Articles on this page are available in 1 other language: Arabic (21) (learn more)

Overview

Brief Summary

Biology

Commonly found in coastal waters, the star sturgeon spends the day close to the seabed, where its downward-facing mouth helps it to feed on bottom-dwelling organisms, such as worms, molluscs and small fish (2) (4). At night, the star sturgeon becomes more active, rising up to the water surface to find other sources of prey (4). In order to reproduce, the star sturgeon must undergo a migration from the sea into a freshwater river, swimming upstream to the spawning ground. Interestingly, there are two separate “races” of star sturgeon, which display different spawning behaviours. One race migrates and spawns during spring and summer, while the other migrates in the winter, over-winters in the river and spawns in the following spring (2). A single female produces a vast amount of eggs, in the order of hundreds of thousands, which stick to river vegetation and stones (6). Generally, it is only the juvenile star sturgeons that are threatened by predation, as the large size and armour of the adults helps to deter predators (2) (6). Nevertheless, on occasion, the parasitic, eel-like lamprey has been known to cause fatal injuries to adult star sturgeons (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology

At the sea, it occurs in coastal and estuarine zones and forages on the bottom mostly on clayey sand and intensively in the middle and upper water layers (Ref. 59043). Found mainly near shore over sand and mud, stays at the bottom during the day and rises to the surface to feed at night. Feeds mainly on fish, also mollusks, crustaceans and worms (Ref. 3193). Spawns in strong-current habitats in main course of large and deep rivers, on stone or gravel bottom. Spawning also takes place on flooded river banks and if gravel bottom is not available, on sand or sandy clay. Juveniles stay in shallow riverine habitats during first summer (Ref. 59043). One of the three most important species for caviar; also utilized fresh and frozen; eaten pan-fried, broiled and baked (Ref. 9988). Overfishing at the sea for meat and caviar will soon cause extinction of the natural populations and their survival can only depend on stocking (Ref. 59043).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Belonging to an ancient group of fish, the prehistoric-looking star sturgeon is notable for being one of the three main caviar producing sturgeon species (2). Reaching over two metres in length, the star sturgeon's elongated body is armoured with rows of hard, spiky, white nodules, which brightly contrast with the blackish-grey upperparts. Like other sturgeons, the star sturgeon's mouth is found on the underside of its head, with a cluster of short barbells located between the mouth and the tip of its long, pointed snout. The tail fin is uneven, with a small, short lower lobe and a much larger upper lobe extending upwards and away from the body (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Stellate Sturgeon inhabits in the Caspian, Black and Azov Seas, and rarely in the Aegan Sea. The Volga, Ural, Terek, Sulak, Kura, Don, Danube, Kuban Rivers are the major spawning rivers. The length of the spawning migration route of the Volga to the cascade of dams is up to Rybinsk, in the Ural - to Uralsk, in the Don - to Pavlovsk, in the Kuban - to Armavir. The highest abundance and biomass of natural population remained in the Caspian Sea.

The feeding area in the Caspian Sea of Stellate Sturgeon extended from the shallow water area of the northern part of the sea to the Iranian coast. An intensive migration of Stellate Sturgeon began in spring (March-May) to the shallow water area, in the Northern Caspian where the largest concentrations of fish were observed at the western coast of this part of the sea, as well as in the pre-mouth areas in the eastern part of the Volga River Delta (Belinskii and Igolkinskii Banks (Khodorevskaya et al. 2009)).


Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

In the Caspian Sea and the tributaries that flow into it.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Baltic sea, Black Sea, European waters (ERMS scope), Greek Exclusive Economic Zone
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eurasia: Caspian, Black, Azov and Aegean Seas, ascending rivers to spawn. Occurrence in Albania needs confirmation. Introduced in Aral Sea. Artificially propagated (Ref. 6866). Appendix III of the Bern Convention (protected fauna). International trade restricted (CITES II, since 1.4.98; CMS Appendix II).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The star sturgeon inhabits the Black, Caspian and Azov Seas, and associated rivers and waterways such as the Danube (1) (2). Individuals have also been found in the Adriatic Sea, off the west coast of Italy, and in the Aegean Sea, around the coasts of Greece and Turkey (5)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 40 - 46; Analsoft rays: 24 - 29
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 2200 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

220 cm TL (male/unsexed; (Ref. 9988)); max. published weight: 80.0 kg (Ref. 9988); max. reported age: 27 years (Ref. 6866)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Snout long, pointed at tip. Lower lip not continuous, interrupted at center. Barbels short not reaching mouth but nearer to it than to tip of snout. Five rows of scutes, dorsal 11-14, lateral 30-36 on each side, ventral 10-11 on each side, with small bony stellate plates and smaller grains between main scute rows. Back dark grey to almost black, flanks lighter, belly white.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is found at sea, coastal and estuarine zones, where it forages on clayey sand bottoms, as well as intensively in middle and upper water layers. It spawns in strong-current habitats in the main course of large and deep rivers, on stone or gravel bottoms. It is also known to spawn on flooded river banks, on sand or sandy clay. Juveniles inhabit shallow riverine habitats during their first summer (Khodorevskaya et al. 2009).

This species is anadromous (spending at least part of its life in salt water and returning to rivers to breed). Caspian fish first mature at 6-7 years for males, and 7-8 years for females, with a generation length not less than 10 years. Females reproduce every 3-4 years and males every 2-3 years in April-September. It spawns only under relatively constant hydrological conditions, as fluctuating hydrological conditions lead to high egg mortality. This species migrates upriver at higher temperatures and therefore later than other sturgeons, with two peaks, in spring and in autumn. Males remain at spawning sites no longer than six weeks and females only 10-12 days. Spent individuals migrate directly back to sea. Yolk-sac larvae are pelagic for 2-3 days and drift with current. Juveniles migrate to sea during their first summer and remain there until maturity. At sea, this species feeds on a wide variety of crustaceans, molluscs and benthic as well as pelagic fish (Khodorevskaya et al. 2009).

The main habitat in the Caspian Sea of the Stellate Sturgeon in the winter is the middle part of the sea (Legeza 1970). In the spring they migrate to the north, with its maximum density being observed off the mid-west coast in shallow water rich in food organisms (Legeza 1970). In late spring they move to the north-west coast. In autumn Stellate Sturgeons begin migrating to the south of the Caspian Sea (earlier than other species), concentrating at the mid-western coast and the south-eastern coast (Legeza 1970).

The spawning migration starts in April. Spawning occurs at temperatures from 9 to 16 °C in the channel and spring flooded spawning grounds at the current speed of 0.8-1.2 m / sec. The greatest number of Stellate Sturgeon migrate to the Ural River (Peseridi et al. 1986, Dovgopol et al. 1992). Stellate Sturgeon stop eating after the beginning of the spawning migration. After spawning, they return downstream into the sea, where they begin actively feeding. The juveniles of Stellate Sturgeon also do not delay in the river and migrate for feeding into the sea.

Systems
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 10 - 100m.
From 10 to 100 meters.

Habitat: demersal. Found mainly near shore over sand and mud, stays at the bottom during the day and rises to the surface to feed at night. Feeds mainly on fish, also molluscs, crustaceans and worms (Ref. 3193). One of the three most important species for caviar; also utilized fresh and frozen; eaten pan-fried, broiled and baked (Ref. 9988).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

The star sturgeon can tolerate a range of habitats, from the salty waters of the Aegean and Adriatic Seas, to the freshwater conditions of the Danube (2) (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

demersal; anadromous (Ref. 51243); freshwater; brackish; marine; depth range 10 - 100 m
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Anadromous. Fish that ascend rivers to spawn, as salmon and hilsa do. Sub-division of diadromous. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

At bottom during the day, rising to surface to feed at night. Long migrations in sea.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Acipenser stellatus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 12 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBGC1672-06|NC_005795|Acipenser stellatus| ACCCGTTGATTCTTTTCTACTAACCACAAAGATATTGGCACCCTGTATTTAGTATTTGGTGCCTGAGCAGGCATAGTCGGCACAGCCCTC---AGCCTTCTGATCCGTGCCGAACTGAGCCAACCTGGTGCCTTGCTTGGCGAT---GATCAGATCTACAATGTTATCGTCACAGCCCACGCCTTTGTCATGATTTTCTTTATAGTAATGCCCATTATGATTGGCGGATTCGGAAACTGACTGGTCCCTCTAATA---ATCGGAGCCCCAGACATAGCATTCCCTCGCATGAACAATATGAGCTTCTGACTTCTACCCCCATCCTTCCTACTCCTTTTAGCCTCCTCTGGGGTAGAGGCCGGAGCCGGCACAGGGTGAACTGTTTACCCCCCACTGGCGGGAAACCTGGCCCATGCAGGAGCCTCTGTAGACCTA---ACCATTTTCTCCCTTCACCTGGCCGGAGTTTCGTCCATCTTGGGGGCCATTAACTTTATTACCACAATTATTAACATGAAGCCCCCCGCAGTATCCCAATACCAGACACCTTTATTTGTGTGATCTGTATTAATCACGGCCGTACTTCTCCTACTCTCACTGCCAGTGCTAGCTGCG---GGAATCACAATGCTCCTAACAGACCGAAATTTAAACACCACCTTCTTTGACCCAGCCGGAGGAGGAGACCCCATCCTCTATCAGCACCTATTTTGATTCTTTGGCCACCCAGAAGTGTATATTCTAATTCTACCGGGATTCGGCATGATCTCCCATATTGTAGCATACTATGCCGGCAAAAAA---GAACCTTTTGGTTACATAGGAATAGTATGGGCTATAATGGCTATTGGACTACTAGGCTTTATCGTGTGAGCTCATCACATATTCACAGTTGGGATGG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Acipenser stellatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 12
Species: 61
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
CR
Critically Endangered

Red List Criteria
A2cde

Version
3.1

Year Assessed
2010

Assessor/s
Qiwei, W.

Reviewer/s
Pourkazemi, M. & Smith, K.

Contributor/s

Justification
The species was known from the Caspian, Black and Aegean Seas. It is now extirpated from the Aegean Sea, and in the Black Sea basin the last natural population migrates up the Danube where it is heavily overfished. Only very few spawners remain in the rest of the Black Sea basin. The Caspian populations are under massive pressure from overfishing (including poaching) and loss of spawning sites and the stocks are declining very fast. Almost all migrating spawners are poached below the Volgograd dam. Overfishing will soon cause extinction of the natural populations. In the immediate future, survival can only depend on stocking and effective fisheries management and combating illegal fishing. Based on catch data, and number of individuals migrating into the Volga and Ural rivers it is estimated that the species has undergone a population decline of at least 80% (possibly close to 100%) in the past three generations (minimum estimate of 30 years, possibly up to 40), which is expected to continue. Catch data shows massive declines across the species range with a 98% decline between 1980 and 2007 in the Caspian Sea, and a 72.5% in four years (2002-2005) in Romania (Danube).

History
  • 1996
    Endangered
    (Baillie and Groombridge 1996)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
A2d

Version
2.3

Year Assessed
1996
  • Needs updating

Assessor/s
Sturgeon Specialist Group

Reviewer/s
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A1acde+2d

Version
2.3

Year Assessed
1996
  • Needs updating

Assessor/s
Sturgeon Specialist Group

Reviewer/s
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
A1acde+2d

Version
2.3

Year Assessed
1996
  • Needs updating

Assessor/s
Sturgeon Specialist Group

Reviewer/s
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Endangered (EN) on the IUCN Red List (1) and listed on Appendix II of CITES (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
In the early 1990s it was estimated that nearly 100% of the Sea of Azov population and 30% of the Caspian Sea population were from stocking. Recent estimations are that more than 50% of the Caspian Sea populations are from stocking (Pourkazemi pers. comm.).

Global catches show that in 1992, 2,730 tonnes were caught, falling to a low of 38 tonnes in 2004, and 50 tonnes in 2007 (a decline of over 98% in 15 years). The average catch between 1992-1999 was 1,063 tonnes, and between 2000 and 2007 it was 132 tonnes, a decline of 87% (FAO 2009). The decline in commercial catch for the species is believed to reflect a decline in the species population (CITES 2000).

For the whole Caspian basin, catch peaked in 1977 with 13,700 tonnes; this has shown an almost continuous decline to 305 tonnes in 2003 (most recent data) (over 97% decline in 32 years) (Pikitch et al. 2005). In 2008 the agreed catch quota for A.stellatus for all Caspian Sea countries in 2008 was set at 240 tonnes, including commercial and scientific catch; the quota has not been met (Pourkazemi pers. comm.).

Khodorevskaya et al. (2009) shows that the average numbers of spawners entering the lower Volga per year has fallen from a peak of 230,000 (between 1986-90) to just 50,000 (between 1998-2002), a decline of 78%. It is expected that the decline has continued at a similar rate to the present time (though data does not exist) and will continue. In the Ural the estimated number of migrating individuals per year has also shown a decline, in 1970: 1,100,000; 1979: 1,050,000; 1990: 300,000 migrating individuals (Veschev 1995); 1998: 103,600; 2001: 87,400 (Pikitch et al. 2000). This shows a 92% decline from 1979 to 2001 (also from 1970 to 2001, as migrating individuals per year remained relatively stable between 1970 and 1979).

Distribution of Stellate Sturgeon in the Caspian Sea has declined (based on CPUE distribution data) from the 1970s to 2004 (Khodorevskaya et al. 2009).

In summer, Stellate Sturgeon feed in the warmer waters, forming the densest concentration, more than 0.6 specimens per 10,000 m3 in the western region of the Caspian sea; this is four times higher than was recorded in 1994 (Khodorevskaya et al. 2009). Concentration of all species of sturgeons and in particular, of Stellate Sturgeon, remains high in the area off the island of Ogurchinskii in the southern part of the Caspian Sea off the Turkmenian coast, but its abundance has declined 3.4 times compared to 1991 (Khodorevskaya et al. 2009).

The total population size in the investigated water in 2008 was between 6.7-9.5 million specimens, this has fallen from 83 million in 1988 (Khodorevskaya et al. 2009).

Over recent decades, Stellate Sturgeon abundance in the Caspian Sea has reduced. Evidence of this is shown in the decrease of the average catch per unit effort during trawl surveys between 1978-1999. These showed a three-fold decrease in the northern Caspian Sea, a 2.7-fold decline in the middle part of the Caspian Sea and a six-fold decline off the Dagestan coast (Vlasenko et al. 2003). Decrease of CPUE has been more apparent in the southern part of the sea. The Stellate Sturgeon population has declined from 69.7 million specimens in 1978 to 15.6 million in 2002, and 7.6 million specimens in 2008. Commercial stock decreased by 12 times during this period (Khodorevskaya et al. 2009).

In the Black Sea, in Romania, from 2002-2005 the catches of wild individuals (stocking only started in 2006 in the Danube) dropped from 12.427 tonnes to 3.43 tonnes (72.5% in 4 years); in 2006 commercial catch was stopped (Suciu pers comm.). In Azov Sea, no wild mature females have been caught [for a stocking programme] since 2004 (Chebanov pers. comm.).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
The reason for Stellate Sturgeon abundance decrease is primarily due to marine fishing and a sharp increase of poaching, seizing the largest and mature fish and nullifying the natural reproduction of sturgeon. In the Caspian Sea and Sea of Azov the illegal sturgeon catch for all species was evaluated to be 6 to 10 times the legal catch (CITES 2000). Single specimens of Stellate Sturgeon were harvested at the Azerbaijan coast during a trawl survey in 1994; this is most likely due to heavy illegal fishing (large number of poaching gears were observed).

Overfishing has prevented hatcheries catching enough mature individuals to maintain the necessary broodstock (Artyukhin 1997 in CITES 2000), and stocking has severely decreased in the Caspian Sea as the stocking process relies upon wild individuals (unlike other sturgeon species they are difficult to keep mature individuals in ponds, Nikolai pers. comm.). The annual release (over the past 10 years) of sturgeon juveniles from sturgeon hatcheries in Russia amounts to from 3 to 20 million specimens; in Kazakhstan - from 2.5 to 4.1 million specimens; in Azerbaijan - from 2.5 to 6.8 million specimens; in Islamic Republic of Iran - from 0.2 to 1.3 million specimens. This quantity of stocks recruitment of Stellate Sturgeon from industrial sturgeon culture is not enough to supply the population at an optimum level (Khodorevskaya et al. 2009).

Dams have also led to the loss of many spawning grounds. For example the Volgograd dam (built in 1955) led to loss of 40% of spawning sites formally available in the Volga (Khodorevskaya et al. 2009). The species is also considered extirpated from the upper and middle Danube since the building of the Djerdap Dams (Iron Gate Dams). The Don River dam removed 68,000 ha of spawning ground and flow regulation in the Kuban led to the loss of 140,000 ha of spawning grounds.

Pollution is a threat to the species. In 1990, 55,000 sturgeon were found dead on the shore of the Sea of Azov as the result of pollution.

The Allee affect is also a potential threat to the species (Gessner, J. pers. comm.).

Introduced Mnemiopsis (from US) which impacts the species food source (pelagic fishes) has impacted the Black Sea population (impacts now reduced in Black Sea) and is now impacting the Caspian Sea populations.

Introduction of fertilized eggs (from before 1986 and again 2003/4, and it may continue) from the Caspian Sea into the Azov Sea may impact the genetic integrity of Azov Sea population (Chebanov pers. comm.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Critically Endangered (CR) (A2cde)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

The major threat to the star sturgeon's survival is overfishing for its meat and, more significantly for caviar, sold under the name “sevruga”. This is produced from the sturgeon's unfertilised eggs and is almost always extracted by killing the female. The caviar industry is currently in crisis, as the dwindling stocks of the star sturgeon, and the other major caviar producing species, can no longer provide sufficient caviar to meet the huge worldwide demand (2). Despite attempts to manage star sturgeon stocks, illegal fishing and black market trade in caviar are threatening to drive this already endangered species to extinction (2) (7). The threat of overexploitation for the caviar trade is also exacerbated by a reduction in the star sturgeon's natural spawning grounds due to the construction of hydroelectric power stations and reservoirs, and also by the high levels of pollution found throughout its range (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Restocking measures are ongoing. However, although aquaculture contributes considerably to the maintenance of the stocks, it cannot compensate for the damage caused to natural reproduction by overfishing (CITES 2000).

It is not fully protected in any range state apart from Moldova. A licence is required for fishing in most countries and private sturgeon fisheries are banned in Iran. This species was listed on CITES Appendix II in 1998.

According to 2007 Caspian Sea Bioresource Commission, 8.1 million fingerlings of A. stellatus were released into Caspian Sea by Khazakstan, Iran and Azerbaijan. Russia released 45 million (all sturgeon species) in 2007, but not specified how many were A. stellatus - but this is not less than 12 million (Ruban pers. comm.).

To preserve the commercial importance of Stellate Sturgeon population it is necessary to protect the recruitment from natural spawning and increase the industrial sturgeon aquaculture. Considering the state of stocks of the Caspian Sea it is necessary for all Caspian Sea states to suspend its harvest for commercial purposes (in Russia, the ban on Stellate Sturgeon commercial harvesting has been introduced since 2005).

Stellate Sturgeon has no commercial value in the basins of the Black and Azov Seas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

In 1998, the star sturgeon was listed by the Convention on International Trade in Endangered Species (CITES), meaning that all international trade in this species is controlled by maximum export quotas and trade permits (2) (3). The countries which are party to the CITES agreement must agree on sustainable catch and export quotas based on scientific surveys, and must adopt regional conservation strategies and attempt to combat illegal fishing. The strict enforcement of these regulations meant that in 2006, caviar export was banned for all of the countries bordering the Caspian Sea, since the countries failed to provide sufficient information about the sustainability of their catch. This promoted an agreement between the countries to reduce their star sturgeon caviar export quotas in 2007 by over 25 percent (8). The countries bordering the Black Sea have adopted an even stricter policy regarding their sturgeon stocks, maintaining a zero quota policy, which has continued into 2008 (9). Whether these reduced quotas will prove sufficient to allow the star sturgeon's population to recover remains to be seen. Due to limited natural spawning grounds, a high proportion of star sturgeon stock in the Caspian and Azov seas is maintained by farm-grown fish released into the wild. Unfortunately, however, poaching has reduced the numbers of adult star sturgeons so dramatically that hatcheries are struggling to obtain enough breeding fish to conduct artificial propagation (2). In an attempt to control the illegal trade in this species, in 2007 a world database for caviar trade was set up to monitor the origin of exported caviar and track shipments around the world (10).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; aquaculture: commercial; aquarium: public aquariums
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Starry sturgeon

Starry Sturgeon, Acipenser stellatus, also known as Drakul and (Turkish) Uzun Burun (long nosed) is a species of sturgeons, living in the Black, Azov, and Caspian sea basins. It is rare in the Adriatic Sea. It reaches 220 cm (over 7 feet) and weighs up to 80 kg (approximately 180 Lbs). The maximum reported age for this species is 27 years. The starry sturgeon is a harmless species.

It is an important commercial species. It is one of the three most important species for caviar along with the Beluga sturgeon and the Persian sturgeon. Its flesh is considered an expensive delicacy in the Caspian region. It is used to make kababs, or is consumed pan fried, broiled, or smoked. There have been several attempts in Russia, Iran, Italy, and the US to adapt this species for aquaculture, with varying degrees of success.

The resilience of this species is low. The minimum population doubling time is 4.5 - 14 years.

The starry sturgeon is an endangered species and trade in products made from its body parts are restricted by CITES

Contents

Environment

Demersal; anadromous; lives in depth ranging between 10 – 100 m. Prefers temperature between 10 – 20°C. It is mainly found near shore over sand and mud, stays at the bottom during the day and rises to the surface to feed at night. Feeds mainly on fish, also mollusks, crustaceans and worms.

Appearance

Stamp of Azerbaijan 728.jpg

It has a dark grey to almost black back. The flanks are lighter, the belly is almost white. Morphology: Dorsal soft rays (total): 40 - 46; Anal soft rays: 24 – 29. Snout long, pointed at tip. Lower lip not continuous, interrupted at center. Barbels short not reaching mouth but nearer to it than to tip of snout. Five rows of scutes, dorsal 11-14, lateral 30-36 on each side, ventral 10-11 on each side, with small bony stellate plates and smaller grains between main scute rows.

See also

References

  1. ^ Sturgeon Specialist Group (1996). Acipenser stellatus. 2006. IUCN Red List of Threatened Species. IUCN 2006. www.iucnredlist.org. Retrieved on 25 February 2007. Listed as Endangered (EN A2d v2.3)
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!