Overview

Comprehensive Description

Biology

Found in estuaries, lower reaches of large rivers, and in salt or brackish water off river mouths (Ref. 5723). Probably spawns in fresh water (Ref. 27547). May cover considerable distances in the ocean (Ref. 27547). Edible but with a disagreeable taste and unpleasant odor (Ref. 1998).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Non-breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: Coastal areas of North Pacific from Gulf of Alaska to southern California and Ensenada, Mexico; currently known to spawn only in the Sacramento and Klamath river systems in California and the Rogue River in Oregon (Houston 1988, Berstein and Bemis 1997, NMFS 2001). The possibility of current spawning in the Umpqua River, Oregon, is under investigation. There is recent evidence of limited green sturgeon spawning in the Eel River based on the collection of both adult and juvenile fish in the mid-1990s (see NMFS 2003). The species formerly spawned in the San Joaquin River in California (NMFS 2001). Green sturgeons are reported to spawn in the Feather River, but this has not been substantiated. The northern distinct population segment (DPS) ranges northward from the Eel River, California; the southern DPS includes drainages whose estuaries are south of the Eel River (NMFS 2003).

The largest spawning population is thought to occur in the Klamath River on the north coast of California (NMFS 2003). Juveniles are captured each year in the Klamath River and have also been found in the lower portion of the Salmon River (a tributary to the Klamath River). Adults occur in the Trinity River, a major tributary to the Klamath River, to Gray's Falls (rkm 69), but spawning can be confirmed only up to the Willow Creek trap (rkm 40).

In the Sacramento river system, spawning occurs predominantly in the upper Sacramento River, above Hamilton City and perhaps as far upstream as Keswick Dam (see NMFS 2003). Juveniles are found throughout the Delta and San Francisco Bay. Adults and juveniles occur throughout the upper Sacramento River (NMFS 2003).

The Rogue River recently was confirmed as a third spawning area; radio-tagged spawners moved upriver as far as rkm 39 (see NMFS 2003); juveniles are taken in beach seining efforts in the Rogue River estuary, and adults are taken in almost all of the Oregon coastal estuaries from the Chetco River to Nehalem Bay (see NMFS 2003).

In the mid-1930s, before Bonneville dam, green sturgeons were found in the Columbia River up to the Cascade Rapids; today they occur up river to the Bonneville Dam (rkm 235) but predominately in the lower 60 rkm. Tagging studies indicate a substantial exchange of fish between the Columbia River and Willapa Bay. The estuaries of Willapa Bay, the Columbia River, and Grays Harbor are late summer concentration areas. The reasons for these concentrations are unclear, but they do not appear to be related to spawning or feeding (NMFS 2003).

Small numbers have been taken in both Tomales Bay and Bodega Bay and a single fish has been taken from the Noyo River. Green sturgeons are regularly taken in small numbers in Humboldt Bay and have been caught in coastal waters and in estuaries from Arcata Bay to the Oregon border. Small numbers of both adult and juvenile green sturgeons have been observed in the Eel River (NMFS 2003). Green sturgeons occur in small numbers along the western coast of Vancouver Island and the Skeena River. Historically, they were not uncommon in the Fraser River. There is no evidence of historical or recent spawning in Canada (Trevor Davies, draft COSEWIC report, 2003).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Green Sturgeon is an anadromous species that spend most of their life in near-shore marine and estuarine waters from Mexico to southeast Alaska (Houston 1988, Moyle et al. 1995, Davies 2004).

Large concentrations of Green Sturgeon are still found in coastal estuaries, but their range in freshwater has been restricted by damming in some rivers. For example, Green Sturgeon were historically observed hundreds of kilometers upstream in the Sacramento and Columbia rivers, but are currently restricted in the Columbia River to the lower 60 km downstream of the Bonneville Dam (Moyle 2002). Spawning is presently known to occur in only three rivers in North America, all of which are in the United States: the Rogue River in Oregon (Erickson et al. 2001, Rien et al. 2001), and the Klamath and Sacramento river systems in California (EPIC 2001, Adams et al. 2002, CDFG 2002, Moyle et al. 1992,1994). Spawning populations have been extirpated from the San Joaquin, Eel, South Fork, and Trinity rivers, and possibly the Umpqua River (EPIC 2001, NMFS 2002). Seasonal concentrations occur in several estuaries including the Sacramento-San Joaquin, Eel, Columbia, Willapa Bay, Grays Harbor and the Fraser River (Beamesderfer and Webb 2002).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America: Aleutian Islands and the Gulf of Alaska to Ensenada, Mexico. Considered vulnerable in Canada. The Asian population is now considered to be a separate species Acipenser mikadoi (Ref. 6866). International trade restricted (CITES II, since 1.4.98; CMS Appendix II).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Historic Range:
U.S.A. (CA) Southern Distinct Population Segment, which includes all spawning populations south of the Eel River (exclusive), principally including the Sacramento River spawning population.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western North America.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 33 - 35; Analspines: 0; Analsoft rays: 22 - 28
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 213 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum size: 2130 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

250 cm TL (male/unsexed; (Ref. 56557)); max. published weight: 159.0 kg (Ref. 2850); max. reported age: 60 years (Ref. 72476)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Characterized by a single row of 1 to 4 bony plates along the midventral line between the anus and the anal fin, and about 33 to 35 rays in the dorsal fin. Dorsal arises at posterior third of the total length; anal fin arises under posterior part of dorsal; pectorals originate low on the body just behind gill opening and are large and rounded; pelvic fins arise near the anus. Generally olive to dark green, lower parts more or less whitish green; a longitudinal olive-green stripe on side between lateral and ventrolateral plates, another on midventral surface; fins grayish to pale green (Ref. 27547).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Amur River Demersal Habitat

This taxon is one of a number of demersal species in the Amur River system. Demersal river fish are found at the river bottom, feeding on benthos and zooplankton

The persistence of mercury contamination in Amur River bottom sediments is a major issue, arising from historic cinnabar mining in the basin and poor waste management practises, especially in the communist Soviet era, where industrial development was placed ahead of sound conservation practises.

The largest native demersal fish species in the Amur River is the 560 centimeter (cm) long kaluga (Huso dauricus); demersal biota are those that inhabit the bottom of a surface water body. Another large demersal fish found in the Amur is the 300 cm Amur sturgeon (Acipenser schrenckii), a taxon which is endemic to the Amur basin.

Other demersal endemic fish species (all in the concubitae family) of the Amur Basin are Iksookimia longicorpa, I. koreensis, I. hugowolfeldi, Cobitis melanoleuca melanoleuca and the Puan spine loach (Iksookimia pumila).

Creative Commons Attribution 3.0 (CC BY 3.0)

© C.Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Habitat Type: Freshwater

Comments: Green sturgeons spend most of their lives in coastal marine waters, estuaries, and the lower reaches of large rivers. They ascend rivers to spawn, but specific spawning and rearing habitats are poorly known.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
The Green Sturgeon is among the most marine oriented and widespread of the sturgeons. Like most sturgeons, the Green Sturgeon is characterized by large size, longevity, delayed maturation, high fecundity, and far-ranging movements. Green Sturgeon reach sizes up to 2.7 m and have been aged to over 50 years (Nakamoto et al. 1995, Farr et al. 2002). Mortality rates of subadults and adults are low and probably do not exceed 10% per year from natural causes based on age frequency analysis. Males typically mature at about 15–17 years and 1.5–1.8 m, while females typically mature at 20–25 years and 1.8–2.1 m (Van Eenennaam and Doroshov 2001a). Similarly aged males are generally smaller than females with males from the northern DPS achieving a maximum size of 168 cm, while sexually mature males and females from the southern DPS range in size from 139 to199 cm and 157 to 223 cm, respectively (Adams et al. 2002). Spawning is believed to occur every 3-5 years and the generation time is 27–33 years (Davies 2004).

Green Sturgeon are oviparious broadcast spawners and adult Green Sturgeon typically migrate into freshwater beginning in late February and spawning occurs in April to June in deep, turbulent river mainstems (Moyle et al. 1995). Klamath and Rogue River populations appear to spawn within 160 km of the ocean while the Sacramento population may travel over 320 km upriver. Green Sturgeon eggs and larvae are comparatively larger than those of other sturgeon species. For example, Cech et al. (2000) reported a egg diameter of 4.34, 3.40 and 2.62 mm for green, white, and Atlantic Sturgeon (A. oxyrinchus) respectfully indicating that Green Sturgeon have eggs which have a volume twice that of white and over four times that of Atlantic Sturgeon. Consequently, Green Sturgeon have a relatively lower fecundity in comparison to other similar sized sturgeon species as reproductive energy is more heavily invested in egg size rather than egg number (Van Eenennaam et al. 2001b, Cech et al. 2000). Fecundity varies with age and size, but has been estimated to be in the order of 2,800 eggs per kilogram bodyweight; approximately half that of White Sturgeon (Acipenser transmontanus) at 5,648 eggs per kilogram bodyweight (Moyle 2002).

The eggs do not form a thick jelly coat as do those of other North American sturgeon and exhibit poor adhesion to substrate (Deng 2000, Cech et al. 2000), which would indicate sensitivity to turbidity loading (Moyle et al. 1994, Moyle 2002). Furthermore, the larger eggs and higher growth rates of developing Green Sturgeon in comparison to other North American sturgeons suggests that a higher oxygen demand may be required for proper embryonic development; thus Green Sturgeon may require colder, cleaner water for spawning. (USFWS 1995).

Eggs hatch in 7 to 9 days at 15°C (Van Eenennaam et al. 2001). Cech et al. (2000) reported that temperatures above 20°C are lethal to embryos and temperatures above 24°C significantly reduce five-day larval growth rates. Larvae begin to feed at 10 days post hatch and complete metamorphosis into juveniles at 45 days (Adams et al. 2002). Juvenile Green Sturgeon grow rapidly reaching 60 cm within 2–3 years and they spend 1–4 years in fresh and estuarine waters before dispersal to saltwater (Beamsesderfer and Webb 2002). Green Sturgeon are commonly observed in bays and estuaries up and down the coast and large concentrations enter the Columbia River estuary, and Washington's Grays Harbor and Willapa Bay during late summer (Moyle et al. 1995). Limited tagging studies show that tagged individuals from the Columbia River have been recaptured off the west coast of Vancouver Island (Adams et al. 2002).

During the 1 to 4 years of freshwater residence, juveniles gradually move to deeper and more saline areas as they grow (Beamesderfer and Webb 2002). As juveniles grow, they exhibit greater tolerance to salinity and achieve seawater tolerance at seven months or sooner (Allen and Cech 2003). Adults return to freshwater to spawn, and Green Sturgeon have been reported to spawn up to 160 km upstream in the Klamath and Rogue rivers, and over 300 km upstream in the Sacramento River (Beamesderder and Webb 2002). After spawning, they to sea in late autumn to early winter when temperatures drop below 10°C and flows increased above 100 m3s-1 (Erickson et al. 2002).

Juveniles are opportunistic benthic feeders with a diet consisting of various invertebrates and fish (EPIC 2001, Moyle 2002). Stomach content analysis indicates that adult Green Sturgeon have a marine diet consisting of various benthic invertebrates including shrimp, crabs, worms, amphioids, and isopods (EPIC 2001), but have also been observed feeding on sand lances (Ammodytes hexapterus) and other fish.

Systems
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; anadromous (Ref. 51243); freshwater; brackish; marine; depth range 0 - 80 m (Ref. 50610)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Tagged green sturgeons from the Sacramento and Columbia Rivers are primarily captured to the north in coastal and estuarine waters, with some fish tagged in the Columbia being recaptured as far north as British Columbia; while there is some bias associated with recovery of tagged fish through commercial fishing, the pattern of a northern migration is supported by the large concentration of green sturgeon in the Columbia River estuary, Willapa Bay, and Grays Harbor which peaks in August. These fish tend to be immature; however, mature fish and at least one ripe fish have been found in the lower Columbia River. Genetic evidence suggests that Columbia River green sturgeon are a mixture of fish from at least the Sacramento, Klamath, and Rogue Rivers. The reasons for the concentration of green sturgeon in Oregon and Washington estuaries during the summer are unknown as there is no known spawning in these rivers and all stomachs examined to date have been empty. See NMFS (2003) for specific sources of this information.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Anadromous. Fish that ascend rivers to spawn, as salmon and hilsa do. Sub-division of diadromous. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Adults feed on bottom invertebrates and small fish.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Found in estuaries, lower reaches of large rivers, and in salt or brackish water off river mouths (Ref. 5723). Probably spawns in fresh water (Ref. 27547). May cover considerable distances in the ocean (Ref. 27547).
  • Radtke, L.D. 1966 Distribution of smelt, juvenile sturgeon, and starry flounder in the Sacramento-San Joaquin Delta with observations on food of sturgeon. p. 115-129. In J. L. Turner and D. W. Kelly (comp.) Ecological studies of the Sacramento-San Joaquin Delta. Part II Fishes of the Delta. (Ref. 9668)   http://www.fishbase.org/references/FBRefSummary.php?id=9668&speccode=2592 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 1 - 5

Comments: Wide-ranging migrant, but only 3 known spawning rivers (Klamath River, California; Sacramento River system, California; Rogue River, Oregon (Moyle et al. 1995). Juveniles have been found in several additional coastal rivers in Oregon, but spawning in these areas has not been confirmed (Moyle et al. 1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

250 - 2500 individuals

Comments: Each of the known or suspected spawning populations presently contain at most a few hundred mature females (Musick et al. 2000). Coded population size is based on this information.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Very little is known about habits and life history, probably similar to those of white sturgeon.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

Apparently spawning occurs in the spring. Individuals become sexually mature at about 17 years (males) or approximately 21 years (females) (NMFS 2001). Females spawn at intervals of 3-7 years (NMFS 2001). Individuals live up to several decades.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Acipenser medirostris

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTGTATTTAGTATTTGGTGCCTGAGCAGGCATAGTCGGTACAGCCCTCAGCCTTCTGATCCGTGCCGAACTGAGCCAACCCGGTGCCTTGCTTGGCGATGACCAGATCTACAATGTTATCGTTACAGCCCACGCCTTTGTTATGATTTTCTTTATAGTGATACCCATCATAATTGGCGGATTCGGAAACTGACTGGTACCCCTAATAATTGGAGCCCCAGACATGGCATTCCCTCGCATAAACAATATGAGCTTCTGGCTCCTACCCCCATCCTTCCTACTCCTTTTGGCCTCCTCTGGGGTAGAGGCCGGAGCCGGCACAGGGTGAACTGTTTACCCCCCACTGGCGGGAAACCTAGCCCATGCGGGAGCCTCTGTAGACCTAACCATTTTTTCCCTCCACCTGGCCGGGGTGTCGTCCATTTTAGGGGCCATTAATTTTATTACCACGATTATTAACATGAAGCCCCCCGCAGTCTCCCAATATCAGACACCTCTATTTGTATGATCTGTATTAATTACAGCCGTACTTCTCCTACTGTCACTGCCAGTGCTAGCTGCGGGAATTACAATACTCCTAACAGACCGGAATTTAAACACCACCTTCTTTGACCCAGCCGGAGGAGGAGACCCCATCCTCTACCAACACCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Acipenser medirostris

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 17
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N1N - Critically Imperiled

United States

Rounded National Status Rank: N3 - Vulnerable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G3 - Vulnerable

Reasons: Large marine range along North Pacific Ocean of North America, but only a few known spawning rivers; threats include commercial and sport fisheries, modification of spawning habitats, entrainment in water project diversions, and pollution; appears not to be greatly threatened, but better information on abundance and trends is needed.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2006

Assessor/s
St. Pierre, R. (US Fish&Wildlife Service) & Campbell, R.R. (COSEWIC Freshwater Fishes SSC)

Reviewer/s
St. Pierre, R. & Pourkazemi, M. (Sturgeon Red List Authority)

Contributor/s

Justification
Acipenser medirostris nearly meets Vulnerable under criterion A2c. Although the estimated population size is above the thresholds for any of the categories for threat, it is not large (34,000–166,000 adults and sub-adults) and the number of mature individuals is unknown. The estimated number of spawning females for the Klamath River (which supports most of the northern DPS) is only 760–1,500 per year. However, four out of seven (57%) of the known spawning locations have been lost within the last three generations for reasons, not all of which are clearly understood, and may not have ceased or reversible.

Green Sturgeon are not subjected to overfishing and habitat fragmentation that have affected other sturgeon species. There are active fisheries restrictions in place throughout the species’ range in the U.S. and Canada.

The current adult–subadult population size is estimated at least in the tens of thousands and there is no evidence of overall population decline, although four of the seven known spawning locations may have been lost. Considerable research is underway or planned to fill in information gaps on stock structure, abundance and migrations. Although Green Sturgeon currently does not warrant "threatened" status under U.S. Endangered Species Act, concerns remain about the limited number of spawning rivers, potential growth of fisheries, and persistent habitat threats from water withdrawals and agricultural pesticides. Given the species’ life history characteristics and limited number of spawning sites, it is considered likely that the species would quickly move into a threatened category if current conservation efforts were withdrawn. It is therefore assessed as Near Threatened.

History
  • 1996
    Vulnerable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Current Listing Status Summary

Status: Threatened
Date Listed: 06/06/2006
Lead Region:   National Marine Fisheries Service (Region 11) 
Where Listed: U.S.A. (CA) Southern Distinct Population Segment


Population detail:

Population location: U.S.A. (CA) Southern Distinct Population Segment
Listing status: T

For most current information and documents related to the conservation status and management of Acipenser medirostris , see its USFWS Species Profile

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: The available population information for green sturgeon in the northern DPS does not provide any evidence that the abundance of green sturgeon in this DPS is declining (NMFS 2003). In particular, the fishery-dependent harvest data from the Yurok tribal fishery show no evidence that catch or CPUE are declining, or that large fish are being removed from that spawning population. Despite this information, NMFS was uncertain about the status of green sturgeon in this DPS because no direct fisheries-independent population estimates were available.

There is no evidence from the available San Pablo Bay population information that green sturgeon abundance in the southern DPS is declining (NMFS 2003). Nevertheless, NMFS (2003) was uncertain about the status of
green sturgeon in this DPS because the method of deriving population estimates involves numerous assumptions and there are no direct measures of population abundance.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Preliminary population genetics results suggest that Green Sturgeon from the Klamath and Rogue rivers are similar to each other but distinct from fish from San Pablo Bay. Green Sturgeon commonly occur in the lower Columbia River (Oregon–Washington) and genetic samples taken there appear to be a mixture of the other populations (Israel et al. 2002).

The National Marine Fisheries Service (NMFS 2003) has determined that, based on genetic evidence of discreteness, there are two Distinct Population Segments (DPS's) for Green Sturgeon. The northern population ranges from the Eel River, California, to at least the Rogue River, Oregon. The southern population is principally comprised of the Sacramento River spawning stock.

Their wide distribution, large numbers observed seasonally in some areas, and projections based on demographic rates suggest that total Green Sturgeon numbers are at least in the tens of thousands (Beamesderfer and Webb 2002). The largest known spawning stock of Green Sturgeon is that of the Klamath River and its tributary, the Trinity River. The Klamath River population is estimated to number up to 66,000 individuals of which 3,000 would be mature adults. Actual spawner numbers in the Klamath were estimated at 760–1,500 females per year based on average harvest and total mortality rates (Beamesderfer and Webb 2002).

Based on a review of recent tagging studies, harvest analyses, and stock assessments from many locations, Beamesderfer and Webb (2002) estimated that the total adult and subadult population size of Green Sturgeon is within the range of 34,000 to 160,000 fish. Of these, greatest abundance was recorded for the Columbia River estuary, and ocean and bay waters of Oregon and Washington.

Attempts to determine trends in sturgeon abundance in the northern DPS have been inconclusive regarding the status of Green Sturgeon, and the status of the northern Green Sturgeon population is unknown (NMFS 2002, Davies 2004).

Similar attempts to determine the status of Green Sturgeon in the southern DPS were also inconclusive, and with the exception of anecdotal evidence of a reduction of Green Sturgeon entrainment at water export facilities indicative of a population decline, the status of the southern DPS is also unknown (NMFS 2002, Davies 2004).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Degree of Threat: B : Moderately threatened throughout its range, communities provide natural resources that when exploited alter the composition and structure of the community over the long-term, but are apparently recoverable

Comments: Threats include commercial and sport fisheries (including bycatch in white sturgeon fishery), modification of spawning habitats (e.g., as a result of logging, agriculture, mining, road construction, and urban development in coastal watersheds), entrainment in water project diversions, and pollution (see Moyle et al. 1995 for further details). All known spawning rivers have flow regimes affected by water projects (Moyle et al. 1995).

There is no documentation of green sturgeon spawning in the San Joaquin River at present, but there may have been spawning there before construction of large-scale hydropower and irrigation development (NMFS 2003).

Green sturgeons reportedly spawned in the South Fork Trinity River but apparently no longer do so in areas affected by extensive sedimentation from the 1964 flood (see NMFS 2003).

Spawning populations are highly vulnerable to over-fishing because individuals tend to hold and concentrate in deep, cold pools in rivers.

There are some risk factors of potential concern for the northern DPS, most notably bycatch harvest in various fisheries; however, there is uncertainty about the overall level of risk facing this DPS (NMFS 2003). In the case of harvest bycatch for which there is the most information, it is not possible to directly assess the impact of harvest on green sturgeon in this DPS. Nevertheless, the available data shows that overall green sturgeon harvest has declined substantially since the mid-1980s due to increasingly restrictive harvest management measures, suggesting that risk from harvest has been also reduced. Although the risk to green sturgeon from harvest bycatch may be declining, NMFS (2003) believed that it may be prudent for fisheries managers to continue recent conservative management measures as well as consider additional harvest protections until population monitoring information can be obtained to assess the status of this DPS with greater certainty. Based on a review of the best available information, NMFS (2003) concluded that the northern green sturgeon DPS is not presently in danger of extinction nor is it likely to become so in the foreseeable future.

There is a great deal of uncertainty regarding the effects of potential risk factors on green sturgeon in the southern DPS (NMFS 2003). While there is some information on harvest bycatch impacts, it appears most of the identified risk factors are not well documented or are only suspected to be risk factors. Examples of the latter include entrainment at the Delta water export facilities, impacts from exotic species introductions, impacts from contaminants, and lethal water temperatures. In the case of harvest bycatch for which there is the most information and perhaps the greatest concern, it is not possible to directly assess the impact of harvest on green sturgeon in this DPS. Nevertheless, direct harvest appears to be limited in California and harvest from fisheries in Oregon and Washington has declined substantially since the mid-1980s and even more so since the mid-1990s due to increasingly restrictive harvest management measures. These harvest reductions and associated restrictive management measures suggest that risk to green sturgeon from harvest bycatch has been reduced. Although the risk to green sturgeon from bycatch harvest may be declining, NMFS (2003) believed that it may be prudent to consider additional harvest protections until population monitoring information can be obtained to assess the status of this DPS with greater certainty. Based on a review of the best available information, NMFS (2003) concluded that the southern green sturgeon DPS is not presently in danger of extinction nor is it likely to become so in the foreseeable future.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Major Threats
Sturgeon exhibit a combination of morphology, life history and habitat requirements that make them highly susceptible to negative impacts from human activities (Boreman 1997). Anthropogenic activities known to impact sturgeon include: exploitation blockage of available freshwater spawning habitat through diking, damming causing inadequate flow regimes, channelization, elimination of backwater areas, dewatering of streams, destruction of thermal refugia, loss of deep pools, inundation of habitat by reservoirs, and exposure to bioaccumulating industrial and municipal pollution, (Boreman 1997, EPIC 2001, Adams et al. 2002).

The long life span and late age of maturity makes sturgeon vulnerable to chronic and acute effects of bioaccumulation. White Sturgeon, for example have been found to have the greatest contaminant concentrations compared to salmonids, suckers, Walleye (Sander vitreus), Pacific Lamprey (Lampetra tridentata), and Eulachon (Thaleichthys pacificus), [USEPA 1999]. Whole body concentrations of hexachlorobenzene (19 ųg/kg), DDT (787 ųg/kg), p,p’DDE (620 ųg/kg), Aroclors (173 ųg/kg), and dioxins were an order of magnitude higher in concentration than all other species tested. Although Green Sturgeon are less exposed to anthropogenic contaminants due to their marine migratory phase, there is the potential for exposure when entering freshwater to spawn and during estuarine concentrations.

Marine and estuarine environments in Canada are of concern as they are heavily impacted by a number of activities including logging, aquaculture, agriculture and urbanization, and can be the eventual sinks to freshwater pollutants. However, a 1994 assessment of the quality of the lower Fraser River ecosystem indicated that no dramatic changes in species assemblages were determined to have occurred since the previous study in 1974 (Healey et al. 1994) despite an increase in usage. Area managed for conservation also increased from 23 to 69% over the same time period with 80% of the increase being accounted for by conservation efforts on the Fraser River estuary (MWLAP 2002). The increase in estuary protection and the results from Healey et al. (1994) suggests that estuarine habitat loss that may effect Green Sturgeon is likely not substantial in Canada.

In the US, where all known spawning populations occur, Green Sturgeon have lost spawning habitat to poor land use practices and habitat alteration through water management projects (EPIC 2001). This has caused a decline in general water quality in some areas through increased sedimentation as well as the loss of deep pools which Green Sturgeon are known to prefer. Furthermore, damming of river systems can block previously available spawning habitat, affect natural flow regimes, potentially reduce areas of thermal refugia, and change sediment transport characteristics of the river which may cascade and impact sturgeon by modifying ecosystem community structure (EPIC 2001). For example, Green Sturgeon were historically observed hundreds of kilometers upstream in the Sacramento and Columbia rivers, but are currently restricted in the Columbia River to the lower 60 km downstream of the Bonneville Dam (Moyle 2002).

Beamesderfer and Webb (2002 suggest that habitat conditions throughout the Green Sturgeon range have stabilized or are improving, but the results of spawning surveys have yet to substantiate that (NMFS 2002). Most of the northern population segment spawns in the Klamath River. Potential threats to this population include concentration of spawning, harvest (especially in mixed-stock estuarine fisheries), and loss of spawning habitat such as the Columbia River, and the Eel and South Fork, and Trinity Rrivers in California (Adams et al. 2002).

The southern population segment (south of the Eel River) is more of a concern because it has fewer spawners (limited to the Sacramento-San Joaquin system), which makes it more susceptible to catastrophic events. These fish also face potentially lethal temperature limits, entrainment by water projects, and may be adversely affected by pesticides and other toxic substances and exotic species (Adams et al. 2002). It is probable that Green Sturgeon spawning habitat has been lost behind dams and water diversions throughout the Central Valley (e.g., Red Bluff Diversion Dam and Glenn-Colusa Irrigation District pumping plant).

Utilisation
Green Sturgeon harvest is all bycatch in Green Sturgeon harvest is all bycatch in two three fisheries. The smaller bycatch occurs in Klamath River Tribal salmon gill net fisheries while the larger portion is in the White Sturgeon commercial and sport fisheries (Adams et al. 2002). Total annual harvest of Green Sturgeon declined substantially to 1,192 fish in 1999–2001 from 6,871 fish in 1985–1989. Most of this earlier harvest came from the Columbia River (51%) and Washington coastal fisheries (28%). In recent years, Columbia and Washington coastal harvest was substantially reduced and in 2001 these two bycatch fisheries and that of the Klamath River tribes were about equal in number. Catch reduction in the Columbia River is a result of increasingly restrictive regulations. For the sturgeon sport fishery, slot limits prohibit retention of fish (white or green) less than 107 cm (42 inches) or more than 152 cm (60 inches). Green Sturgeon retained as bycatch in the commercial fishery must be between 122 and 168 cm (48-66 inches).

Klamath Tribal fisheries (Yurok and Hoopa) accounted for an average 266 adult fish annually from 1986–2001 with no apparent trend. This fishery is monitored but not regulated. California sport catch of Green Sturgeon, primarily in San Pablo Bay, is not monitored, but is thought to be only a few fish each year (Adams et al. 2002). California slot size limits for both sturgeon species is 117–183 cm (46–72 inches).

There is also a bycatch in the domestic trawl fishing industry in B.C., which takes about 171 Green Sturgeon annually (Davis 2004).

There is no information on the extent of illegal exploitation of Green Sturgeon, but poaching activity on White Sturgeon in the lower Fraser River is a concern (Ptolemy and Vennesland 2003).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Near Threatened (NT)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Management Requirements: See recovery plan for Sacramento-San Joaquin Delta native fishes (USFWS 1995).

Biological Research Needs: Current research needs include: 1. Detailed studies on life history and ecological requirements. 2. Population assessment and monitoring.

It is essential that immediate efforts be undertaken to implement direct monitoring of green sturgeon in both the northern and southern DPSs (NMFS 2003).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Protection: Unknown whether any occurrences are appropriately protected and managed

Comments: Fisheries along Pacific coast are managed by each state (e.g., California, Oregon, and Washington).

Needs: 1. Fisheries that target green sturgeon should be limited until more is learned about the biology and abundance of the species. 2. Implement regulations to reduce the catch of large reproductive females. See recovery plan for Sacramento-San Joaquin Delta native fishes (USFWS 1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation Actions

Conservation Actions
Fishery managers in California, Oregon, Washington and British Columbia have recognized the sensitivity of Green Sturgeon to fishing and have actively restricted commercial and sport fisheries everywhere Green Sturgeon occur. None of the reviews examined mentioned any legal, regional, national or international trade in Green Sturgeon products. This species is not considered as good to eat as White Sturgeon and markets for their flesh are limited.

Due to life history characteristics that make it particularly sensitive to human activities or natural events Green Sturgeon has a designation of "Special Concern" in Canada (Houston 1988, Davies 2004), and no harvest is allowed in Canadian waters.

In response to a petition to list Green Sturgeon under the U.S. Endangered Species Act, the National Marine Fisheries Service (NMFS) completed a status review for this species (Adams et al. 2002). NMFS determined that the species is comprised of two distinct population segments (DPS) but that neither warrants listing as a threatened or endangered species at this time (NMFS 2003). However, because of remaining uncertainties about their population structure and status, both DPS populations were added to the agency's list of candidate species and will be reevaluated in five years provided sufficient new information becomes available.

It is listed on CITES Appendix II.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; gamefish: yes; price category: unknown; price reliability:
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Green sturgeon


Investigation of potential copyright issue

Do not restore or edit the blanked content on this page until the issue is resolved by an administrator, copyright clerk or OTRS agent.

If you have just labeled this page as a potential copyright issue, please follow the instructions for filing at the bottom of the box.

The previous content of this page or section has been identified as posing a potential copyright issue, as a copy or modification of the text from the source(s) below, and is now listed on Wikipedia:Copyright problems (listing):

http://www.usbr.gov/mp/cvo/OCAP/docs/OCAP_BA_008.pdf (Duplication Detector report)
 

Unless the copyright status of the text on this page is clarified, the problematic text or the entire page may be deleted one week after the time of its listing.
Temporarily, the original posting is still accessible for viewing in the page history.

Can you help resolve this issue?
About importing text to Wikipedia
  • Posting copyrighted material without the express permission of the copyright holder is unlawful and against Wikipedia policy.
  • If you have express permission, this must be verified either by explicit release at the source or by e-mail or letter to the Wikimedia Foundation. See Wikipedia:Declaration of consent for all enquiries.
  • Policy requires that we block those who repeatedly post copyrighted material without express permission.
Instructions for filing

If you have tagged the article for investigation, please complete the following steps:

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Based on genetic data, NMFS (2003) identified two distinct population segments (DPSs). The geographic range of the northern DPS occurs largely within the Coastal Range ecoregion which extends from the Olympic Peninsula southward through the Coast Range and Klamath Mountains to and including the Eel River. The southern DPS occurs south of the Eel River, largely within the Central California Valley ecoregion which includes the Sacramento and San Joaquin rivers. NMFS stated that further research may revise these ranges and that additional DPSs could be recognized in the future.

ACIPENSER MIKADOI of eastern Asia formerly was included in this species. Chromosomal and molecular data support the recognition of A. MEDIROSTRIS and A. MIKADOI as distinct species (Birstein 1993, Birstein et al. 1993, Birstein and Bemis 1997, Birstein and DeSalle 1998).

Gene sequencing data of Birstein and DeSalle (1998) indicate that there are least three main clades within ACIPENSER: A. STURIO-A. OXYRINCHUS, A. SCHRENCKII-A. TRANSMONTANUS, and all Ponto-Caspian species plus A. DABRYSNUS and A. BREVIROSTRUM.

Krieger et al. (2000) examined phylogenetic relationships of North American sturgeons based on mtDNA sequences and found that (1) nucleotide sequences for all four examined genes for the three SCAPHIRHYNCHUS species were identical; (2) the two ACIPENSER OXYRINCHUS subspecies were very similar in sequence; (3) A. TRANSMONTANUS and A. MEDIROSTRIS were sister taxa, as were A. FULVESCENS and A. BREVIROSTRUM (in constrast to Birstein and DeSalle 1998).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!