Overview

Comprehensive Description

Biology

May occur in large schools near the surface both inshore and offshore, but also buries itself in sand (Ref. 2850). Inshore, found from intertidal to subtidal areas (Ref. 2850). Offshore, found near the surface over deep water (Ref. 2850). Benthic (Ref. 58426). Juveniles and adults feed on zooplankton (Ref. 28499). Utilized dried or salted and frozen; sometimes targeted as a raw material for fishmeal; eaten fried (Ref. 9988).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: Throughout the coastal North Pacific; in the Sea of Japan and Sea of Okhotsk in the western North Pacific and the Beaufort Sea south to Balboa Island (near Baja California) in the eastern North Pacific.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Arctic, Northwest to Northeast Pacific: Arctic Alaska to the Sea of Japan and Balboa Island, southern California, USA. Western Atlantic: northern Quebec, Canada to North Carolina, USA. The Arctic and Pacific populations may be a separate species, distinct from the Atlantic populations (Ref. 7251).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Arctic, North Pacific, and North Atlantics.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 58 - 63; Analspines: 0; Analsoft rays: 28 - 31; Vertebrae: 68 - 72
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 270 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

30.0 cm TL (male/unsexed; (Ref. 56394)); max. published weight: 100.0 g (Ref. 56527); max. reported age: 11 years (Ref. 56557)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Resembles A personatus in body shape but distinguished by its numerous dorsal fin rays (58 to 63 against 55 to 59) an vertebrae (68 against 67), and larger eyes. Lateral plicae 144 to 161.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Marine

Comments: Found in nearshore and intertidal marine environments. Burrowing habitat is typically well washed fine sand and fine gravel, free of mud, usually with a strong bottom current keeping oxygen levels high (Emmett et al. 1991). Sand lance distribution in Kodiak, Alaska, was associated with freshwater influence and not on beaches composed entirely of fine, hard packed sand (Dick and Warner1982). Prefer well-lighted habitat and are most common at depths less than 50 m, but may be found up to depths of 275 m. Feeding schools are found in littoral waters within proximity of burrowing habitat. Highest abundance found in burrowing habitat that is sheltered from onshore wave action and disturbance by winter storms (Robards et al. 2002).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

benthopelagic; oceanodromous (Ref. 51243); brackish; marine; depth range 0 - 275 m (Ref. 58426), usually 30 - 100 m (Ref. 56557)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 341 specimens in 1 taxon.
Water temperature and chemistry ranges based on 168 samples.

Environmental ranges
  Depth range (m): 0 - 269
  Temperature range (°C): -1.065 - 12.204
  Nitrate (umol/L): 0.338 - 32.084
  Salinity (PPS): 27.438 - 35.263
  Oxygen (ml/l): 3.066 - 8.393
  Phosphate (umol/l): 0.634 - 2.853
  Silicate (umol/l): 6.436 - 60.201

Graphical representation

Depth range (m): 0 - 269

Temperature range (°C): -1.065 - 12.204

Nitrate (umol/L): 0.338 - 32.084

Salinity (PPS): 27.438 - 35.263

Oxygen (ml/l): 3.066 - 8.393

Phosphate (umol/l): 0.634 - 2.853

Silicate (umol/l): 6.436 - 60.201
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 100m.
Recorded at 100 meters.

Habitat: benthopelagic. Occurs in large schools near the surface but also buries itself in sand. Inshore, found in intertidal areas and to 47 m depth. Offshore, found near the surface over deep water. Feeds on plankton (Ref. 4925). Eaten by predatory fishes such as salmon, cod, pollock (Ref. 9988), also by halibut (Ref. 6885), sea birds and marine mammals. Utilized dried/salted and frozen; sometimes targeted as a raw material for fishmeal; eaten fried (Ref. 9988).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Spawning appears to occur within habitat occupied by this species year-round, and no spawning migrations have been observed; however, offshore-onshore movements occur before spawning in the fall (Robards et al. 1999d). Exhibits high site fidelity to spawning locations, although eggs and larvae are subject to limited movement by water currents and tides.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Larvae feed on phytoplankton and early zooplankton stages. Adults feed in large schools, consuming mainly copepod zooplankton within relatively short distances of fish burrowing habitat (Hobson 1986). Epibenthic invertebrates become more important in diet during autumn and winter. Adults also feed on herring (Clupea harengus) larvae and eggs, and may feed in mixed aggregations with herring and Pink salmon (O. gorbuscha) (Sturdevant et al. 2000).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

May occur in large schools near the surface both inshore and offshore, but also buries itself in sand (Ref. 2850). Inshore, found from intertidal to subtidal areas (Ref. 2850). Offshore, found near the surface over deep water (Ref. 2850). Juveniles and adults feed on zooplankton (Ref. 28499). Also feeds on crustaceans, snails and worms (Ref. 58426).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Considered a key prey species for many marine predators including birds, fishes and mammals because of its high energy content (Mabry 2000). Predators include commercially valued species such as halibut (Hippoglossus spp.), rockfish (Sebastes spp.) and salmon (Oncorhynchus spp.) as well as seabirds such as the Rhinoceros Auklet (Cerorhinca monocerata), Double-crested Cormorant (Phalacrocorax auritus) and Red-throated Loon (Gavia stellata) and marine mammals including the Steller sea lion (Eumetopias jubatus), fur seal (Callorhinus ursinus) and humpback whale (Megaptera novaeangliae) (Field 1987). The recovery of a Pigeon Guillemot (Cepphus columba) colony in Prince William Sound, Alaska, appears to be limited by the availability of sand lance (Golet et al. 2002). Sand lance availability may also affect the reproductive output of Common Murres (Uria aalge) (Piatt and Anderson 1996). This euryhaline and eurythermic species has a short life span (up to 7 yrs), a large number of predators, and probably has correspondingly high rates of mortality, growth and fecundity (Fritz et al. 1993). Defense tactics used against predation include burrowing into soft, wet sand in the intertidal/subtidal zones and contraction of the fish school into a ball of closely packed fish (Robards et al. 1999d).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: Feeds and schools diurnally and burrows nocturnally into sand substrate; also burrows into substrate to pass the winter in a dormant state. Spawning occurs during night and day, between August and February, throughout the species' range.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 8 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Spawns intertidally and possibly subtidally once a year within proximity of burrowing habitat: in Alaska, from late August through October (Robards et al. 1999b); in Puget Sound, Washington, as late as mid February (Penttila 1997). Spawning has been documented in the same locations for decades (Robards et al. 1999b). Robards et al. (1999b) found age 1 (50%) and age 2 (31%) fish dominated spawning schools in the Gulf of Alaska and ages 3, 4, 5 and 6 made up 14, 4, 1 and < 1%, respectively, of the overall spawning school composition. Female fecundity is proportional to length, ranging from around 1,400 to 16,080 ova per female. Spawns vigorously in dense formations, leaving scoured pits in beach sediments. Slightly adhesive eggs are deposited in the intertidal zone just below the water line, and in some areas of Alaska in the subtidal zone (McGurk and Warburton 1992). Embryos develop in up to 67 days, often through periods of intertidal exposure and sub-freezing air temperatures (Robards et al. 1999d).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Ammodytes hexapterus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 16
Specimens with Barcodes: 38
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Ammodytes hexapterus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 13 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTGGCACCCTTTATCTAGTATTTGGTGCTTGAGCCGCTATGGTGGGGACGGCTCTAAGCCTGCTCATCCGAGCAGAACTTAGCCAACCCGGCGCCCTCCTAGGAGATGATCAAATCTATAACGTAATTGTTACCGCTCATGCATTCGTAATGATTTTCTTTATAGTAATACCAATTATGATTGGTGGTTTTGGAAACTGACTAATCCCCCTAATAATTGGTGCCCCTGATATAGCATTCCCTCGAATAAATAACATGAGCTTTTGACTCCTCCCACCCTCCCTCCTTCTTCTTTTAGCCTCTTCAGGCGTAGAAGCTGGAGCTGGTACCGGTTGAACTGTATACCCTCCCCTGGCCGGAAATCTAGCCCACGCAGGTGCATCTGTTGACTTAACAATCTTCTCTCTGCATTTAGCCGGGATCTCTTCGATTCTTGGAGCAATCAACTTCATCACCACAATTATTAACATGAAACCTCCCGCTATCTCTCAGTATCAGACACCCTTATTTGTGTGAGCTGTGCTGATTACAGCCGTCCTTCTCCTCCTCTCCCTCCCCGTCCTTGCTGCCGGCATTACAATGCTTCTTACAGACCGCAACTTAAATACCACCTTCTTTGACCCTGCAGGAGGGGGAGACCCTATTCTGTACCAACACCTGTTCTGATTCTTCGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Widespread and abundant in coastal waters; population trend unknown. Closely tied to sandy substrates in the intertidal zone; pollution by oiling and other contaminants and habitat destruction due to coastal urbanization are of concern.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Comments: This species may be particularly vulnerable to pollution in coastal areas and development of beach-front habitats (Robards et al. 1999c). Sand lance avoid oiled substrates (Pinto et al. 1984) and their site fidelity, spawning habitat requirements and burrowing behavior make them especially sensitive to beach pollution. Indirect evidence suggests that populations in Prince William Sound were negatively impacted by the Exxon Valdez oil spill in 1989 (Golet et al. 2002). In Puget Sound, Washington, habitat is threatened by urbanization; placement of shoreline armoring structures and other development activities eliminate sand and gravel intertidal spawning and burrowing habitat (Penttila 1997).

Commercial fishing in Japan may impact this species, as 100,000 tons are harvested per year; in the U.S. limited recreational use of Pacific sand lance as bait is permitted (Emmet et al. 1991). Commercial fishing bycatch for this species is relatively low (Kruse et al. 2000).

May compete for food with salmon and herring. In Prince William Sound, Alaska, sand lance changed their diets when feeding in sympatric aggregations with Pink Salmon and herring; sand lance total food consumption declined in the presence of both species (Sturdevant et al. 2000).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Biological Research Needs: Basic research is needed on species life history parameters including reproductive ecology, productivity, and habitat requirements. Genetic studies are needed to identify population structure. Major sources of mortality need to be identified.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: The taxonomy of the genus Ammodytes is debated; research is needed to establish if 1) two genetically distinct species are present in the north Pacific and if 2) A. hexapterus and A. americanus are actually distinct species, or if A. americanus belongs to a single trans-Atlantic species, A. marinus, which may be circumpolar and synonymous with A. hexapterus (Robards et al. 1999d, Nizinski et al. 1990 in Mecklenburg et al. 2002). Similar in external appearance, differentiation between species of Ammodytes relies on meristic characters such as the number of vertebrate or protein characterization with electrophoresis; this has led to some confusion in the scientific literature about species names and geographic ranges (McGurk and Warburton 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!