Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Brief Summary

Anguilla marmorata, known by many common names including the marbled eel, giant mottled eel and long finned eel, is one of about 19 species in its genus, the only genus in the small freshwater eel family Anguillidae. Of the angillid eels, the marbled eel has the widest distribution, found in several discrete but intermixing populations throughout the tropics and subtropics across the southwestern and central Pacific ocean, in the northwestern Pacific as far north as Japan, and in the southeastern Indian ocean to southern Africa (Wanatabe et al. 2008, 2009; Gagnaire et al. 2011).  It has been recorded in small numbers from the Galapagos (McCosker et al. 2003) though whether this is the edge of their natural range or an introduction is unclear (Vishwanath and Mailautoka 2012). 

Marbled eels, like other anguillid eels, have a complex life history, spending most of their life in the “yellow eel growth phase,” during which they inhabit the bottoms of fresh and brackish continental waters.  This can last 2-3 years in warmer regions and up to 20 years in colder northern areas.  The eels then migrate long distances as “silver eels” to spawning regions in open ocean gullies located at depths of 150-300 meters (500-1540 feet).  The spawning areas for the different marbled eel populations are not well identified, although those in the northern pacific are known to share spawning areas in the Mariana trench with the Japanese eel Anguilla marmorata (Tsukamoto 2011).  The planktonic larvae hatch at sea and develop into glass eel larvae to return to continental waters.  There they metamorphose into the pigmented elver stage whereupon they begin to feed and travel in schools to freshwater inland rivers, lakes, streams and estuaries where they complete their development.  In areas of large shallow coastal seas, they may stay as elvers without migrating upstream to fresh waters (Vishwanath and Mailautoka 2012).

Distinguished by their mottled brown, green and yellow coloration, adults reach up to 2 meters (6.6 feet) in length; one of the largest angillids.  They are usually encased in slime making them very slippery.  Nocturnal carnivores, the adult eels eat a diverse diet rich in fish, amphibians and invertebrates such as crab and shrimp (Froese and Pauly 2006).  Like other anguillid eels, the marbled eel is a sought-after commercial food fish, eaten at many of its developmental stages, and its fishery may well expand as other species of angillids decline (especially A. anguilla and A. japonica).  Currently it is listed by the IUCN as of least concern at it is common throughout its wide range, however its potential vulnerability to decline due to fisheries pressure and habitat loss is recognized as an important parameter to monitor (Vishwanath and Mailautoka 2012).

  • Froese, Rainer and Pauly, Daniel, eds. (2006). "Anguilla marmorata" in FishBase. February 2006 version. Retrieved September 18, 2013 from http://www.fishbase.org/summary/Anguilla-marmorata.html.
  • Gagnaire, P.-A., Minegishi, Y., Zenboudji, S., Valade, P., Aoyama, J. and Berrebi, P. 2011. Within-population structure highlighted by differential introgression across semipermeable barriers to gene flow in Anguilla marmorata. Evolution 65: 3413–3427
  • McCosker, J. , Bustamante, R., Wellington, G. 2003. The Freshwater Eel, Anguilla Marmorata, Discovered in Galápagos. Noticias de Galápagos 62, Available online from http://www.galapagos.org/pdf/Noticias62.pdf.
  • Tsukamoto, K., Chow, S., Otake, T., Mochioka, N., Miller, M. J., Aoyama, J., Kimura, S., Watanabe, S., Yoshinaga, T., Shinoda, A., Kuroki, M., Oya, M., Watanabe, T., Hata, K., Ijiri, S., Kazeto, Y., Nomura, K., Tanaka, H. 2011. Oceanic spawning ecology of freshwater eels in the western North Pacific. Nature Communications 2:179. doi: 10.1038/ncomms1174.
  • Vishwanath, W. & Mailautoka, K. 2012. Anguilla marmorata. In: IUCN 2013. IUCN Red List of Threatened Species. Version 2013.1. . Downloaded on 18 September 2013.
  • Watanabe, S., Aoyama, J., Miller, M.J., Ishikawa, S., Feunteun, E., and Tsukamoto, K. 2008. Evidence of population structure in the giant mottled eel, Anguilla marmorata,using total number of vertebrae. Copeia 2008: 681–689.
  • Watanabe, S., Miller, M.J., Aoyama, J., Tsukamoto, K. 2009. Morphological and meristic evaluation of the population structure of Anguilla marmorata across its range. Journal of Fish Biology 74(9): 2069–2093.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

© Dana Campbell

Supplier: Dana Campbell

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

  Common names: eel (English), anguilla (Espanol)
 
Anguilla marmorata Quoy and Gaimard, 1824

Giant mottled freshwater eel



Body robust; compressed at rear; mouth reaching to under rear edge of eye, lower jaw projecting; lips thick; teeth minute, in bands on jaws and a patch that conspicuously narrows in its middle on roof of mouth, jaw teeth with toothless groove separating inner and outer teeth; with large pectoral fins; dorsal fin origin well behind pectoral fin; dorsal and anal fins continuous with tail fin; lateral line complete but pores very small; small imbedded scales arranged in basket-weave pattern present in adults but not juveniles; 100-110 vertebrae.

Yellowish to olive or brown, mottled with dark greenish brown, lighter below; all fins dark.

Reaches 2 m.

0-2 m depth.

Widely distributed in the Indo-central Pacific; recently found in the Galapagos, where it evidently is a vagrant. Adults in fresh to brackish water, migrate long distances to spawning grounds in deep gyres in the open ocean; larvae marine.
   
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

Live in freshwater areas as adults, estuaries and seas as young (Ref. 12693). Found in lowland rivers as well as upland tributaries (Ref. 2847). While in river, the sex gland does not develop. But in winter when they move from the stream to river mouth, the sex gland begins to develop as mature individuals go to deep sea to breed (Ref. 45563). The spawning grounds are deep sea gullies among the south of the Philippines, east of Indonesia and Papua New Guinea (Ref. 45563). Are active at night, feeding on a wide range of prey (Ref. 7248, 79840), especially crabs, frogs and fish (Ref. 7248). Thought to breed east of Madagascar where the young are wafted to the East Coast by ocean currents (Ref. 13337, 79840).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Watanabe et al. (2009) described the species as being present longitudinally from the east coast of Africa to the Marquesas Islands (French Polynesia) in the central South Pacific, as far north as southern Japan, and as far south as southern Africa. Individuals have, however, recently been found in the Pacific in the Palmyra Atoll and as far east as the Galapagos Islands, although it is not known if these are the result of natural migration, vagrant individuals, or introduction.

The species is widely distributed throughout most of the tropical and subtropical western-central Pacific and Indian Oceans. It has been reported from the southern islands of Japan, Taiwan, southeastern China, throughout the Indo-Pacific region, New Caledonia, the islands of Polynesia and French Polynesia, and in the eastern and southwestern Indian Ocean (Ege 1939); Viet Nam, Malaysia, Indonesia, Philippines to South Pacific Islands and Indo-West Pacific. It is known from the Mekong River to the Upper Mekong (Lower Lancangjiang) in Yunnan, southern China (recorded from the Changjiang (Yangtze River), Qiantangjiang, Lingjiang, Oujiang, and Minjiang rivers; Wang 1998), the Xijiang River (Guangdong Province), throughout rivers in Hainan Province (Kuang 1991), and from the Zhujiang River (Pearl River).

In Africa it is restricted to southern Africa, more common south of the Limpopo River (Skelton 2001). Other records include Ecuador (the Galapagos Islands; McCosker et al. 2003). The species is at the edge of its range here, and inland distribution is limited here (Tesch 2003).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific 
 
Global Endemism: All species, TEP non-endemic, Indo-Pacific only (Indian + Pacific Oceans), "Transpacific" (East + Central &/or West Pacific), All Pacific (West + Central + East)

Regional Endemism: All species, Tropical Eastern Pacific (TEP) non-endemic, Island (s), Island (s) only

Residency: Vagrant

Climate Zone: Equatorial (Costa Rica to Ecuador + Galapagos, Clipperton, Cocos, Malpelo)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-Pacific: East Africa to French Polynesia, north to southern Japan. Africa: inland Mozambique and lower Zambezi River.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Africa, Asia, Australia, Indo-West Pacific: South African and East African watersheds and adjacent oceanic waters (including Madagascar and Mascarenes) east to Caroline Islands (Micronesia), Mariana Islands and Marquesas Islands, north to southern Japan,
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth

Depth Range (m): 0 (S) - 2 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Vertebrae: 100 - 110
  • Smith, D.G. 1999 Anguillidae. Freshwater eels. p. 1630-1636. In K.E. Carpenter and V.H. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the WCP. Vol. 3. Batoid fishes, chimaeras and bony fishes part 1 (Elopidae to Linophrynidae). FAO, Rome. (Ref. 9828)   http://www.fishbase.org/references/FBRefSummary.php?id=9828&speccode=1274 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length max (cm): 200.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 2000 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

70.0 cm TL (male/unsexed; (Ref. 57749)); 200 cm TL (female); max. published weight: 20.5 kg (Ref. 13337); max. published weight: 15 kg; max. reported age: 40 years (Ref. 48660)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Description

Inhabits deep rocky pools and is active at night, feeding on a wide range of prey, especially crabs, frogs and fish (Ref. 7248).
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Adults have a brownish to black marbling on their back on a greyish yellow background. This coloration can fade away. White belly. Younger specimens are greyish to orange and the marbling is less visible (Ref. 48622). Body color brown speckles scattered on back, sides and fins; yellow between speckles and edge of pectoral fin; belly white or pale blue (Ref. 45563). Head rounded; snout depressed; lower jaw protruded; gill openings small; scales matted-like under skin; pectoral fin rounded; pelvic fin absent (Ref. 45563). Distinguished from all other species by the mottled color and the long dorsal fin, which begins closer to the gill opening than to the anus (Ref. 9828).
  • Smith, D.G. 1999 Anguillidae. Freshwater eels. p. 1630-1636. In K.E. Carpenter and V.H. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the WCP. Vol. 3. Batoid fishes, chimaeras and bony fishes part 1 (Elopidae to Linophrynidae). FAO, Rome. (Ref. 9828)   http://www.fishbase.org/references/FBRefSummary.php?id=9828&speccode=1274 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Zambezi River Demersal Habitat

This taxon is one of a number of demersal species in the Zambezi River system of southern Africa. Demersal river fish are found at the river bottom, feeding on benthos and zooplankton

Nutrient levels in the Zambezi River are relatively low, especially in the upper Zambezi; in that reach, above Victoria Falls, most of the catchment drains Kalahari sands, whose nutrient levels are inherently low due to their aeolian formation; moreover, agricultural fertilizer addition throughout the Zambezi watershed is low, due to the shortage of capital available to farmers of this region.

Nitrate levels (as nitrogen) in the upper Zambezi are typically in the range of .01 to .03 milligrams per liter. Correspondingly electrical conductivity of the upper Zambezi is on the order of 75 micro-S per centimeter, due to the paucity of ion content. From the Luangwa River downstream nitrate levels elevate to .10 to .18 milligrams per liter, and electrical conductivity rises to a range of two to four times the upper Zambezi levels. Not surprisingly, pH, calcium ion concentration, bicarbonate and electrical conductivity are all higher in portions of the catchment where limestone soils predominate compared to granite.

There are a total of 190 fish species present in the Zambezi River, including eel and shark taxa. The largest native demersal species present are the 117 centimeter (cm) long tiger fish (Hydrocynus vittatus), the 175 cm African mottled eel (Anguilla bengalensis labiata), the 120 cm Indonesian shortfin eel (Anguilla bicolor bicolor), the 200 cm Giant mottled eel (Anguilla marmorata), the 150 cm African longfin eel (Anguilla mossambica), the 183 cm Sampa (Heterobranchus longifilis), the 150 cm Cornish jack (Mormyrops anguilloides) and the 700 cm largetooth sawfish (Pristis microdon).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© C.Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Yangtze River Demersal Habitat

This taxon is one of a number of demersal species in the Yangtze River system. Demersal river fish are found at the river bottom, feeding on benthos and zooplankton.

The upper Yangtze basin consists chiefly of Paleozoic limestone and terrigenous sedimentary rock, with some granitic material. The most downstream element of the upper Yangtze basin is often termed the Sichuan Basin; here the Yangtze cuts through Triassic and Permian material before entering the Three Gorges. The Three Gorges area is a stretch of the Yangtze that runs approximately 660 kilometers, terminating at the site of the Three Gorges Dam. Prior to construction of the dam, the Three Gorges area was a site of exceptional natural beauty; after dam construction the gorge areas were filled with approximately 100 meters in depth of Yangtze water, and considerable amounts of the watershed were graded.

The lower Yangtze basin consists of anabranching river structures and Pleistocene coastal terraces. Prior to development of the Three Gorges Dam, the Yangtze Delta was replenished with a copious sediment load reaching the river mouth; however, the dam has now severely limited the natural flow and deposition of sediment to the delta region. Consequently, the integrity of the delta is been compromised, with scouring exceeding deposition, and the very stability of the delta is endangered.

Lower and middle basins of the Yangtze carry heavy pollutant loads. In the lower Yangtze basin nitrate levels are high, measuring at about 1000 tons per day at Datong; these levels accrue from high applications of chemical fertilizer applied and also considerable loadings of untreated sewage due to the large human population of the basin, with correspondingly little infrastructure for sewage treatment.

Heavy metal concentrations are also high in the lower Yangtze, with measurements of dissolved lead at 0.078 microgram/liter; cadmium (0.024 microgram/liter), chromium (0.57 microgram/liter), copper (1.9 microgram/liter), and nickel (0.50 microgram/liter). Levels of dissolved arsenic have been measured at 3.3 microgram/liter) and zinc at 1.5 microgram/liter), both notably higher by factors of 5.5 and 2.5 respectively than other typical large world rivers. In Yangtze River suspended sediment, arsenic comprises 31 microgram/gram, lead comprises 83 microgram/gram, and nickel comprises 52 micrograms/gram of sediment content

There are several large native demersal fish found in the Yangtze River, chiefly the 250 centimeter (cm) long endangered Yangtze sturgeon (Acipenser dabryanus), the 120 cm Chinese sturgeon (Acipenser sinensis), the 200 cm Giant mottled eel (Anguilla marmorata), the 122 cm black carp (Mylopharyngodon piceus), the 300 cm Chinese paddlefish (Psephurus gladius), and the 100 cm Silurus meridionalis. Furthermore, there are a few exceptionally large native benthopelagic fishes found in the Yangtze, namely, the 105 cm Silver carp (Hypophthalmichthys molitrix), the 200 cm Wuchang bream (Megalobrama amblycephala), the 200 cm yellowcheek (Elopichthys bambusa), the 145 cm common carp (Cyprinus carpio carpio), the 122 cm Mongolian redfin (Chanodichthys mongolicus), the 102 cm predatory carp (Chanodichthys erythropterus) and the 100 cm snakehead (Channa argus argus).. The demersal fish Silurus meridionalis also is found as a Yangtze River endemic species.

Creative Commons Attribution 3.0 (CC BY 3.0)

© C.Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Habitat and Ecology

Habitat and Ecology

The species is facultatively catadromous, being found in freshwater, brackish and saline habitats during its continental growth stages (Briones et al. 2007). The yellow eel growth stage may be as short as two to three years in warm productive habitats, but about six to twenty years or more in more northerly latitudes, e.g. in the Pearl River, China (Williamson and Boëtius 1994). Maturing silver eels migrate to deep oligotrophic sea regions and spawning at depths of 150 to 300 m.

Spawning often occurs in the same oceanic areas as other anguillids (e.g. Kuroki et al. 2009, Pous et al. 2010, Tsukamoto et al. 2011), although the spawning areas of this species have not been well identified yet (Réveillac et al. 2008, Robinet et al. 2008, Pous et al. 2010, Kuroki et al. 2008, E. Feunteun pers. comm. 2012), except for the the north pacific population where adult spawners and eggs were found in the Mariana Trench region by Tsukamoto’s team. The distribution of the growth stages of the species in relation to other anguillids is affected by gyre and coastal currents, spawning times and growth rates and duration of the leptocephalus stage. For example, recruitment is relatively more abundant on the east coast of Taiwan than the west (Leander et al. 2012). The species may also show preferences for upstream freshwater habitats, but competition with other eel species and environmental factors may influence choices (Shiao et al. 2003, Briones et al. 2007, Robinet et al. 2007).

Planktonic larvae (leptocephali) follow oceanic gyre currents and then metamorphose into glass eels before migrating towards continental habitats (e.g. Robinet et al. 2008, Pous et al. 2010). They then pigment into the elver stage, commence feeding and can migrate into freshwaters.

If the edge of the continental plate is steep (this usually results in short high gradient streams and low-diversity fauna) the elvers ascend the streams (Annamite slope, Philippines, east Borneo, Sulawesi, Indian Ocean slope of Sumatra and Java, Thailand between Phuket and Ranong, etc). If it is an extensive shallow coastal sea (e.g. Sunda shelf), only occasional stray individuals enter freshwater (for example, the Chao Phraya and Mekong estuaries) (M. Kottelat pers. comm. 2011).


Systems
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

demersal; catadromous (Ref. 51243); freshwater; brackish; marine; depth range 1 - 400 m (Ref. 6898)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 84 specimens in 1 taxon.
Water temperature and chemistry ranges based on 69 samples.

Environmental ranges
  Depth range (m): 0.4 - 8.5
  Temperature range (°C): 28.723 - 28.954
  Nitrate (umol/L): 0.050 - 0.099
  Salinity (PPS): 34.131 - 34.205
  Oxygen (ml/l): 4.472 - 4.525
  Phosphate (umol/l): 0.113 - 0.160
  Silicate (umol/l): 1.305 - 1.579

Graphical representation

Depth range (m): 0.4 - 8.5

Temperature range (°C): 28.723 - 28.954

Nitrate (umol/L): 0.050 - 0.099

Salinity (PPS): 34.131 - 34.205

Oxygen (ml/l): 4.472 - 4.525

Phosphate (umol/l): 0.113 - 0.160

Silicate (umol/l): 1.305 - 1.579
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Salinity: Brackish, Freshwater, Non Marine

Inshore/Offshore: Inshore, Inshore Only

Water Column Position: Bottom, Bottom only

Habitat: Reef (rock &/or coral), Rocks, Reef and soft bottom, Soft bottom (mud, sand,gravel, beach, estuary & mangrove), Estuary, Freshwater

FishBase Habitat: Demersal
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Catadromous. Migrating from freshwater to the sea to spawn, e.g., European eels. Subdivision of diadromous. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Catadromous; lives in inland waters such as river mouths, marshes, rivers, streams, lakes and ponds. Inhabits deep rocky pools (Ref. 7248). It hides in holes and stone crevices in daylight. Found in lowland rivers as well as upland tributaries (Ref. 2847). While in rivers, the sex gland of the fish does not develop and in winter it follows streams to river mouths where the sex gland begins to develop and afterwards it goes to deep sea to breed (Ref. 45563). Active at night, feeding on a wide range of prey (Ref. 7248). Feeds on fishes, shrimps, crabs and carcass of large animals fallen into the water (Refs. 7248, 45563) and frogs (Ref. 7248).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Feeding

Feeding Group: Carnivore

Diet: mobile benthic crustacea (shrimps/crabs), bony fishes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diseases and Parasites

Galactosomum Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Bothriocephalus Infestation 1. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

Egg Type: Pelagic, Pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Anguilla marmorata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 17
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Anguilla marmorata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGGCAATCACCCGTTGATTCTTTTCTACTAATCACAAAGACATTGGTACCCTATATCTAGTATTTGGTGCCTGAGCCGGAATGGTGGGAACCGCACTAAGCCTTCTAATCCGTGCCGAATTAAGTCAACCAGGCGCCCTTCTTGGAGATGACCAAATTTACAATGTCATCGTCACAGCGCATGCCTTTGTAATGATTTTCTTTATAGTAATACCAGTAATAATTGGAGGATTTGGCAACTGACTTGTGCCATTAATGATCGGCGCTCCAGACATAGCATTTCCCCGAATAAACAATATAAGCTTCTGACTCTTACCACCATCATTTCTCCTTCTACTAGCCTCCTCAGGAGTAGAAGCTGGGGCTGGTACAGGTTGAACTGTATATCCGCCTCTAGCTGGAAACTTAGCCCACGCCGGAGCATCTGTTGACCTGACAATTTTCTCGCTTCACCTTGCAGGAATTTCATCAATCCTAGGAGCCATTAATTTTATCACTACAATTATTAACATGAAACCGCCTGCCATTACACAATACCAAACCCCTCTGTTTGTATGAGCTGTTTTAGTCACCGCTGTTCTACTACTCCTATCCCTACCAGTCCTAGCTGCAGGTATTACAATACTTCTGACTGACCGAAACTTAAATACAACCTTCTTTGACCCTGCAGGAGGTGGAGACCCAATCCTCTACCAACACCTATTCTGATTCTTTGGTCATCCAGAAGTATACATTTTAATCTTACCAGGGTTTGGAATAATCTCACACATTGTTGCTTATTACTCCGGTAAGAAAGAACCATTTGGGTATATAGGAATGGTCTGAGCAATAATGGCTATCGGACTTCTAGGATTCATTGTTTGAGCACACCATATGTTTACAGTAGGAATAGATGTAGACACCCGTGCCTACTTCACTTCTGCCACAATAATCATCGCAATTCCAACTGGAGTAAAAGTATTCAGCTGACTAGCCACATTACACGGAGGGGCCATCAAATGAGAAACTCCACTCCTTTGAGCTTTAGGCTTTATTTTCCTATTTACAGTTGGTGGTTTAACAGGTATTGTACTAGCAAACTCATCAATCGATATTGTATTACATGACACATACTATGTAGTAGCTCATTTCCATTATGTTTTATCCATAGGAGCAGTCTTTGCTATTATAGGGGGCTTTGTACACTGATTCCCACTGTTTTCAGGATATACACTACACGACACATGAACCAAAGTACACTTTGGAATTATATTCGTAGGGGTAAACCTAACCTTCTTCCCACAACATTTCCTAGGATTAGCAGGAATACCACGACGTTATTCAGACTACCCAGATGCATACACCCTGTGAAACACAATCTCCTCTATTGGATCACTAATTTCCCTCACAGCCGTAGTCCTATTCCTATTCATCCTCTGAGAAGCATTCACTGCCAAACGAGAAGTAAAATGAGTAGAACTCACAGAAACAAACGTTGAATGACTACACGGATGTCCTCCACCATACCACACATTCGAAGAACCAGCGTACGTCCGAGTCCAACCGCCCTCAGATGATCAAAAATCAGAAGCCAAAGCCCACATTCAAGAAAGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
Vishwanath, W. & Mailautoka, K.

Reviewer/s
Knights, B., Feunteun, E., Allen, D. & Smith, K.

Contributor/s
Bills, R., Cambray, J., Engelbrecht, J., Marshall, B., Larson, H. & Kottelat, M.

Justification
The species has a wide distribution throughout most of the tropical and subtropical western-central Pacific and Indian Oceans and associated freshwater systems. It is considered Least Concern at present as there is no evidence of population declines, nor are there thought to be any major threats. Sub-populations are impacted by local threats, and local declines have been shown in some areas as Réunion Island and Madagascar due to river management (rice culture in Madagascar which has lead to the disappearance of silver eel stocks in the Highlands of Tananarive and over fishing in Réunion Island).

However, the species is a highly commercial food fish, and could be vulnerable to overfishing in their yellow and silver life stages /silver and, for seed-stock for aquaculture, in the glass eel stage. In Madagascar, an extensive glass eel fishery is operated (several tens of tons). Restrictions on supplies of other species, such as Anguilla anguilla, to global markets could also stimulate exploitation. Habitat loss and degradation and migration barriers could also become a problem in many parts of its range. Thus recruitment, populations, habitats and fisheries should be monitored, and the species reassessed if further data become available showing population impacts or habitat decline.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This is a common species with a wide distribution, probably comprising four populations with different spawning areas in the North Pacific, Micronesia, Indian Ocean and the North and South Pacific according to Watanabe et al. (2008). However, Gagnaire et al. (2011) suggest there are three populations, spawning in the North Pacific, South Pacific and Southwest Indian Ocean, showing partial reproductive and hence genetic isolation but with some inter-population gene flow occurring due to long-distance migration mixing. Thus the species is probably panmictic at the regional scale and partial mixing may promote complete panmixia over very long-time scales.
There is no detailed information on population numbers, but numbers would be expected to decrease with distance from spawning grounds and with distance from the sea in freshwaters, as in other anguillids.

Sub-populations are impacted by local threats, and local declines have been shown in some areas as Réunion Island and Madagascar due to river management (rice culture in Madagascar which has lead to the disappearance of silver eel stocks in the Highlands of Tananarive and over fishing in Réunion Island) (E. Feunteun pers. comm. 2012). Population declines have also been reported from China (E. Feunteun pers. comm. 2012).

The species overall population is considered stable at present, however this requires monitoring.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
River management, water impoundment, overfishing and pollution could impact this species. In southern Africa, in the upper catchments in Mozambique, all Anguilla species are susceptible to hook and line fishing and poisoning by subsistence fishermen. Within South Africa and other countries, major impoundments and weirs are barriers to upstream eel movement and mortalities can occur on downstream passage of silver eels through turbines and pumps. In developing countries, hydroelectric capacity is being rapidly developed and fish passage requirements is scarcely taken into account (e.g., Roberts 2004). Loss and/or deterioration of habitats due to land drainage and reclamation and pollution may become problems in parts of the species range. Development of aquaculture initiatives could locally threaten this species because this will require the collection of glass eels and elvers in estuaries as seed stock.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The species has been assessed as 'II Rare and Valuable’ in the Wildlife Conservation Act Republic of China (Taiwan) Article 4 (Wang 1998). Further research is required to confirm the species spawning areas, continental distributions, key habitats and vulnerabilities, especially of different populations.

Coordination between countries to define and implement regional management plans are strongly requested and do not exist yet.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; aquaculture: commercial; gamefish: yes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Marbled eel

The marbled eel, also known as the giant mottled eel, Anguilla marmorata, is a species of tropical anguillid eel that is found in the Indo-Pacific and adjacent freshwater habitats.[1]

Distribution[edit]

This anguillid species can be found from East Africa to French Polynesia and as far north as southern Japan.[1][2][3] In Africa, it may be found within Mozambique and the lower Zambezi River.[1] The marbled eel has the widest distribution of all the Anguilla eels.[2][4] It is usually found in tropical climates between 24°N to 33°S.[1] It has also been found in other more distant regions such as the Galapagos possibly due to abnormal larval transport associated with El Niño-Southern Oscillation events.[5] It is not on the IUCN Red List of Threatened Species, but in Taiwan, it is endangered.[2][6]

In 2002, a single eel was captured from a pond close to Kaupo, Maui, Hawaii, though it is not indigenous to the area.[2]

Physical description[edit]

Similar to other anguillids, the marbled eel is cylindrical with small, well-developed pectoral fins and a protruding lower jaw.[2] The eel has thick, fleshy lips.[2] The eel has dorsal and anal fins that are continuous around the tail, with the origin of the dorsal-fin origin between the pectoral fins and anus.[2] It has small, oval-shaped scales that are embedded in the skin.[2]

Unlike some other anguillid species, the marbled eel has a mottled color.[1][2] The adult eels are yellow with a greenish-brown to black marbling on their back and a white belly.[1][2] The young elvers have less visible marbling and are grayish to yellow.[1][2] The dorsal fin of the marbled eel is closer to the gill opening than to the anus, more anterior than other species of Anguilla.[2] Like all anguillid eels, it does not have pelvic fins.[7] The head is rounded and the snout is depressed.[7] Its teeth are small and in bands.[7] It has a total of 100 to 110 vertebrae.[1]

It can grow up to 2 meters (6.6 ft) for females and 1.5 meters (4.9 ft) for males and can weigh up to 20.5 kilograms (45 lb),[1] which is larger than most other species of anguillid eels. The marbled eel can live up to about 40 years.[2]

Ecology and behaviour[edit]

Life cycle of eels

The adults of this species are demersal, living on the bottom of fresh to brackish waters, in rivers, lakes, and tributaries.[1] This species and all anguillid eels are catadromous, migrating sometimes long distances out into the open ocean to spawning over deep water.[1] A spawning area of this species is known to be west of the Mariana Islands in an area of the North Equatorial Current in the western North Pacific, but other spawning areas are thought to exist in the western South Pacific and Indian Ocean.[8]

Marbled eels spend their adult lives in freshwater or estuarine habitats, and migrate to the ocean to reproduce.[2] When the eggs hatch, the leptocephali drift in ocean currents for months until they reach estuaries as glass eels where they migrate upstream into freshwater as elvers.[2] Then, after about 8 to 20 years in brackish or freshwater, the yellow eels grow up into silver eels (mature eels), and they return to the ocean for reproduction.[2]

The marbled eel is carnivorous, but harmless, with a wide ranging diet, eating shrimp, crabs, bony fish, and frogs.[9] It is nocturnal, so it is active at night.[9]

Significance to humans[edit]

Oounagi070224.jpg

Like other anguillid eels, this species is used as a source of food in some regions.[2] Some restaurants buy live eels.[2] In 1992, for example, a typical 12 kilogram (26.5 lb) marbled eel retailed for one thousand US dollars in China.[2][10]

An eel habitat, Cheonjiyeon Waterfalls' pond, is a natural monument in South Korea.[11]

Large individuals of this species are also highly regarded and are not harmed by native people in some island groups of the western Pacific.

References[edit]

  1. ^ a b c d e f g h i j k Froese, Rainer and Pauly, Daniel, eds. (2006). "Anguilla marmorata" in FishBase. February 2006 version.
  2. ^ a b c d e f g h i j k l m n o p q r s USGS. Species Fact Sheet "Anguilla marmorata". Retrieved 2006-11-21. 
  3. ^ Tsukamoto, K.; Aoyama, J. (1998). Environmental Biology of Fishes 52: 139–148. doi:10.1023/A:1007427724175.  edit
  4. ^ Robinet, T.; Guyet, S.; Marquet, G. R.; Mounaix, B. A.; Olivier, J. M.; Tsukamoto, K.; Valade, P.; Feunteun, E. (2003). "Elver Invasion, Population Structure and Growth of Marbled eels Anguilla marmorata in a Tropical River on Réunion Island in the Indian Ocean". Environmental Biology of Fishes 68 (4): 339–348. doi:10.1023/B:EBFI.0000005761.51686.f7.  edit
  5. ^ McCosker, J. E., Bustamante, R. H. & Wellington, G. M. (2003). "The freshwater eel, Anguilla marmorata, discovered at Galapagos.". Noticias de Galápagos 62: 2–6. Retrieved 21 June 2011. 
  6. ^ Shiao, J. C.; Iizuka, Y.; Chang, C. W.; Tzeng, W. N. (2003). "Disparities in habitat use and migratory behavior between tropical eel Anguilla marmorata and temperate eel A. japonica in four Taiwanese rivers". Marine Ecology Progress Series 261: 233–242. 
  7. ^ a b c Discover Life. "Anguilla marmorata". Retrieved 2011-06-28. 
  8. ^ m., M.; n., M.; t., O.; k., T. (2002). "Evidence of a spawning area of Anguilla marmorata in the western North Pacific". Marine Biology 140 (4): 809–814. doi:10.1007/s00227-001-0754-9.  edit
  9. ^ a b Paul Harvey Skelton (10 September 2001). A complete guide to the freshwater fishes of Southern Africa. Struik. p. 108. ISBN 978-1-86872-643-1. Retrieved 23 June 2011. 
  10. ^ Williamson, Gordon R.; Boëtius, Jan (1993). "The eels Anguilla marmorata and A. japonica in the Pearl River, China, and Hong Kong". Asian Fisheries Science 6: 129–138. 
  11. ^ Lee, Cecilia Hae-Jin. (2008). Frommer's South Korea. Hoboken, NJ: Wiley. p. 392. ISBN 978-0-470-18191-1. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!