stage larvae (pre-leptocephali) were found in the same area (Kuroki et al. 2009a). Extensive collections were made of the larvae of A. japonica and A. marmorata of the North Pacific population in an overlapping area of the North Equatorial Current region of the western North Pacific Ocean, but their spawning strategies appear to be different (Kuroki et al. 2009a). The geographic distribution of the growth stages of the species in relation to other anguillids is affected by gyre and coastal currents, spawning times and growth rates and duration of the larval (leptocephalus) stage. The leptocephali of A. marmorata spend about 114-132 days drifting in the plankton before recruiting to river mouths. Ages at metamorphosis from the larval stage and recruitment are thought to be approximately 125 and 155 days respectively (Arai et al. 2002). The recruitment is relatively greater on the east coast of Taiwan compared to the west (Han et al. 2012, Leander et al. 2012). The species may also show preferences for upstream freshwater habitats, but competition with other eel species and environmental factors may influence choices (Shiao et al. 2001, Briones et al. 2007, Robinet et al. 2007).

Leptocephali follow oceanic gyre currents and during this time they metamorphose into glass eels before migrating towards continental habitats (e.g., Robinet et al. 2008, Kuroki et al. 2009b, Pous et al. 2010). They then develop pigment during the elver stage, commence feeding and become yellow eels in either brackish or freshwater habitats. Regarding recruitment to freshwater habitat, as a general rule if the edge of the continental plate is steep (this usually results in short high gradient streams and low-diversity fauna) the elvers ascend the streams (Annamite slope, Philippines, east Borneo, Sulawesi, Indian Ocean slope of Sumatra and Java, Thailand between Phuket and Ranong, etc). If it is an extensive shallow coastal sea (e.g., Sunda shelf), only occasional stray individuals enter freshwater (for example, the Chao Phraya and Mekong estuaries) (M. Kottelat pers. comm. 2011). Most often A marmorata is found in running clear water and seems to avoid still and backwaters. When they are found in sympatry with other anguillid species, they seem to be preferentially located in the mid part of rivers avoiding both high and low altitudes.


Systems
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; catadromous (Ref. 51243); freshwater; brackish; marine; depth range 1 - 400 m (Ref. 6898)
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
  • Shao, K.-T. and P.L. Lim 1991 Fishes of freshwater and estuary. Encyclopedia of field guide in Taiwan. Recreation Press, Co., Ltd., Taipei. vol. 31. 240 p. (in Chinese). (Ref. 6898)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 84 specimens in 1 taxon.
Water temperature and chemistry ranges based on 69 samples.

Environmental ranges
  Depth range (m): 0.4 - 8.5
  Temperature range (°C): 28.723 - 28.954
  Nitrate (umol/L): 0.050 - 0.099
  Salinity (PPS): 34.131 - 34.205
  Oxygen (ml/l): 4.472 - 4.525
  Phosphate (umol/l): 0.113 - 0.160
  Silicate (umol/l): 1.305 - 1.579

Graphical representation

Depth range (m): 0.4 - 8.5

Temperature range (°C): 28.723 - 28.954

Nitrate (umol/L): 0.050 - 0.099

Salinity (PPS): 34.131 - 34.205

Oxygen (ml/l): 4.472 - 4.525

Phosphate (umol/l): 0.113 - 0.160

Silicate (umol/l): 1.305 - 1.579
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Salinity: Brackish, Freshwater, Non Marine

Inshore/Offshore: Inshore, Inshore Only

Water Column Position: Bottom, Bottom only

Habitat: Reef (rock &/or coral), Rocks, Reef and soft bottom, Soft bottom (mud, sand,gravel, beach, estuary & mangrove), Estuary, Freshwater

FishBase Habitat: Demersal
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Catadromous. Migrating from freshwater to the sea to spawn, e.g., European eels. Subdivision of diadromous. Migrations should be cyclical and predictable and cover more than 100 km.
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Catadromous; lives in inland waters such as river mouths, marshes, rivers, streams, lakes and ponds. Inhabits deep rocky pools (Ref. 7248). It hides in holes and stone crevices in daylight. Found in lowland rivers as well as upland tributaries (Ref. 2847). While in rivers, the sex gland of the fish does not develop and in winter it follows streams to river mouths where the sex gland begins to develop and afterwards it goes to deep sea to breed (Ref. 45563). Active at night, feeding on a wide range of prey (Ref. 7248). Feeds on fishes, shrimps, crabs and carcass of large animals fallen into the water (Refs. 7248, 45563) and frogs (Ref. 7248).
  • Rainboth, W.J. 1996 Fishes of the Cambodian Mekong. FAO Species Identification Field Guide for Fishery Purposes. FAO, Rome, 265 p. (Ref. 12693)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Feeding

Feeding Group: Carnivore

Diet: mobile benthic crustacea (shrimps/crabs), bony fishes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diseases and Parasites

Galactosomum Infestation. Parasitic infestations (protozoa, worms, etc.)
  • Arthur, J.R. and S. Lumanlan-Mayo 1997 Checklist of the parasites of fishes of the Philippines. FAO Fish. Tech. Pap. 369, 102 p. FAO, Rome. (Ref. 26129)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Bothriocephalus Infestation 1. Parasitic infestations (protozoa, worms, etc.)
  • Arthur, J.R. and S. Lumanlan-Mayo 1997 Checklist of the parasites of fishes of the Philippines. FAO Fish. Tech. Pap. 369, 102 p. FAO, Rome. (Ref. 26129)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

Egg Type: Pelagic, Pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Anguilla marmorata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGGCAATCACCCGTTGATTCTTTTCTACTAATCACAAAGACATTGGTACCCTATATCTAGTATTTGGTGCCTGAGCCGGAATGGTGGGAACCGCACTAAGCCTTCTAATCCGTGCCGAATTAAGTCAACCAGGCGCCCTTCTTGGAGATGACCAAATTTACAATGTCATCGTCACAGCGCATGCCTTTGTAATGATTTTCTTTATAGTAATACCAGTAATAATTGGAGGATTTGGCAACTGACTTGTGCCATTAATGATCGGCGCTCCAGACATAGCATTTCCCCGAATAAACAATATAAGCTTCTGACTCTTACCACCATCATTTCTCCTTCTACTAGCCTCCTCAGGAGTAGAAGCTGGGGCTGGTACAGGTTGAACTGTATATCCGCCTCTAGCTGGAAACTTAGCCCACGCCGGAGCATCTGTTGACCTGACAATTTTCTCGCTTCACCTTGCAGGAATTTCATCAATCCTAGGAGCCATTAATTTTATCACTACAATTATTAACATGAAACCGCCTGCCATTACACAATACCAAACCCCTCTGTTTGTATGAGCTGTTTTAGTCACCGCTGTTCTACTACTCCTATCCCTACCAGTCCTAGCTGCAGGTATTACAATACTTCTGACTGACCGAAACTTAAATACAACCTTCTTTGACCCTGCAGGAGGTGGAGACCCAATCCTCTACCAACACCTATTCTGATTCTTTGGTCATCCAGAAGTATACATTTTAATCTTACCAGGGTTTGGAATAATCTCACACATTGTTGCTTATTACTCCGGTAAGAAAGAACCATTTGGGTATATAGGAATGGTCTGAGCAATAATGGCTATCGGACTTCTAGGATTCATTGTTTGAGCACACCATATGTTTACAGTAGGAATAGATGTAGACACCCGTGCCTACTTCACTTCTGCCACAATAATCATCGCAATTCCAACTGGAGTAAAAGTATTCAGCTGACTAGCCACATTACACGGAGGGGCCATCAAATGAGAAACTCCACTCCTTTGAGCTTTAGGCTTTATTTTCCTATTTACAGTTGGTGGTTTAACAGGTATTGTACTAGCAAACTCATCAATCGATATTGTATTACATGACACATACTATGTAGTAGCTCATTTCCATTATGTTTTATCCATAGGAGCAGTCTTTGCTATTATAGGGGGCTTTGTACACTGATTCCCACTGTTTTCAGGATATACACTACACGACACATGAACCAAAGTACACTTTGGAATTATATTCGTAGGGGTAAACCTAACCTTCTTCCCACAACATTTCCTAGGATTAGCAGGAATACCACGACGTTATTCAGACTACCCAGATGCATACACCCTGTGAAACACAATCTCCTCTATTGGATCACTAATTTCCCTCACAGCCGTAGTCCTATTCCTATTCATCCTCTGAGAAGCATTCACTGCCAAACGAGAAGTAAAATGAGTAGAACTCACAGAAACAAACGTTGAATGACTACACGGATGTCCTCCACCATACCACACATTCGAAGAACCAGCGTACGTCCGAGTCCAACCGCCCTCAGATGATCAAAAATCAGAAGCCAAAGCCCACATTCAAGAAAGG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Anguilla marmorata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 17
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2014

Assessor/s
Jacoby, D. & Gollock, M.

Reviewer/s
Feunteun, E., Larson, H., Schabetsberger, R., Tsukamoto, K., Turnock, S. & Weyl, O.

Contributor/s
Ahn, H., Bennett, L., Bills, R., Cambray, J., Casselman, J., Crook, V., DeLucia, M., Engelbrecht, J., Kaifu, k., Kottelat, M., Kurwie, T., Larson, H., Mailautoka, K., Marshall, B., Sasal, P., Silfvergrip, A., Uchida, K., Vishwanath, W. & Walker, M

Justification

This species has a wide distribution throughout most of the tropical and subtropical western-central Pacific and Indian Oceans and associated freshwater systems. It is considered Least Concern at present as there is no evidence of population declines, nor have any major threats to the whole population been identified, however exploitation, water management, reclamation of wetlands, dams and pollution does occur across many of the countries in its range so increased monitoring of the population is required. Additionally, there is still relatively little known about the extent to which changing oceanic currents and/or temperature changes impact the recruitment of glass eels to maturing grounds, as is the case for all anguillids. Further research is certainly needed in this area. Regionally, the species is impacted by local threats, and local declines have been shown in some areas such as Réunion Island due to over fishing and Madagascar due to river management (e.g., rice culture in Madagascar which has led to the disappearance of silver eel stocks in the Highlands of Tananarive).

This species is a highly commercial food fish and as such yellow and silver life stages could be vulnerable to over fishing whilst glass eels of A. marmorata are used for seed-stock for farming. In Madagascar, an extensive glass eel fishery (several tens of tons) is in operation. Restrictions on supplies of other species, such as the ban on export of Anguilla anguilla outside of the European Union, to global markets could also stimulate increasing exploitation. Habitat loss and degradation and migration barriers could also become a problem in many parts of its range. Thus recruitment, populations, habitats and fisheries should be carefully monitored, and the species reassessed if further data become available as the current level of perturbation could, if neglected, easily push A. marmorata into a Near Threatened or threatened category.

Debate over the number of isolated subpopulations and the number of spawning grounds that exist continues and will likely prove a significant area of future research. Once resolved the spawning population(s) will require localised management and conservation strategies considering each as a distinct ecological unit (Watanabe et al. 2013).

Assessment of this species was carried out during a workshop held at the Zoological Society of London from July 1st-5th, 2013.

History
  • 2012
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population

This is a widely distributed species, with a range spanning two oceans, and as such there is considerable debate as to how many subpopulations of A. marmorata exist and equally how many different spawning grounds there are. Morphological analyses carried out on specimens from multiple localities throughout its range suggest that there are at least four subpopulations (North Pacific, Micronesia, Indian Ocean and South Pacific) with metapopulation structure evident in the Indian Ocean and South Pacific (Watanabe et al. 2008, 2009). Molecular genetic research varies somewhat: Ishikawa et al. (2004) found differences among geographic samples that revealed the existence of five geographic subpopulations around North Pacific, Madagascar, Sumatra, Fiji, and Tahiti. Minegishi et al. (2008) were more consistent with the molecular analyses proposing four genetically different subpopulations (North Pacific, South Pacific, Indian Ocean, Guam region), offering that the North Pacific population is fully panmictic with some meta-population structure in the South Pacific and Indian Ocean populations. More recently however, Gagnaire et al. (2011) suggest the existence of just three genetically distinct subpopulations, spawning in the North Pacific, South Pacific and Southwest Indian Ocean, showing partial reproductive and hence genetic isolation but with some inter-population gene flow occurring due to long-distance migration mixing. Thus the species is probably panmictic at the regional scale and partial mixing may promote complete panmixia over very long-time scales. It is thought that the different subpopulations are closely associated with the water mass structure of the oceans with new current systems being exploited as the species expanded its range (Ishikawa et al. 2004). Despite the uncertainty surrounding the sub-population structure, the spawning localities and thus the taxonomy of this species, spawning populations should be considered separate from a management and conservation perspective, regardless of the taxonomic category (Watanabe et al. 2013).

There is no detailed information on population size, but numbers would be expected to decrease with distance from spawning grounds and with distance from the sea in freshwaters, as in other anguillids. A recent study shows that when estimated using molecular techniques, the effective population size of A marmorata is much smaller than in all other eel species (Delgado 2013). This suggests a higher vulnerability of A. marmorata to bottlenecks and population decline than in any other species. In the Indian Ocean, upstream migration of elvers into freshwater habitats does occur year round but is most pronounced between January and April. In this region particularly, upstream invasion patterns of A. marmorata elvers appear to be synchronized with regular cyclonic floods (Robinet et al. 2003). Subpopulations are impacted by local threats, and local declines have been shown in some areas such as Réunion Island and Madagascar due to river management (rice culture in Madagascar which has lead to the disappearance of silver eel stocks in the Highlands of Tananarive and over fishing in Réunion Island) (E. Feunteun pers. comm. 2012). Population declines have also been reported from China (E. Feunteun pers. comm. 2013) and Japan (K. Tsukamoto pers. comm. 2014).


Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
River management, water impoundment, overfishing and pollution could impact this species. In southern Africa, in the upper catchments in Mozambique, all Anguilla species are susceptible to hook and line fishing and poisoning by subsistence fisherman. Within all countries, major impoundments and weirs are barriers to upstream eel movement (Wasserman et al. 2011) and mortalities can occur on downstream passage of silver eels through turbines and pumps. In developing countries, hydroelectric capacity is being rapidly developed and fish passage requirements are scarcely taken into account (e.g., Roberts 2004). Loss and/or deterioration of habitats due to land drainage and reclamation and pollution may become problems in parts of the species range. Development of farming initiatives could locally threaten this species as this will require the collection of glass eels and elvers in estuaries as seed stock. In central Vietnam, this species has been shown to accumulate, in their muscle tissue, high levels of trace metals (Cr, Mn, Co, Cu, Zn, Sr, Cd and Pb) suggesting pollution poses a threat to some subpopulations and consumers (Le et al. 2009).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions

The species has been assessed as 'II Rare and Valuable’ in the Wildlife Conservation Act Republic of China (Taiwan) Article 4 (Wang 1998). In some areas, this species is designated as a “Natural monument” (protected animals) in Japan, clearly indicating this species is quite rare in the country. Further research is required to confirm the species spawning areas, continental distributions, key habitats and vulnerabilities, especially of different populations.

Coordination between countries to define and implement regional management plans are strongly requested and do not exist yet. This species was previously assessed as Least Concern in 2012 (Vishwanath and Mailautoka 2012).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; aquaculture: commercial; gamefish: yes
  • International Game Fish Association 1991 World record game fishes. International Game Fish Association, Florida, USA. (Ref. 4699)
  • Robins, C.R., R.M. Bailey, C.E. Bond, J.R. Brooker, E.A. Lachner, R.N. Lea and W.B. Scott 1991 World fishes important to North Americans. Exclusive of species from the continental waters of the United States and Canada. Am. Fish. Soc. Spec. Publ. (21):243 p. (Ref. 4537)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Marbled eel

The marbled eel, also known as the giant mottled eel, Anguilla marmorata, is a species of tropical anguillid eel that is found in the Indo-Pacific and adjacent freshwater habitats.[2]

Distribution[edit]

This anguillid species can be found from East Africa to French Polynesia and as far north as southern Japan.[2][3][4] In Africa, it may be found within Mozambique and the lower Zambezi River.[2] The marbled eel has the widest distribution of all the Anguilla eels.[3][5] It is usually found in tropical climates between 24°N to 33°S.[2] It has also been found in other more distant regions such as the Galapagos possibly due to abnormal larval transport associated with El Niño-Southern Oscillation events.[6] It is not on the IUCN Red List of Threatened Species, but in Taiwan, it is endangered.[3][7]

In 2002, a single eel was captured from a pond close to Kaupo, Maui, Hawaii, though it is not indigenous to the area.[3]

Physical description[edit]

Similar to other anguillids, the marbled eel is cylindrical with small, well-developed pectoral fins and a protruding lower jaw.[3] The eel has thick, fleshy lips.[3] The eel has dorsal and anal fins that are continuous around the tail, with the origin of the dorsal-fin origin between the pectoral fins and anus.[3] It has small, oval-shaped scales that are embedded in the skin.[3]

Unlike some other anguillid species, the marbled eel has a mottled color.[2][3] The adult eels are yellow with a greenish-brown to black marbling on their back and a white belly.[2][3] The young elvers have less visible marbling and are grayish to yellow.[2][3] The dorsal fin of the marbled eel is closer to the gill opening than to the anus, more anterior than other species of Anguilla.[3] Like all anguillid eels, it does not have pelvic fins.[8] The head is rounded and the snout is depressed.[8] Its teeth are small and in bands.[8] It has a total of 100 to 110 vertebrae.[2]

It can grow up to 2 meters (6.6 ft) for females and 1.5 meters (4.9 ft) for males and can weigh up to 20.5 kilograms (45 lb),[2] which is larger than most other species of anguillid eels. The marbled eel can live up to about 40 years.[3]

Ecology and behaviour[edit]

Life cycle of eels

The adults of this species are demersal, living on the bottom of fresh to brackish waters, in rivers, lakes, and tributaries.[2] This species and all anguillid eels are catadromous, migrating sometimes long distances out into the open ocean to spawning over deep water.[2] A spawning area of this species is known to be west of the Mariana Islands in an area of the North Equatorial Current in the western North Pacific, but other spawning areas are thought to exist in the western South Pacific and Indian Ocean.[9]

Marbled eels spend their adult lives in freshwater or estuarine habitats, and migrate to the ocean to reproduce.[3] When the eggs hatch, the leptocephali drift in ocean currents for months until they reach estuaries as glass eels where they migrate upstream into freshwater as elvers.[3] Then, after about 8 to 20 years in brackish or freshwater, the yellow eels grow up into silver eels (mature eels), and they return to the ocean for reproduction.[3]

The marbled eel is carnivorous, but harmless, with a wide ranging diet, eating shrimp, crabs, bony fish, and frogs.[10] It is nocturnal, so it is active at night.[10]

Significance to humans[edit]

Anguilla marmorata Stuffed specimen.jpg

Like other anguillid eels, this species is used as a source of food in some regions.[3] Some restaurants buy live eels.[3] In 1992, for example, a typical 12 kilogram (26.5 lb) marbled eel retailed for one thousand US dollars in China.[3][11]

An eel habitat, Cheonjiyeon Waterfalls' pond, is a natural monument in South Korea.[12]

Large individuals of this species are also highly regarded and are not harmed by native people in some island groups of the western Pacific.

References[edit]

  1. ^ Jacoby, D. & Gollock, M. (2014). "Anguilla marmorata". IUCN Red List of Threatened Species. Version 2014.1. International Union for Conservation of Nature. Retrieved 1 July 2014. 
  2. ^ a b c d e f g h i j k Froese, Rainer and Pauly, Daniel, eds. (2006). "Anguilla marmorata" in FishBase. February 2006 version.
  3. ^ a b c d e f g h i j k l m n o p q r s USGS. Species Fact Sheet "Anguilla marmorata". Retrieved 2006-11-21. 
  4. ^ Tsukamoto, K.; Aoyama, J. (1998). Environmental Biology of Fishes 52: 139–148. doi:10.1023/A:1007427724175.  edit
  5. ^ Robinet, T.; Guyet, S.; Marquet, G. R.; Mounaix, B. A.; Olivier, J. M.; Tsukamoto, K.; Valade, P.; Feunteun, E. (2003). "Elver Invasion, Population Structure and Growth of Marbled eels Anguilla marmorata in a Tropical River on Réunion Island in the Indian Ocean". Environmental Biology of Fishes 68 (4): 339–348. doi:10.1023/B:EBFI.0000005761.51686.f7.  edit
  6. ^ McCosker, J. E., Bustamante, R. H. & Wellington, G. M. (2003). "The freshwater eel, Anguilla marmorata, discovered at Galapagos.". Noticias de Galápagos 62: 2–6. Retrieved 21 June 2011. 
  7. ^ Shiao, J. C.; Iizuka, Y.; Chang, C. W.; Tzeng, W. N. (2003). "Disparities in habitat use and migratory behavior between tropical eel Anguilla marmorata and temperate eel A. japonica in four Taiwanese rivers". Marine Ecology Progress Series 261: 233–242. doi:10.3354/meps261233. 
  8. ^ a b c Discover Life. "Anguilla marmorata". Retrieved 2011-06-28. 
  9. ^ m., M.; n., M.; t., O.; k., T. (2002). "Evidence of a spawning area of Anguilla marmorata in the western North Pacific". Marine Biology 140 (4): 809–814. doi:10.1007/s00227-001-0754-9.  edit
  10. ^ a b Paul Harvey Skelton (10 September 2001). A complete guide to the freshwater fishes of Southern Africa. Struik. p. 108. ISBN 978-1-86872-643-1. Retrieved 23 June 2011. 
  11. ^ Williamson, Gordon R.; Boëtius, Jan (1993). "The eels Anguilla marmorata and A. japonica in the Pearl River, China, and Hong Kong". Asian Fisheries Science 6: 129–138. 
  12. ^ Lee, Cecilia Hae-Jin. (2008). Frommer's South Korea. Hoboken, NJ: Wiley. p. 392. ISBN 978-0-470-18191-1. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!