Overview

Comprehensive Description

Biology

Inhabits bottom of lakes and large rivers (Ref. 10294), usually in 5-9 m depth, over mud, sand, and gravel. Occasionally enters brackish water. A specimen caught in 1952 was reputed to have been 152 years old (Ref. 6866). Search for food, with the aid of the sensory ability of the barbels, by constantly moving close to the substrate. Omnivorous, virtually anything edible that enters the mouth is sucked up and consumed. The food is worked or pulled in the mouth, often partly ejected and sucked in again (Ref. 1998). Spawning sites are rocky and boulder filled areas along the outside bend of rivers (Ref. 41542). Smoked and in 1951, Canada, 2,000 lbs. of caviar were made from the eggs (Ref. 37032). Threatened due to over harvesting, habitat loss and pollution (Ref. 58490).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

Lake sturgeons are found in the freshwaters of North America from the Hudson Bay through the Mississippi River drainages to Alabama. They are found in the Great Lakes and the St. Lawrence River drainage and in large lakes in New York and Vermont, including Cayuga Lake and Lake Champlain.

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Gulf of St. Lawrence
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North America: St. Lawrence-Great Lakes, Hudson Bay, and Mississippi River basins. International trade restricted (CITES II, since 1.7.75; CMS Appendix II).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Lake sturgeon spend their entire life cycle in freshwater and are widely distributed in North America. They currently range throughout much of the drainages of the Mississippi River, the Great Lakes, Lake Champlain, the St. Lawrence River, Hudson Bay-James Bay, and the Saskatchewan River (Pflieger 1975, Becker 1983, Ferguson and Duckworth 1997). In the Mississippi basin this species occurs from the headwaters in Minnesota to the northern portion of the state of Louisiana and up the Missouri River into southern South Dakota. There is no known natural exchange of stocks between the Great Lakes and western Canadian provinces and those of the Mississippi River basin, though some stockings in the Mississippi have included lake sturgeon of Great Lakes Basin origin.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Lake sturgeon spend their entire life cycle in freshwater and are widely distributed in North America. They currently range throughout much of the drainages of the Mississippi River, the Great Lakes, Lake Champlain, the St. Lawrence River, Hudson Bay-James Bay, and the Saskatchewan River (Pflieger 1975, Becker 1983, Ferguson and Duckworth 1997). In the Mississippi basin this species occurs from the headwaters in Minnesota to the northern portion of the state of Louisiana and up the Missouri River into southern South Dakota. There is no known natural exchange of stocks between the Great Lakes and western Canadian provinces and those of the Mississippi River basin, though some stockings in the Mississippi have included lake sturgeon of Great Lakes Basin origin.

For a more detailed description of this species’ range, see NatureServe’s Explorer database.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Acipenser fulvescens occurs in the freshwaters of North America from the Hudson Bay through the Mississippi River drainages to Alabama. It is found along the Great Lakes - St. Lawrence River drainage and in large lakes in New York and Vermont, including Cayuga Lake and Lake Champlain.

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (200,000 to >2,500,000 square km (about 80,000 to >1,000,000 square miles)) Large range in North America includes the St. Lawrence-Great Lakes basin from Quebec to Minnesota, Wisconsin, and Illinois; Lake Champlain (Vermont and New York); Hudson Bay, James Bay, and Saskatchewan River basins from Quebec to Alberta; and Mississippi River basin from Minnesota and Wisconsin southward to northern Alabama and rarely Arkansas and northern Louisiana, including the Missouri River upstream rarely or formerly as far as southern South Dakota, the Ohio River basin upstream (formerly) to West Virginia, and the Tennessee River as far upstream (at least formerly) to northern Alabama and eastern Tennessee (Lee et al. 1980, Baker 1980, Becker 1983, Smith 1985, Houston 1987, Brousseau 1987, Robison and Buchanan 1988, Page and Burr 1991, Etnier and Starnes 1993, Mettee et al. 1996, Ferguson and Duckworth 1997, Pflieger 1997, Boschung and Mayden 2004). Lake sturgeon also has been found in the Coosa River system, Mobile Bay drainage, Alabama and adjacent northwestern Georgia (Boschung and Mayden 2004). Lake sturgeon is relatively common in the northern portion of its range in Canada but is approaching extinction or is extirpated in the southern part of the range in the Missouri, Ohio, and middle Mississippi river drainages (Page and Burr 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North America.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

This fish has a skeleton partly of bone and partly of cartilage. Their slender bodies are covered with rows of bony plates. Beneath the projecting snout there is a small, toothless mouth with thick, sucking lips. There are four barbels (whiskers) in front of the mouth that are used to direct food towards the mouth. Like the body, the head is well protected with plates. A single dorsal fin rises from the back, and the body extends into the long upper part of the tail fin. (World Book Encyclopedia 1998)

The physical characteristics of Acipenser_fulvescens vary greatly with age and size. In the young, the body shields are rough and ornamented with hooked spines. As they become adults, the shields grow smoother. Many of them eventually disappear with age. The snout also grows less pointed with age, and the spots of the younger fishes' color pattern disappear. It is common for the lake sturgeon to reach a length of about 1.8 meters and have a mass, on average, of 90 kilograms. (Encyclopedia Americana 1996)

Average mass: 90 kg.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Average mass: 70000 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

This fish has a skeleton partly of bone and partly of cartilage. Their slender bodies are covered with rows of bony plates. Beneath the projecting snout there is a small, toothless mouth with thick, sucking lips. There are four barbels (whiskers) in front of the mouth that are used to direct food towards the mouth. Like the body, the head is well protected with plates. A single dorsal fin rises from the back, and the body extends into the long upper part of the tail fin. (World Book Encyclopedia 1998)

The physical characteristics of Acipenser fulvescens vary greatly with age and size. In the young, the body shields are rough and ornamented with hooked spines. As they become adults, the shields grow smoother. Many of them eventually disappear with age. The snout also grows less pointed with age, and the spots of the younger fishes' color pattern disappear. It is common for the lake sturgeon to reach a length of about 1.8 meters and have a mass, on average, of 90 kilograms. (Encyclopedia Americana 1996)

Average mass: 90 kg.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Average mass: 70000 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 2740 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

274 cm TL (male/unsexed; (Ref. 5723)); max. published weight: 125.0 kg (Ref. 3672); max. reported age: 152 years (Ref. 72475)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Length: 140 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Single row of preanal shields. Soft area on the top of the head absent and black viscera. Large blotches present on anterior half of upper surface of snout and on back. Lower surface whitish (Ref. 37032).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Differs from the shovelnose sturgeon (SCAPHIRHYNCUS PLATORHYNCUS) in having spiracles and in lacking a completely scute-covered caudal peduncle and a long filament on the upper lobe of the caudal fin in the young (Cook et al. 1987).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

The lake sturgeon is a fish of temperate waters and is found only in the Northern Hemisphere in North America. Their habitat is usually on the bottom of a riverbed or lake. Acipenser_fulvescens prefer a river or lake bottom that has clear sand or gravel. (Herald 1971)

Aquatic Biomes: lakes and ponds; rivers and streams

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

demersal; potamodromous (Ref. 51243); freshwater; brackish
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Pectoral fin ray sections have been used to determine that lake sturgeon can live to be over 100 years old - though most are less than 35 years old. Lake sturgeon typically grow to almost two metres in length and about 90 kg, with rare records from the Great Lakes of fish up to 141 kg (Priegel and Wirth 1971). Compared to sturgeon from Lake Winnebago (Wisconsin) and the Great Lakes, relatively little information is available regarding age, growth, maturity and spawning periodicity of lake sturgeon in the Mississippi River basin.

Based on information from northern populations, lake sturgeon spawning occurs when water temperatures rise and reach 9–15°C (Priegel and Wirth 1971, Kempinger 1988). Spawning sturgeon will select shallow areas with relatively strong current velocities (Kempinger 1988).

Usual lake sturgeon habitat is the highly productive shoal areas of larger lakes, reservoirs and rivers. Lake sturgeon in the Upper Mississippi River prefer habitat in or adjacent to flow, but with relatively low to moderate current velocity (B.C. Knights, USGS, unpublished data). They are rarely found in backwater habitats without flow. In the Mississippi basin habitat that is in or adjacent to current is generally depositional and has relatively compact silt or silt-sand substrates with presumed high densities of benthic invertebrates. These areas occur at the lower end of navigation pools near the main channel, the mouths of tributaries and large secondary channels, and at some channel border areas. While migrating, presumably en-route to spawning habitats or high use (feeding/home) areas, lake sturgeon will use areas of the river with relatively high current velocities including tailwaters, the main channel in the upper and mid reaches of navigation pools, and tributaries.

Lake sturgeon are known to move great distances to spawning and feeding habitats (Auer 1996). In a recent study, nearly half of lake sturgeon radio-tagged in Pool 10 of the Mississippi River near Prairie du Chien, Wisconsin moved up the Wisconsin River about 140 km to the Prairie du Sac dam (Knights, B.C., USGS, unpublished data). Fish tagged in Pool 5A near Winona, Minnesota moved as far downstream as Pool 10 near Clayton, Iowa (about 170 km). Fifty-four occurrences of passage through navigation dams were observed and 46% of tagged sturgeon moved through at least one dam during the 18–month study. One lake sturgeon tagged in the Wisconsin River at Prairie du Sac, Wisconsin, traveled 415 km and moved through seven dams between September 28, 1999 and March 28, 2001, when it was recaptured by an angler at Lock and Dam 3 of the Mississippi River (A. Runstrom, USFWS, unpublished data). Lake sturgeon stocked by the Missouri Department of Conservation into Pool 24 of the Mississippi River and at several locations on the Missouri River have been reported as far upstream as the Lock and Dam 19 tailwater, as far downstream as Chester, IL, and as far up the Missouri River as the Gavins Point Dam tailwater (K. Brummett, MODOC, unpublished data).

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Based on pectoral fin ray sections it has been determined that lake sturgeon can live to be over 100 years old. One individual caught in Lake of the Woods, Ontario in 1953 was estimated to be 152 years old (Priegel and Wirth 1971). Lake sturgeon can reach lengths of 1.9 m, and weigh 91 kg. However, a 141 kg lake sturgeon was reportedly caught in Lake Superior in 1922 and a fish of equal weight was caught in Lake Michigan in 1943. Most fish reported in the literature were less than 35 years old.

Lake sturgeon from Black Lake in Michigan measured 75–193 cm total length (TL) and were 9–64 years old, with most fish less than 20 years old (Baker and Borgeson 1999). In the Lake Winnebago system of Wisconsin, female lake sturgeon reach sexual maturity between 24–26 years of age when they are about 140 cm long. Females spawn only every 3–6 years and can produce up to 700,000 eggs each time. Few male lake sturgeon mature before they are 114 cm long or 14–16 years old. Males spawn every one or two years (Priegel and Wirth 1971, Lyons and Kempinger 1992). In the Sturgeon River of Upper Michigan, male spawning intervals of two, three and four years were observed while females returned to spawn every three to seven years (Auer 1999). In Canadian rivers and lakes, mature male lake sturgeon range in size from 76–98 cm and females 84–117 cm (Houston 1987). Compared to sturgeon from Lake Winnebago and the Great Lakes, relatively little information is available regarding age, growth, maturity and spawning periodicity of lake sturgeon in the Mississippi River basin.

During the spring season, lake sturgeon spawning occurs when water temperatures rise and reach 9–15 °C (Priegel and Wirth 1971, Kempinger 1988). Spawning sturgeon will select shallow areas over hard clean substrate with relatively strong current velocities (Kempinger 1988).

Usual lake sturgeon habitat is the highly productive shoal areas of larger lakes and rivers. They require moderate to swift currents and large rough substrates for spawning and embryo development. Lake sturgeon in the Upper Mississippi River prefer habitat in or adjacent to flow, but with relatively low to moderate current velocity (Knights, B. C., USGS, unpublished data). They are rarely found in backwater habitats without flow. In the Mississippi basin habitat that is in or adjacent to current is generally depositional and has relatively compact silt or silt-sand substrates with presumed high densities of benthic invertebrates. These areas occur at the lower end of navigation pools near the main channel, the mouths of tributaries and large secondary channels, and at some channel border areas. While migrating, presumably en-route to spawning habitats or high use (feeding/home) areas, lake sturgeon will use areas of the river with relatively high current velocities including tailwaters, the main channel in the upper and mid reaches of navigation pools, and tributaries.

Lake sturgeon are known to move great distances to spawning and feeding habitats (Auer 1996). Wisconsin DNR recently reported that a sturgeon originally tagged in Lake Winnebago in October 1978 was recovered almost 19 years later at Locust Point Reef in Lake Erie, a minimum travel distance of almost 1,100 km (R. Bruch, WI DNR, news release).

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The lake sturgeon is a fish of temperate waters and is found only in the Northern Hemisphere in North America. Their habitat is usually on the bottom of a riverbed or lake. Acipenser fulvescens prefer a river or lake bottom that has clear sand or gravel. (Herald 1971)

Aquatic Biomes: lakes and ponds; rivers and streams

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 3 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 1.25 - 35

Graphical representation

Depth range (m): 1.25 - 35
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Freshwater

Comments: Primary habitat is the bottoms of large, clean, freshwater rivers and lakes (Hocutt and Wiley 1986, Becker 1983), although the species rarely occurs in the brackish water of the lower St. Lawrence River and the Moose River near James Bay (Scott and Crossman 1973). Preferred substrates include firm sand, gravel, or rock (Pflieger 1975). In the Great Lakes, A. fulvescens lives primarily in shoal water. Lakes sturgeons are found most often at depths of 5-10 meters (COSEWIC 2006), but larger fish occasionallyhave been taken at depths of up to 43 meters (Harkness and Dymond 1961, Scott and Crossman 1973). In rivers, preferred habitat is deep mid-river areas and pools, where water depths vary between four and nine meters and food is abundant (Harkness and Dymond 1961, Priegel and Wirth 1977). In the Mississippi and Missouri rivers in Missouri (Pflieger 1997), habitat is characterized by river channels developed in deep deposits of gravel, sand, and silt, possessing numerous islands, side channels, and backwaters (Pflieger 1989); a continuous strong flow coupled with one or two periods of sustained flooding is also indicative of this habitat; gradients are generally less than 1 foot per mile.

In rivers, spawning occurs in water generally 0.3-4.7 meters deep, typically in areas of swift currents, rapids, or waterfalls that prevent upstream migration (Scott and Crossman 1973, Priegel and Wirth 1971, Harkness and Dymond 1961). Spawning sites in the Wolf River of Wisconsin typically occur on the outside bends of river banks, particularly where upwelling currents and substrates of boulders, rocks, or slabs of concrete have been riprapped at a steep angle (Priegel and Wirth 1971). Spawning substrate varies from hard-pan clay to gravel to boulders, including riprap that has been placed along river edges (LaHaye et al. 1992, COSEWIC 2006). In rivers, larvae drift downstream. In lakes, spawning occurs over rocky ledges or shoals where wave action produces sufficient oxygen levels for the eggs. No nest is constructed; eggs and milt are scattered over the bottom where fertilized eggs adhere to rocks.

Young sturgeons travel in large schools over gravel areas and sand bars during the fall months of their first year. After the first year, the young inhabit the same areas as older fish, as described above (Becker 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Potamodromous. Migrating within streams, migratory in rivers, e.g. Saliminus, Moxostoma, Labeo. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Few studies have been successful in defining lake sturgeon movements (Sandilands 1987). Sturgeons generally are believed to travel widely, in loose aggregations, within their "home range," leaving it only to spawn in the spring, then returning (Sandilands 1987, Dumont et al. 1987, Becker 1983, Priegel and Wirth 1971). Within a given "home range", Scott and Crossman (1973) believed that lake sturgeon moved from shallow to deeper waters in the summer, to shallow waters in the fall, and back to deeper waters in the winter.

Migrations between spawning and nonspawning habitats frequently are as long as 125 km and may be as far as 400 km (Sandilands 1987).

In the upper Mississippi River system, individuals had ranges of 3-198 km (median 56 km); certain river reaches were unique to groups or substocks of fish (Knights et al. 2002).

In the Kettle River, Minnesota, a small population remained year-round in a 20-mile section of river and appeared to mix very little with nearby populations, despite the absence of physical barriers at either end of the occupied reach (Borkholder et al. 2001).

See Fortin et al. (1993) for information on movements in the St. Lawrence and Ottawa river systems.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

The name sturgeon in several European languages means "the stirrer", from the way the fish rummages among the mud for food. It finds its food largely by touch, using its sensitive barbels. As the lake sturgeon cruises over the bottom, the sensitivity of the fleshy whiskers trailing in the sand makes up, to some extent, for the fish's poor eye sight. As soon as the whiskers pass over food, the protrusible mouth drops down with an elevator-like motion and rapidly sucks in its meal. (Herald 1971) Acipenser_fulvescens are one of the few fishes to have taste buds on the outside of their mouth. In other fish, they are normally found on the tongue or inside the mouth. The taste buds of the lake sturgeon protrude from the toothless mouth and are used to help in the selection of food.

These fish are slow feeders and can survive several weeks without eating. Moreover, the food it eats is small compared to its own size. The lake sturgeon, in its normal habitat, must devote a great deal of time to feeding. Acipenser_fulvescens eat insect larvae, worms, crayfish, snails, and other small fishes. (Rodgers 1990)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Inhabits bottom of lakes and large rivers (Ref. 10294), usually in 5-9 m depth, over mud, sand, and gravel. Occasionally enters brackish water. A specimen caught in 1952 was reputed to have been 152 years old (Ref. 6866). Search for food, with the aid of the sensory ability of the barbels, by constantly moving close to the substrate (Ref. 1998). Feeds on benthic organisms such as crayfishes, mollusks, and insect larvae, especially midges. Adult migrate up rivers to spawn (Ref. 10294).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

The name sturgeon in several European languages means "the stirrer", from the way the fish rummages among the mud for food. It finds its food largely by touch, using its sensitive barbels. As the lake sturgeon cruises over the bottom, the sensitivity of the fleshy whiskers trailing in the sand makes up, to some extent, for the fish's poor eye sight. As soon as the whiskers pass over food, the protrusible mouth drops down with an elevator-like motion and rapidly sucks in its meal. (Herald 1971) Acipenser fulvescens are one of the few fishes to have taste buds on the outside of their mouth. In other fish, they are normally found on the tongue or inside the mouth. The taste buds of the lake sturgeon protrude from the toothless mouth and are used to help in the selection of food.

These fish are slow feeders and can survive several weeks without eating. Moreover, the food it eats is small compared to its own size. The lake sturgeon, in its normal habitat, must devote a great deal of time to feeding. Acipenser fulvescens eat insect larvae, worms, crayfish, snails, and other small fishes. (Rodgers 1990)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Feeds mainly on small invertebrates obtained from the bottom. At a very small size (19 mm in length), the young start feeding on minute crustaceans and continue on that diet until they are 178-203 mm in length (Eddy and Underhill 1974). As a whole, lake sturgeon feed largely on leeches, snails, small clams, and other small invertebrates, including insects (Houston 1987). Analysis of stomach contents from fish in Lake Winnebago, Wisconsin, showed an almost pure preference for Chironomus plumosus. One individual, however, possessed leeches, Psidium clams, and small snails, along with the chironomids. Individuals from the Chippewa River, Wisconsin, fed largely on snails. Small fishes such as sticklebacks and sculpins have also been found in stomach contents and may represent an important food source in some areas (Harkness 1923). Individuals found near grain elevators have been known to consume spilled grain, while algae has also been found in lake sturgeon stomachs (Scott and Crossman 1973). Sandilands (1987) reported that the diet in the Kenogami River of Ontario was similar to that stated for other river systems, except for the preponderance of crayfish. Magnin and Harper (1970) listed caddisflies, mayflies, diptera, stoneflies, and dragonflies as the predominant food items in the Waswancipi River, Quebec. For a detailed summary of food and feeding habits, refer to Harkness (1923) and Harkness and Dymond (1961).

Adults apparently require extensive areas of water less than 30 feet (914 cm) in depth (Becker 1983). Feeding is accomplished by probing the sediments with the ends of sensitive barbels dragging lightly over the bottom (Priegel and Wirth 1971). Upon contacting food, the tubular mouth is protruded and the food is sucked in along with sediments. The sediments are screened out through the gills, with the food retained within the crop. Feeding habits apparently differ with respect to food availability.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 - 300

Comments: Historically this species was very widespread and represented by many occurrences (subpopulations) (Auer 1994). Now there are fewer subpopulations, and they are much more geographically restricted (Auer 1994). Assuming that each major occupied river or lake that is not interrupted by a barrier represents a single subpopulation, the number of extant subpopulations exceeds 100.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Comments: Total adult population size is unknown but is much greater than 10,000 and may exceed 100,000. Some northern populations include relatively large numbers of individuals (Becker 1983, COSEWIC 2006, Environment Canada and U.S. EPA 2007),) whereas the species is now very rare in the southern portion of the historical range, particularly in the Mississippi River basin (Smith 1979, Cooper 1983, Robison and Buchanan 1988, Etnier and Starnes 1993, Boschung and Mayden 2004).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Lampreys (Petromyzon marinus and Ichthyomyzon unicuspis) infrequently attach themselves to lake sturgeons and may seriously weaken or kill them (Scott and Crossman 1973). Scutes generally protect the young from lamprey parasitism, whereas larger individuals are generally too large to be affected (Houston 1987).

Apparently, few other parasites have been recorded on lake sturgeon (Hoffman 1967). Known parasites include: Monongenea (3 species), Trematoda (8 species), Nematoda (3 species), Acanthocephala (1 species), Hirudinoidea (1 species) and Brachiura (1 species) (Margolis and Arthur 1979). Hoffman et al. (1974) found a coelenterate (Polypodium SP.) in the ovaries of sturgeon taken from Black Lake in Michigan. Baker (1980) recorded Cucullanus CHITELLARIUS from the hind gut and SPINITECTUS GRACILIS from the esophagus of sturgeon found in the Saginaw River in Michigan.

Apparently, the lake sturgeon does not compete with other bottom feeding fishes (Coregonus clupeaformis, CATASTOMUS COMMERSONI and Catostomus) for food, since they feed in different habitats (Scott and Crossman 1973). According to Sandilands (1987), the shorthead redhorse (Moxostoma SPP.) is the only fish species that may actively compete with lake sturgeon for available food supplies in the Kenogami River of Ontario.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: Feeding activity occurs throughout the year, including winter (Priegel and Wirth 1971), but apparently ceases during spawning (Houston 1987).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Spawning sites are rocky and boulder filled areas along the outside bend of rivers (Ref. 41542).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: wild:
82.0 years.

Average lifespan

Status: wild:
152.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan/Longevity

Average lifespan

Status: wild:
82.0 years.

Average lifespan

Status: wild:
152.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 152 years (wild) Observations: One of the longest-lived animals in the world, though some results suggest they exhibit reproductive senescence. In the wild, females may live 80 years and males 55 years (http://www.dec.state.ny.us/). Record longevity, however, belongs to a wild-caught specimen estimated to be 152 years (http://www.demogr.mpg.de/longevityrecords).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

In early summer, lake sturgeons migrate toward the shores of freshwater lakes for spawning purposes. They seek out pebbly habitats with no mud to breed. (Evans 1994) Spawning usually takes place at a depth of 5.4 to 6.0 meters. The females lay a vast number of eggs, anywhere from 2 to 3 million in one season, depending on their size and age. After spawning, the eggs are left to develop on their own. The parents will then return to the lake or river where they spend most of their time. (Rodgers 1990)

The eggs, or roe, are small and sticky. They are encased in a jelly-like substance and use the stickiness to adhere to water plants and stones, or clump together in masses. This allows them to remain stationary and stay in one location despite the current. The eggs are one-fourth of a centimeter in diameter and blackish in color. They will normally hatch in three to seven days. The larvae are 1.25 centimeters long and by the first summer may grow to a length of 20 centimeters. The young grow rapidly until maturity, after which growth continues slowly for several years. (Rodgers 1990)

Although the Russian sturgeon (Acipenser huso) may reach a length of 30 centimeters in one year, the lake sturgeon requires twenty years to attain a length of a little over a meter. Acipenser_fulvescens become sexually mature when they are around the age of twenty and at a length of a little over a meter. (Herald 1971)

Average time to hatching: 6 days.

Average number of offspring: 350000.

Average age at sexual or reproductive maturity (male)

Sex: male:
2920 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
9490 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

In early summer, lake sturgeons migrate toward the shores of freshwater lakes for spawning purposes. They seek out pebbly habitats with no mud to breed. (Evans 1994) Spawning usually takes place at a depth of 5.4 to 6.0 meters. The females lay a vast number of eggs, anywhere from 2 to 3 million in one season, depending on their size and age. After spawning, the eggs are left to develop on their own. The parents will then return to the lake or river where they spend most of their time. (Rodgers 1990)

The eggs, or roe, are small and sticky. They are encased in a jelly-like substance and use the stickiness to adhere to water plants and stones, or clump together in masses. This allows them to remain stationary and stay in one location despite the current. The eggs are one-fourth of a centimeter in diameter and blackish in color. They will normally hatch in three to seven days. The larvae are 1.25 centimeters long and by the first summer may grow to a length of 20 centimeters. The young grow rapidly until maturity, after which growth continues slowly for several years. (Rodgers 1990)

Although the Russian sturgeon (Acipenser huso) may reach a length of 30 centimeters in one year, the lake sturgeon requires twenty years to attain a length of a little over a meter. Acipenser fulvescens become sexually mature when they are around the age of twenty and at a length of a little over a meter. (Herald 1971)

Average time to hatching: 6 days.

Average number of offspring: 350000.

Average age at sexual or reproductive maturity (male)

Sex: male:
2920 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
9490 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Spawning occurs in spring or early summer (mid- to late May, at water temperatures of about 11-22 C, near Montreal, Quebec) (LaHaye et al. 1992). Spawning takes place during late April and early May in central Wisconsin (Becker 1983). In northern Wisconsin, however, the spawning run takes place later in the year, from May to early June (Eddy and Underhill 1974). Spawning dates are apparently dependent on water temperatures and can vary widely between given years. Baker (1980) observed sturgeon on spawning runs in Michigan during May and June, when water temperatures varied between 52 and 53 F. Rusak and Mosindy (1997) found that lake-wintering and river-wintering populations of the Lake of the Woods and Rainy River system appeared to spawn and initiate extensive spring and summer movements at different times.

Males usually arrive at the spawning sites before the females, and cruise the area in schools of a dozen or more individuals (Priegel and Wirth 1971). Spawning is initiated as soon as a ripe female enters a school of males. Several males attend a single female, swimming alongside her in the same direction, usually against the current (Priegel and Wirth 1971). Spawning lasts about 5 seconds, whereupon the group drifts downstream or into deeper water, then returns. The spawning activity for one female usually lasts from 5 to 8 hours, but may extend to over one day in length (Priegel and Wirth 1971).

Males release milt at the time that the eggs are extruded, fertilizing the eggs. The glutinous eggs are black and about 3 mm in diameter. Egg production by females varies considerably; anywhere from 50,000 to 700,000 are released by a single female (Priegel and Wirth 1971). Eggs receive no parental care (Baker 1980). Eggs are preyed upon by suckers, carp, catfish, and other sturgeons (Becker 1983).

Hatching of eggs is apparently dependent on water temperature. In waters between 55 and 57 degrees F (12.8-13.9 C), hatching takes 8 days. In warmer temperatures (17 C), hatching occurs in five days (Priegel and Wirth 1971). Harkness and Dymond (1961) reported that eggs hatched in 5-8 days when water temperatures were 60-64 F. Near Montreal, Quebec, larval emigration from spawning ground began 11 days after peak spawning.

Fry are roughly 8 mm (0.3 inches) long upon hatching, but grow to 21 mm after 16 days of development (Harkness and Dymond 1961). Growth is rapid during the first 10 years of life, then slows and becomes extremely variable among different individuals (Baker 1980). Mortality among sexes varies considerably during the first 10-15 years of life. Among the largest and oldest sturgeon, there is a predominance of females (Baker 1980). Of all freshwater fishes, the lake sturgeon takes the longest to reach sexual maturity (Houston 1987). The age of first spawning varies between the two sexes, with latitude and within a population. It has been estimated that maturity in A. FULVESCENS is reached between eight and 13 years, but first spawning occurs at 8 to 19 years for males and 14 to 23 years for females (Roussow 1957). Becker (1983), however stated that female lake sturgeons reach sexual maturity when they are 24-26 years old and roughly 140 cm (55 in) in length.

Upon reaching sexual maturity, the females will spawn once every 4-6 years. Males mature when they reach a size of 114 cm (45 in) in length, then spawn every year or every other year (Becker 1983). Males and females generally grow at the same rate, but females tend to live longer (Dumont et al. 1987, Becker 1983). Individuals can live as long as 80 years or more (Scott and Crossman 1973). An individual taken in Lake of the Woods of Minnesota/Ontario in 1953 was thought to be 154 years old, weighing 94.6 kg (MacKay 1963).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Acipenser fulvescens

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTGTATTTAGTATTTGGTGCCTGAGCAGGCATGGTCCGCACAGCCCTCAGCCTTCTGATCCGTGCCGAACTGAGCCAACCCGGTGCCCTGCTTGGCGATGATCAGATCTACAATGTTATCGTTACAGCCCACGCCTTTGTCATGATTTTCTTTATAGTAATACCCATCATAATTGGCGGATTCGGAAACTGACTAGTCCCCCTAATAATTGGGGCCCCAGACATGGCATTTCCTCGCATGAACAATATAAGCTTCTGACTCCTACCCCCATCTTTCCTGCTCCTTTTAGCCTCCTCTGGGGTAGAGGCCGGAGCCGGCACAGGATGAACTGTTTACCCTCCGCTGGCGGGAAACCTGGCCCATGCGGGAGCCTCTGTAGACCTAACCATTTTCTCCCTTCACCTGGCTGGGGTTTCGTCCATTTTGGGGGCTATTAATTTTATTACTACCATTATTAACATGAAACCCCCCGCAGTATCCCAATATCAGACACCTCTGTTTGTGTGATCTGTATTAGTCACGGCCGTACTTCTCCTACTATCACTGCCAGTGCTAGCTGCAGGGATCACAATGCTCCTAACAGACCGAAATTTAAACACCACTTTCTTTGACCCAGCCGGAGGAGGAGACCCCATCCTCTACCAACACCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Acipenser fulvescens

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 15
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Lake sturgeon populations have declined in the last century. This is due partly to overfishing, pollution of rivers, and to some extent because river damming has destroyed spawning runs. (Rodgers 1990)

Lake sturgeon used to be one of the most important fish in the Great Lakes. Heavy fishing and pollution from newly developed land around the lakes has caused it to become very rare. (Evans 1994) Lake sturgeons are listed as threatened by the state of Michigan.

IUCN Red List of Threatened Species: least concern

US Federal List: no special status

CITES: appendix ii

State of Michigan List: threatened

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A2acd

Version
3.1

Year Assessed
2004

Assessor/s
Runstrom, A. & St. Pierre, R. (U.S. Fish & Wildlife Service)

Reviewer/s
St. Pierre, R. & Pourkazemi, M. (Sturgeon Red List Authority)

Justification
Acipenser fulvescens was assessed by the IUCN SSC Sturgeon Specialist Group in 1996 as Vulnerable. A more detailed look at the data available for this species resulted in the global assessment being downgraded to Least Concern. However, the subpopulation in the Mississippi and Missouri River Basin area is still assessed as Vulnerable.

Although very little stock assessment work is underway, the lake sturgeon subpopulation in the Mississippi and lower Missouri river basins is believed to be stable but relatively small, certainly compared to levels in the late 1800s prior to development of modern locks, dams and reservoirs. Although extensive migrations have been reported, stocks are fragmented and spawning habitats are disrupted by development and adverse water quality. Except for a few, well regulated and short duration sport fisheries in select tributaries, harvest of lake sturgeon throughout this portion of their range is banned, but some illegal harvest has been reported.

Causes for decline of this subpopulation are known and, for the most part, irreversible. Area of occupancy, extent of occurrence and quality of habitats are all diminished compared to historic conditions. Restocking efforts using cultured fish are modest and fragmented among the states but results from Missouri DOC stockings are encouraging. Since there is currently no concerted basin-wide or interstate plan to manage or restore this stock lake sturgeon populations in the Mississippi river basin are considered to be Vulnerable.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2004

Assessor/s
St. Pierre, R. & Runstrom, A. (U.S. Fish & Wildlife Service)

Reviewer/s
St. Pierre, R. & Pourkazemi, M. (Sturgeon Red List Authority)

Contributor/s

Justification
Acipenser fulvescens was assessed by the IUCN SSC Sturgeon Specialist Group in 1996 as Vulnerable. A more detailed look at the data available for this species has resulted in it being downgraded to Least Concern.

The lake sturgeon occupies the United States and Canadian waters of the Great Lakes and the St. Lawrence River basin; Lake Champlain (Vermont-New York); the Lake Winnebago-Fox River complex (Wisconsin); Canada’s Hudson and James Bay watersheds; the Saskatchewan River (Alberta, Saskatchewan and Manitoba); and the Mississippi River basin area from the headwaters in Minnesota to the northern portion of the state of Louisiana and up the Missouri River into southern South Dakota. Well-regulated sport fisheries occur throughout the northern part of the range and Canada manages modest commercial fisheries in Ontario and Quebec provinces.

Although very little stock assessment is underway, the lake sturgeon subpopulation in the Mississippi and lower Missouri river basins is believed to be stable but relatively small, certainly compared to levels in the late 1800s prior to development of modern locks, dams and reservoirs. Area of occupancy, extent of occurrence and quality of habitats in this part of the species’ range are all diminished compared to historic conditions. Restocking efforts using cultured fish are modest and fragmented among the states but results from Missouri DOC stockings are encouraging. Since there is currently no concerted basin-wide or interstate plan to manage or restore this stock, the Mississippi river basin lake sturgeon subpopulation is considered to be Vulnerable.

The largest proportion of the global population lies in the Great Lakes and the St Lawrence River basin areas where numerous management and recovery plans are in place among and between states and provinces sharing boundary waters. Most threats here are understood and essential conservation measures are being implemented. Populations of lake sturgeon are being monitored and assessed and most segments of the stock appear to be increasing. Based upon all of the above information and IUCN definitions, the species currently is not facing a threat to its survival and is categorized as Least Concern (LC).

History
  • 1996
    Vulnerable
  • 1994
    Vulnerable
    (Groombridge 1994)
  • 1990
    Vulnerable
    (IUCN 1990)
  • 1988
    Vulnerable
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Vulnerable
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lake sturgeon populations have declined in the last century. This is due partly to overfishing, pollution of rivers, and to some extent because river damming has destroyed spawning runs. (Rodgers 1990)

Lake sturgeon used to be one of the most important fish in the Great Lakes. Heavy fishing and pollution from newly developed land around the lakes has caused it to become very rare. (Evans 1994) Lake sturgeons are listed as threatened by the state of Michigan.

US Federal List: no special status

CITES: appendix ii

State of Michigan List: threatened

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N3 - Vulnerable

United States

Rounded National Status Rank: N3 - Vulnerable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G3 - Vulnerable

Reasons: Historically abundant and widespread in rivers and lakes from southern Canada to the southeastern U.S.; now much reduced in distribution and abundance as a result of historical overfishing, dams, and water pollution; many populations continue to be negatively affected by physical barriers to migration, loss and degradation of spawning and nursery areas, and (in some areas) fishing pressures or illegal harvest, but major declines have largely ceased, and populations have stabilized (at relatively low abundance levels) or increased in some areas, in part as a result of substantial ongoing recovery efforts.

Intrinsic Vulnerability: Highly vulnerable

Comments: Lake sturgeon is a slow-growing, late-maturing (15-26 years) species that spawns intermittently (once every 4-6 years) (Becker 1983); depleted populations, even if protected, may take many years to recover. On the other hand, individuals are very long lived, so populations sometimes can persist for decades and recover once suitable conditions (e.g., for spawning) are restored.

Generation time in Canada has been estimated at 35-54 years (COSEWIC 2006).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Lake sturgeon were generally considered to be rare to uncommon in most waters of the Mississippi River basin since the late 1800s. In 1989, this species was declared as threatened by the American Fisheries Society in all Mississippi River states except Louisiana where they are believed to be extirpated (Williams et al. 1989). The Department of Natural Resources in Iowa and Illinois and the Missouri Department of Conservation list the lake sturgeon as endangered in their respective states, and in Minnesota the lake sturgeon is listed as a species of special concern. The species appears to be extirpated from its former range in Alabama and Arkansas.

The current status of lake sturgeon throughout the Mississippi basin is considered to be severely depressed from historical abundance levels. However, modern population assessment studies are lacking and rate of stock decline or growth is unknown. Native stocks were extremely depressed prior to the stocking program undertaken by the Missouri Department of Conservation. Following the first releases into Mark Twain Lake (Salt River, a Pool 24 tributary) in 1984, then at Louisiana on Pool 24 of the Mississippi River and at several Missouri River locations in 1988, increasing reports of incidental catch in commercial gear and by recreational anglers has been occurring.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Lake sturgeon were, and in some cases continue to be, an important component of Native American diet and culture. Up until about 1870, lake sturgeon were primarily considered a nuisance by commercial fisherman and were stacked on the shores to rot (Milner 1874 cited in Becker 1983). Within the next 30 years the value of sturgeon for flesh and the use of roe for caviar became economically important. During heavy fishing years in the late 1800s lake sturgeon harvest from the Great Lakes averaged over 1,814 metric tons (mt) per year. In the peak harvest year of 1885, 4,901 mt were reported of which 2,359 tons came from Lake Erie alone. Sturgeon populations declined dramatically after 1900 and although some incidental harvest was reported until 1977, numbers were extremely low after 1956.

Although lake sturgeon populations in the Great Lakes were greatly reduced due to overfishing during the last several decades of the nineteenth century they appear to be on the rebound throughout the Great Lakes and St. Lawrence basins with spawning populations being documented from 63 locations and spawning size estimates calculated for 17 of these sites. The current status of lake sturgeon populations in most of the Great Lakes Basin, the St. Lawrence River and in Wisconsin’s Lake Winnebago system is stable or increasing.

Lake sturgeon were generally considered to be rare to uncommon in most waters of the Mississippi River basin since the late 1800s. In 1989, this species was declared as threatened by the American Fisheries Society in all Mississippi River states except Louisiana where they are believed to be extirpated (Williams et al. 1989). The Department of Natural Resources in Iowa and Illinois and the Missouri Department of Conservation list the lake sturgeon as endangered in their respective states, and in Minnesota, the lake sturgeon is listed as a species of special concern. The species appears to be extirpated from its former range in Alabama and Arkansas.

The current status of lake sturgeon throughout the Mississippi basin is considered to be severely depressed from historical abundance levels. However, modern population assessment studies are lacking and rate of stock decline or growth is unknown. Native stocks were extremely depressed prior to the stocking program undertaken by the Missouri Department of Conservation. Following the first releases into Mark Twain Lake (Salt River, a Pool 24 tributary) in 1984, then at Louisiana on Pool 24 of the Mississippi River and at several Missouri River locations in 1988, increasing reports of incidental catch in commercial gear and by recreational anglers has been occurring.

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: Recently, with improved management, including several restoration and reintroduction programs, the decline has slowed in some areas and in other areas populations may have stabilized, but at a depressed population level (Environment Canada and U.S. EPA 2007). Abundance is increasing in the Great Lakes, where the overall trend is "improving" (Environment Canada and U.S. EPA 2007). In the United States, Michigan and Wisconsin have the largest remaining populations; Michigan populations were regarded as stable in the early 2000s (Michigan Department of Natural Resources). Trend in Canada varies among hydrographic units (see following); declines are continuing in most units (COSEWIC 2006). Trend may be relatively stable (at a low level) or possibly increasing in the Mississippi River basin.

COSEWIC (2006) divided the range in Canada into 8 units and separately assessed the status of each. Lake sturgeon was listed as Endangered in 5 units, Threatened in 1 unit, and Special Concern in 2 units. Together these comprise most of the current range of the species where it has not been reduced to extreme rarity (as in most of the Mississippi River basin), with the exception of some of the U.S. Great Lakes states. The following includes a brief summary of the status of each Canadian unit (based on COSEWIC 2006).

Western Hudson Bay populations: Endangered. Area of occupancy declining; few extant locations; population size probably in the low 1,000s, probably declining but poorly known; probably severely fragmented.

Saskatchewan River populations: Endangered. Four locations, declining; habitat area/quality declining; adult population size about 3,300, declining; severely fragmented; decline of more than 50 percent over three generations.

Nelson River populations: Endangered. Possibly fewer than 5 locations; habitat area/quality declining; fewer than 3,000 mature individuals, declining; severely fragmented.

Red-Assiniboine Rivers-Lake Winnipeg populations: Endangered. Declining extent of occurrence and area of occupancy; fewer than 5 locations, declining; very few mature individuals, declining in abundance; close to 100 percent decline over past three generations; severely fragmented; declining in number of populations.

Winnipeg River-English River populations: Endangered. Possibly 8 locations, declining; habitat area/quality declining; population size and trend unknown; severely fragmented; declining number of populations.

Lake of the Woods-Rainy River populations: Special Concern; 2+ locations, stable; habitat area/quality increasing following a decline; more than 50,000 adults and subadults, with increasing abundance; not severely fragmented; stable number of populations; severe decline with past heavy commercial exploitation, followed by steady recovery since 1970.

Southern Hudson Bay-James Bay populations: Special Concern. Stable or possibly stable extent of occurrence, area of occupancy, and number of locations; more than 10 extant locations; habitat area/quality possibly declining; unknown population size and trend; severely fragmented.

Great Lakes-Upper St. Lawrence populations: Threatened. Declining extent of occurrence and area of occupancy; fewer than 70 locations, declining; habitat area/quality declining; unknown number of mature individuals but at least several thousand; large decline in population size 2-3 generations in past, variable trend among different populations over past generation; 99 percent decline associated with commercial fishing in the Great Lakes over the past 3 generations; most populations have not increased since the early 1900s; severely fragmented; more than a quarter of the historical populations have been lost, but more than half of the remaining populations are either stable or recovering; self-sustaining population units are present in all of the Great Lakes and many tributaries; recent decline in St. Lawrence River due to overexploitation.

Global Long Term Trend: Decline of >90%

Comments: Abundance declined drastically during the late 1800s. For example, in the Mississippi and Missouri rivers in Missouri, the species declined from economic importance prior to 1900 to rarity by 1908 (Pflieger 1997). In Ohio, this species was abundant in the Ohio River in the 1800s (Trautman 1981). It declined thereafter and for the period 1955-1980 Trautman (1981) mentioned and mapped only one record in the Ohio River. The total commercial catch in the Great Lakes dropped drastically during the late 1800s and early 1900s such that what was a major commercial species became commercially insignificant by 1910 (earlier in some lakes) (Baldwin et al. 1979, Smith 1979, Trautman 1981).

The species now exists at an estimated 1 percent of its former abundance (Hay-Chmielewski and Whelan 1997). Historically, the Lake Michigan population, the largest in the Great Lakes, may have included 11 million fish (Hay-Chmielewski and Whelan 1997). Today, only two rivers in the Lake Michigan basin appear to have annual spawning runs of more than 200 individuals, and several others have annual runs of only 25-75 adults (Environment Canada and U.S. EPA 2007).

Lake sturgeons still inhabit much of their native postglacial distribution in the northern portion of the range in Manitoba, Ontario, and Quebec (Ferguson and Duckworth 1997). However, overexploitation and habitat alteration have reduced or extiprated some populations. The largest zone of extirpation and population reduction is in the Lake Winnipeg drainage area, which covers more than one-third of Manitoba, and populations have been severely reduced or extirpated include the lower Laurentian Great Lakes of Lake Ontario and Lake Erie (Ferguson and Duckworth 1997). In northern Ontario, lake sturgeon populations whose riverine habitats have been fragmented by two or more dams are substantially reduced from their former levels (Ferguson and Duckworth 1997). Robust populations exist in the Ontario's more remote northern rivers and lakes (Duckworth et al. 1992, Ferguson and Duckworth 1997). Populations in Lake of the Woods and possibly the north channel of Lake Huron and southern Lake Huron appear to be increasing from recent depressed levels and may be capable of sustaining very modest fisheries (Duckworth et al. 1992). No populations in Quebec are known to have been extirpated, but some have declined (Rejean Fortin, pers. comm., cited by Ferguson and Duckworth 1997).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
The life history characteristics of slow growth, late maturation, and irregular spawning periodicity make lake sturgeon populations particularly vulnerable to over-exploitation. Sturgeon populations are threatened by industrial and municipal pollution, blockage of access to habitats by dikes and dams, channelization and elimination of backwater areas, dewatering and water level fluctuations, physical destruction of spawning habitat, and inundation of habitat by reservoirs (Rochard et al. 1990, Auer 1996, Beamesderfer and Farr 1997, Noakes et al. 1999).

Although there are numerous recorded instances of tagged sturgeon passing through navigation locks, many fish are precluded or delayed from reaching spawning or preferred feeding waters. Dams without locks completely block sturgeon passage and serve as severe impediments to lake sturgeon recovery in the Mississippi basin. Spawning and nursery areas are further degraded from land use problems such as erosion and sedimentation, and direct mortality of lake sturgeon due to impacts with commercial and/or recreational navigation vessels has been documented.

Although lake sturgeon harvest from the Mississippi River is prohibited, financial incentive to collect roe for caviar remains. Small population sizes may limit poachers from targeting this species but it is likely that incidental captures are utilized and end up in the black market. With the first stocking of lake sturgeon by Missouri DOC now at age 17, there is increasing concern that poachers will target them as the females reach maturity within the next few years.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
The life history characteristics of slow growth, late maturation, and irregular spawning periodicity make lake sturgeon subpopulations particularly vulnerable to over-exploitation. Anthropogenic effects such as industrial and municipal pollution, blockage of access to habitats by dykes and dams, channeliszation and elimination of backwater areas, dewatering and water level fluctuations, physical destruction of spawning habitat, and inundation of habitat by reservoirs are known to threaten sturgeon subpopulations (Rochard et al. 1990, Auer 1996, Beamesderfer and Farr 1997, Noakes et al. 1999). Direct mortality of lake sturgeon due to impacts with commercial and/or recreational navigation vessels has been documented.

Dams may be the greatest impediment to lake sturgeon rehabilitation in the Great Lakes. Although there are numerous recorded instances of tagged sturgeon passing through navigation locks, many fish are precluded or delayed from reaching spawning or preferred feeding waters. Dams without locks completely block sturgeon passage and serve as severe impediments to lake sturgeon recovery in the Mississippi basin. Spawning and nursery areas are further degraded from land use problems such as erosion, sedimentation, and adverse discharges from point and non-point sources. Other concerns in the Great Lakes include stream channelization, over-exploitation and/or illegal harvest, lack of public concern and potential adverse impacts of lampricides on sensitive life stages.

Although lake sturgeon harvest from the Mississippi River is prohibited, financial incentive to collect roe for caviar remains. Small population sizes may limit poachers from targeting this species but it is likely that incidental captures are utilized and end up in the black market. With the first stocking of lake sturgeon by Missouri DOC now at age 17, there is increasing concern that poachers will target them as the females reach maturity within the next few years.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Degree of Threat: AB

Comments: This species has been detrimentally affected by historical overexploitation (mostly in the late 1800s and early 1900s as markets for eggs [caviar] and smoked flesh developed) and habitat loss and degradation, such as caused by dams (block migrations; alter flows and water levels, which may strand adults or render habitat unsuitable for young), siltation of spawning habitat (resulting from land clearing, agriculture, and other human activities), stream channelization (sometimes destroying spawning habitat), pollution (e.g., toxins that negatively affect sturgeons or their food resources; paper mill effluents that cause oxygen depletion and sturgeon die-offs), and loss of large mussel beds (food resources) (Harkness and Dymond 1961, Harkness and Dymond 1961, Priegel and Wirth 1971, Trautman 1981, Becker 1983, Mongeau et al. 1983, Brousseau 1987, Hart 1987, Houston 1987, Mosindy 1987, Duckworth et al. 1992, LeHaye et al. 1992, Ferguson and Duckworth 1997, Pflieger 1997, Knights et al. 2002). In even the northern portion of the range where the species is doing relatively well in some areas, commercial overexploitation and habitat alteration, usually through hydroelectric dam construction and operation, have either singly or jointly reduced or extirpated some populations in Manitoba, Ontario, and Quebec (Ferguson and Duckworth 1997). During recent decades, major human uses of water have contributed to depletion of lake sturgeon habitat in the Saskatchewan River in Alberta (McLeod et al. 1999).

Sturgeon populations continue to be negatively affected by physical barriers to migration, loss and degradation of spawning and nursery areas, and (in some areas) fishing pressure (Rochard et al. 1990, Environmental Canada and U.S. EPA 2007). Existing threats in the Canadian portion of the range include overexploitation (mostly historical), direct and indirect effects of dams, poaching, chemical control of sea lamprey, invasive species, habitat degradation and contamination, and potentially genetic contamination through stocking from non-native populations or through accidental releases from hatcheries (COSEWIC 2006). In the Great Lakes, additional threats include zebra mussel colonization of spawning habitats and predation of eggs by round gobies (Hay-Chmielewski and Whelan 1997). With the collapse of the Caspian Sea sturgeon populations, black market demand for sturgeon caviar could put tremendous pressure on Great Lakes lake sturgeon populations (Environment Canada and U.S. EPA 2007). An additional concern for lake sturgeon in Lake Erie and Lake Ontario is the spread of Botulism Type E, which produced a die-off of lake sturgeon in Lake Erie in 2001 and 2002. Botulism may also have been the cause of similar mortalities observed in Lake Ontario in 2003 and in Green Bay of Lake Michigan (Environment Canada and U.S. EPA 2007). Illegal harvesting continues to threaten some lake sturgeon populations (Baker 1980, Dumont et al. 1987, COSEWIC 2006). In the Great Lakes (and many other areas), current low numbers or lack of fish (where extirpated) is a significant impediment to recovery in many spawning areas (Environmental Canada and U.S. EPA 2007).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Commercial harvest of lake sturgeon is prohibited in all U.S. waters. Sport fishing for lake sturgeon is currently prohibited in the Mississippi River but is allowed in some tributaries in Wisconsin and Minnesota (e.g., Wisconsin, Chippewa, and St. Croix rivers) during a short hook and line season in the fall. Angling in Minnesota has several restrictions as to season, fish sizes and gear and the reported annual sport catch was 2,200–4,200 kg in 1998–2000. Harvest is not allowed in Iowa, Ohio, Kansas, Missouri, Illinois and South Dakota.

Construction of spawning habitats using coarse stone rip-rapping has been undertaken in some states (particularly Wisconsin) and appears to be highly successful. To help restore populations several states are involved in culture and supplemental stocking programs. The largest of these is Missouri which has stocked over 210,000 lake sturgeon fingerlings in the upper Mississippi and lower Missouri rivers since 1986. Survival of stocked fish is considered excellent as tagged lake sturgeon have been recaptured in the Mississippi, Missouri, Gasconade and Osage rivers and commercial fishermen have reported incidental catches reaching nuisance proportions (Hesse and Carreiro 1997).

Artificial culture and restocking of lake sturgeon is also under development in Minnesota using wild broodstock. Wisconsin DNR propagates some lake sturgeon for restocking purposes with most cultured fish being placed into the same river basins from which broodstock were taken. The Tennessee Valley Authority has stocked thousands of young lake sturgeon within the Ohio River Basin.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Actions

Conservation Actions
Commercial harvest of lake sturgeon is prohibited in all U.S. waters and strictly managed in Canadian waters with closed seasons, size limits and gear restrictions.

Angling in some waters of Michigan is allowed with several restrictions as to season, fish sizes and gear. In Wisconsin, harvest is limited to two separate sportfishing seasons. Spear fishermen must purchase a one-fish sturgeon spear tag and they are allowed to spear a fish from early February until a specified quota is reached. In Lake Winnebago, the 2000 quota was set at 400 adult females, 400 juvenile females and 2,150 males. Once 80% of the quota is reached the fishery is closed after the next day. Typical spear fishing harvest in recent years produced 1,500 to 2,500 fish. Wisconsin’s hook and line fishery allows the catch of one fish per angler per season with a minimum size range of 127–178 cm, depending on location, during early September through 15 October. All anglers must apply for and use a free tag and the fishery produces about 300–400 fish per season.

Sport fishing for lake sturgeon is currently prohibited in the Mississippi River but is allowed in some tributaries in Wisconsin and Minnesota (e.g., Wisconsin, Chippewa, and St. Croix rivers) during a short hook and line season in the fall. Angling in Minnesota has several restrictions as to season, fish sizes and gear and the reported annual sport catch was 2,200–4,200 kg in 1998–2000. Harvest is not allowed in Iowa, Ohio, Kansas, Missouri, Illinois and South Dakota.

According to the CITES Management Authority of Canada (CMAC 2000) sturgeon harvest in Canada consists of aboriginal, commercial and recreational fisheries. The entire North American commercial harvest of lake sturgeon comes from Canada where in 1997, 223 mt were caught in New Brunswick and Quebec, with 90% (200 mt) being taken from the St. Lawrence River. Catch in Ontario during the late 1990s ranged from 5–8 mt. Most of this came from Lake Huron with a small amount from Lake St. Clair. In 1998, international trade in lake sturgeon meat was reported to be 18.2 mt exported from Canada to the U.S. (mostly New York). No caviar exports are reported and no export quotas have been established by range states. Canadian Department of Fisheries and Oceans reported that in recent years total recreational catch from the North and South Saskatchewan rivers in Alberta and Saskatchewan amounted to about 1,000 fish.

Acipenser fulvescens is not listed as a species at risk by the Committee on the Status of Endangered Wildlife in Canada (COSEWIC). Most subpopulations are thought to be capable of sustaining well-regulated fisheries. Although the species is managed and protected in Canada under the Federal Fisheries Act, regulations differ between provinces and are revised annually. This species is listed under provincial legislation as "threatened" in Alberta, Manitoba, New Brunswick, Newfoundland, Ontario, Quebec and Saskatchewan (CMAC 2000).

In recent years, interest in the restoration of lake sturgeon has increased greatly. Partnerships have been developed throughout the Great Lakes basin between state and federal natural resource agencies, commercial and sport fishers and other water users. Numerous management and recovery plans have been completed for select waters within the lake sturgeon range and are being implemented as resources allow. Their goals include conservation, rehabilitation and enhancement of sturgeon populations, completion of status assessments, harvest restrictions, identification and restoration of critical habitats and elimination of negative effects of dams.

Construction of spawning habitats using coarse stone rip-rapping has been undertaken in some states (particularly Wisconsin) and appears to be highly successful. Artificial culture and restocking of lake sturgeon is under development in Minnesota using wild broodstock. In New York, sturgeon eggs are taken from wild stocks in the St. Lawrence River and cultured fingerlings have been reared and released in several locations since 1995. Survival has been high and populations appear to be recovering. In Missouri over 210,000 lake sturgeon fingerlings have been stocked in the upper Mississippi and lower Missouri rivers since 1986. Survival of stocked fish is considered excellent as tagged lake sturgeon have been recaptured in the Mississippi, Missouri, Gasconade and Osage rivers and commercial fishermen have reported incidental catches reaching nuisance proportions (Hesse and Carreiro 1997). Artificial culture and restocking of lake sturgeon is also under development in Minnesota using wild broodstock. Wisconsin DNR propagates some lake sturgeon for restocking purposes with cultured fish only being placed into the same basins from which broodstock were taken. The Tennessee Valley Authority has stocked thousands of young lake sturgeon within the Ohio River Basin.

A Lake Sturgeon Management Plan has been implemented in Alberta since 1997. This involves a zero catch limit on the North Saskatchewan River; and on the South Saskatchewan, a closed season during the 1 April to 15 June spawning period with a one fish limit (greater than 130 cm) outside that restricted season. There is no aboriginal fishery in Alberta. In Saskatchewan, a self-imposed moratorium on commercial catch of lake sturgeon has been in place since 1996 and sport angling has not been allowed since 1999. A multi-agency study of habitat, fish migration and abundance is currently underway (CMAC 2000). Manitoba reduced its possession limit of lake sturgeon to zero in 1995. The remaining few commercial fisheries closed down during the 1990s but catch and release angling is still allowed in addition to aboriginal subsistence fishing in most rivers. Lake sturgeon population management has been initiated in several Manitoba rivers with involvement of First Nations communities.

In Ontario, a Lake Sturgeon Assessment Program has been implemented for Lake Huron and Lake St. Clair, including population abundance estimation and tagging to identify movements and verify ages. As enough information is developed a management plan for the species will be drafted. Commercial catch quotas of lake sturgeon were established in 1984 and were adjusted periodically - through never achieved. In 1997, the catch quotas amounted to 1,500 kg in Lake St. Clair and 13,124 kg in Lake Huron. Huron catch that year was 5,471 kg, the highest of the previous several years.

Quebec allows the harvest of lake sturgeon with 19–20.3 cm mesh gill nets only during an open season of 14 June through 31 October. A minimum fish length is in effect and quotas are enforced by the requirement that all fish for market must be tagged, and the tag must stay with the fish until it is processed. Quebec sport fishermen may catch and keep one fish per day.

It is listed on CITES Appendix II.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Restoration Potential: Recovery in historic range is a long-term, extremely slow process. Since the lake sturgeon is a slow-growing, late-maturing (15-25 years) species that spawns intermittently (once every 4-7 years), its turn-over rate is slow. Depleted populations, as a result of habitat destruction and commercial overharvesting, may take many years to recover even with adequate protection. It is apparent that recovery will not take place in watersheds where habitat degradation and excess fishing continues to occur. Once populations have recovered, minimal levels of harvest may be possible.

The Michigan Department of Natural Resources completed a three-year study in which eggs were obtained from female sturgeon, fertilized, and grown within McDonald jars (Anderson 1987). Fairly good success was reported for fry fed with a natural, as opposed to an artificial, diet. Currently, the Minnesota Department of Natural Resources is conducting a five-year recovery program for the sturgeon in the St. Louis River of northeastern Minnesota, using artificially procured sturgeon (Anderson 1987).

New York Department of Environmental Conservation has been using artificial propagation of this species to reestablish populations of lake sturgeon in selected tributaries of Lake Ontario and the St. Lawrence River, including the Oswegatchie River, Black Lake, the St. Regis River, Oneida Lake and Cayuga Lake.

Information obtained through these stocking attempts should provide additional information pertaining to the recovery potential of this species.

Preserve Selection and Design Considerations: Protection of upland areas within a given watershed is needed to ensure habitat maintenance and reduce the risk of degradation through point and non-point pollution sources. Protection through land acquisition is not feasible or necessary unless primary spawning or resting areas are targeted.

Management Requirements: The lake sturgeon is a late-maturing, slow-growing, long-lived fish and is able to withstand only light levels of harvest pressure (Cook et al. 1987). The best indication of an over-exploited fishery is an abundance of young, small fish present in a catch (Wirth and Schultz 1957). Due to the low tolerance of this species to harvest, management must control the amount of harvest in all active fisheries.

As a whole, regulations intended to control harvest and manage lake sturgeon populations have been woefully inadequate (Hart 1987). Given the biology of the species and its habitat requirements, prompt and sound management practices must be applied if population levels are to rebound. Rehabilitation of the spawning stocks in some areas must be considered (Dumont et al. 1987).

Management must also be concerned with the availability of suitable spawning habitat and water quality. Procedures designed to reduce siltation, pesticide pollution, and point-source pollutants should be implemented in selected rivers where the likelihood of sturgeon restoration is most likely.

MacRitchie (1983) estimated that riverine lake sturgeon populations in areas of good habitat could sustain a long-term yield of 0.20-0.28 kg per hectare, if only young fish (under 90 cm) were harvested. On one fishery that had undergone past exploitation, however, the fishery collapsed very rapidly under this quota (Payne 1987). Whatever the case, management of commercial fisheries for sustained yield is a must, and may require extremely downgraded harvest quotas in years to come. In order to implement appropriate management tactics, managers must have population-specific knowledge of lake sturgeon biomass, annual yield, age of maturity, length-at-age and weight-at-age information in a particular water system (Hart 1987). To date, no information exists on successful management of lake sturgeon for sustained yields in northern waters (Nowak and Jessop 1987).

Protection of adults of spawning age has been suggested as a means of improving the long-term sturgeon populations (Hart 1987, Mosindy 1987). Imposition of slot limits (Nowak and Jessop 1987) and restrictions on gear (Hart 1987) would protect most of the brood stock. A fecundity study specific to a given fishery would first be required in order to determine which size class should be made available for harvest. Payne (1987) recommended a maximum size limit of 90 cm for commercially harvested fish, just below average mature size estimates. Nowak and Jessop (1987) suggested a slot range of 105 cm to 130 cm as possible for sport anglers in the Groundhog and Mattagami rivers in Ontario. Slot ranges have also been suggested for the St. Lawrence River in Quebec (Dumont et al. 1987). In areas such as the St. Lawrence River, Quebec (Dumont et al. 1987) and in Ontario (Hart 1987), minimum size limits are in effect and are not protecting the brood stock.

In some areas, spawning adults are protected by close monitoring of important sites. For example, Michigan Department of Natural Resources joins forces with local citizens in Cheboygan County to protect spawning lake sturgeon in the upper Black River. This section of the Black River has long been a problem spot for the illegal taking of lake sturgeon during spring spawning. But with the help of `Sturgeon Watch' volunteers, key areas can be monitored 24 hours a day. In Wisconsin, with the help of Sturgeon For Tomorrow, a conservation group, poaching has been significantly reduced on the Lake Winnebago-Wolf River System. The volunteer group, now 2,500 members strong, helps organize, fund, and serve on round-the-clock patrols to guard spawning sturgeon along the Wolf River.

Payne (1987) recommended the following management practices in three rivers in Ontario: 1) a cancellation of existing licenses in some river systems, 2) reduction of the quota, and 3) allocation of sturgeon in some areas exclusively to the sport fishery. Similar management procedures might be considered for other sturgeon waters.

Remaining highly productive fisheries and spawning grounds should be considered for protection as fish sanctuaries (Nowak and Jessop 1987, Hart 1987). Since spawning sturgeons are very vulnerable to harvest due to concentration at predictable time periods, closed seasons should be required during such periods (Hart 1987). The stretch of the Groundhog River in Ontario from LaDuke to "the Pot" has been proposed as a sanctuary from May 1 until July 15 to protect this excellent spawning and post-spawning rest area (Nowak and Jessop 1987).

Hart (1987) argued that current Ontario fishery regulations do not allow fishery managers the specific capability to appropriately manage lake sturgeon populations. Recent sturgeon studies have reported that age of maturity, and size and weight as an indicator of age, vary widely between watersheds and even within watersheds. Adjustable regulations for each lake sturgeon fishery have been recommended to better manage sturgeon in the province. Hart (1987) further stated that the management of lake sturgeon commercial fisheries must be based on: 1) management for sustained yields, 2) brood stock maintenance, 3) implementation of management initiatives that consider restoration of depleted populations, 4) protection and enhancement of lake sturgeon spawning and nursery habitat, and 5) determination if commercial and sport fishing can coexist, followed by the allocation of harvest according to specific management concerns.

Sturgeon aquaculture is new and largely experimental. As a result, suitable prepared food items have not been developed, placing total reliance on expensive, difficult-to-acquire, natural food items. At present the Minnesota Department of Natural Resources has had success raising sturgeon fry on a progressive sequence of natural foods based on the size and development of the fry: immature brine shrimp, to zooplankton, to frozen adult brine shrimp, to frozen krill (Barsness, pers. comm.). Frozen adult brine shrimp were substituted for live Tubifex worms from California when there was some concern that the worms could carry a disease and decimate the stock.

Management of the aquatic habitat is also a mandatory requirement for successful, long-term population maintenance (Harkness and Dymond 1961). Any gains obtained by intense fishery management will be for naught if environmental degradation makes the fishery uninhabitable or unsuitable for reproduction.

Management Research Needs: Baker (1980) stated that research on early life-history is needed. Growth, mortality, movements, food intake, and factors affecting year class strength should be investigated. Research needs to be continued with regard to the sexual maturation cycle (Dumont et al. 1987). Specific reproductive requirements and factors affecting spawning success need to be researched (Hesse, pers. comm. 1990; Baker 1980). Can these requirements be met by water level management or habitat rehabilitation where lake sturgeon once lived? Knowledge of these life history characteristics and reproductive requirements would play a large part in habitat rehabilitation and recovery/reintroduction.

In the upper Mississippi river system, information on population numbers and dynamics, spawning areas, relations among different groups of sturgeons, and effects of commercial navigation is needed to aid in development of effective management strategies (Knights et al. 2002).

Inventories using trap nets and/or fish caught by commercial fishermen could provide information concerning food habits, population age structure, and location of spawning grounds (Howell, pers. comm., Rice, pers. comm.). Mark-recapture methodologies would provide a considerable amount of information to this end. Radio-tagging could provide valuable information pertaining to life history, preferred habitats, and movement patterns. Rice (pers. comm., 1990) suggested that remnant populations in Lake Erie should be monitored using radio-tags in order to obtain information on movements within the lake and possible spawning areas. Research into habitat carrying capacity, economical culture techniques, and habitat enhancement also is needed (Swanson, pers. comm., 1993).

Rice (pers. comm., 1990) stated that it would be interesting to know if the lake sturgeon is using the rapidly expanding, exotic, zebra mussel population as a new food source.

Biological Research Needs: In the upper Mississippi River system, information is needed on population dynamics and the effects of commercial navigation (Knights et al. 2002). Better information is needed on current exploitation rates. Little is known about the juvenile life stage (Environment Canada and U.S. EPA 2007).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Protection: Few to several (1-12) occurrences appropriately protected and managed

Comments: Several occupied rivers are designated as state or federal scenic rivers. Many of these have low lake sturgeon population levels and do not necessarily provide protection from upstream pollution or siltation sources. Many occurrences need restoration; protection of existing conditions often is inadequate for maintaining or establishing viable sturgeon populations. Fishing for lake sturgeon is prohibited or highly regulated throughout the range of the species, but illegal harvest is a problem in some areas. Volunteer groups that watch over spawning grounds provide additional protection (Barsness, pers. comm., 1993; Dick, pers. comm., 1993).

Needs: Aquatic habitat protection is of primary importance. Releases from hydro-electric dams should be managed to ensure reproductive success and to maintain habitat productivity (Swanson, pers. comm., 1993). Upland areas should be protected in such a way as to avoid degradation of water by point and nonpoint pollution sources. Protection through land aquisition is not feasible or necessary unless primary spawning or resting areas are targeted. Additional policing and enforcement are needed to deter poaching in some areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

The lake sturgeon does not appear to present any negative attributes concerning the environment or humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

The lake sturgeon is best known as a food fish. Their unfertilized eggs, carried inside the female, are considered a delicacy. These eggs are the luxury food known as caviar. The meat of this fish is also eaten. Lake sturgeon have been fished for their flesh and their oil as well as for their caviar. Steamboats in North America once used their oil as fuel. They have also supplied isinglass. Isinglass is a form of gelatin and is obtained from the sturgeon's swimbladder and vertebrae. It was traditionally used to clarify wines and as a gelling agent in jams and jellies. Today, it is used for special cements and water-proofing materials, but its main use is in cleaning white wines. (Evans 1994)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Importance

fisheries: commercial; aquaculture: experimental; gamefish: yes; aquarium: public aquariums
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

The lake sturgeon does not appear to present any negative attributes concerning the environment or humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

The lake sturgeon is best known as a food fish. Their unfertilized eggs, carried inside the female, are considered a delicacy. These eggs are the luxury food known as caviar. The meat of this fish is also eaten. Lake sturgeon have been fished for their flesh and their oil as well as for their caviar. Steamboats in North America once used their oil as fuel. They have also supplied isinglass. Isinglass is a form of gelatin and is obtained from the sturgeon's swimbladder and vertebrae. It was traditionally used to clarify wines and as a gelling agent in jams and jellies. Today, it is used for special cements and water-proofing materials, but its main use is in cleaning white wines. (Evans 1994)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: The most important North American commercial fishery for lake sturgeon is in the St. Lawrence River (annual yield 15,000-30,000 fishes) (Fortin et al. 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Risks

Stewardship Overview: Monitoring needs include tracking the status of populations in various habitats throughout the range. Changes in habitat quality, population levels, harvest quotas, and reproduction also should be monitored.

Research should be centered around the completion of baseline population surveys. In addition, early life history, the sexual maturation cycle, reproductive requirements, and the utilization of potential non-native food sources should be investigated.

Management needs include a strict control over harvest quotas, the rehabilitation of spawning stock, and pollution control. In many areas habitat restoration is needed because spawning and rearing habitat has been destroyed or altered, or access to it has been blocked.

In many areas, population reintroduction is ongoing. Reintroduction is occurring in some northern regions, such as Wisconsin, where some lake sturgeon populations were extirpated but others are in relatively good shape. Restoration is also being attempted farther south where the species was completely extirpated. For example, as of 2006, tens of thousands of lake sturgeons had been released into the French Broad and Holston Rivers downstream of Douglas and Cherokee reservoirs in Tennessee; other release sites in Tennessee include the upper Clinch River and the Cumberland River (Tennessee Wildlife Resources Agency). Similar programs are underway in the Coosa River in Georgia (Georgia Department of Natural Resources) and in other parts of the range.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Lake sturgeon

The lake sturgeon (Acipenser fulvescens) is a North American temperate freshwater fish, one of about 25 species of sturgeon. Like other sturgeons, this species is an evolutionarily ancient bottomfeeder with a partly cartilaginous skeleton, a overall streamlined shape and skin bearing rows of bony plates on its sides and back, resembling an armored torpedo. The fish uses its elongated, spadelike snout to stir up the substrate and sediments on the beds of rivers and lakes while feeding. The lake sturgeon has four purely sensory organs that dangle near its mouth. These organs, called barbels, help the sturgeon to locate bottom-dwelling prey.Lake sturgeons can grow to a relatively large size, topping six feet (two meters) long and weighing nearly 200 pounds (90 kilograms). Lake sturgeon are also extremely long-lived fish, males may live some 55 years, and female lake sturgeon can reach 150 years. The lake sturgeon doesn't reach sexual maturity until its third decade of life.[2]

This species occurs in the Mississippi River drainage basin south to Alabama and Mississippi. It occurs in the Great Lakes and east down the St. Lawrence River to the limits of fresh water. In the west it reaches Lake Winnipeg and the North and South Saskatchewan Rivers. In the north it is found in the Hudson Bay Lowland.[3] This distribution makes sense in that all these areas were linked by the large lakes that formed as the glaciers retreated from North America at the end of the last ice age (e.g., Lake Agassiz, Lake Iroquois).

The lake sturgeon has taste buds on and around its barbels near its rubbery, prehensile lips. It extends its lips to vacuum up soft live food which it swallows whole due to its lack of teeth. Its diet consists of insect larvae, worms (including leeches), and other small organisms (primarily metazoan) it finds in the mud. Fish are rarely found in its diet and are likely incidental items only, with the possible exception of the invasive Round Goby.[4] Given that it is a large species surviving by feeding on very small species, its feeding ecology has been compared to that of large marine animals, like some whales, which survive by filter-feeding.[5]

These fish were once killed as a nuisance bycatch because they damaged fishing gear. When their meat and eggs became prized, commercial fishermen targeted them. Between 1879 and 1900, the Great Lakes commercial sturgeon fishery brought in an average of 4 million pounds (1800 metric tons) per year. Such unsustainable catch rates were coupled with environmental challenges such as pollution and the construction of dams and other flood control measures. Sturgeons, which return each spring to spawn in the streams and rivers in which they were born, found tributaries blocked and spawning shoals destroyed by silt from agriculture and lumbering. The 20th century saw drastic drops in sturgeon catches, increased regulations, and the closure of viable fisheries. Currently 19 of the 20 states within the fish's original U.S. range list it as either threatened or endangered.

This sturgeon is a valuable gourmet food fish, as well as source of specialty products including caviar and isinglass. The exploitation of the sturgeon typifies human exploitation of large animals in general. "In 1860, this species, taken on incidental catches of other fishes, was killed and dumped back in the lake, piled up on shore to dry and be burned, fed to pigs, or dug into the earth as fertilizer." [6] It was even stacked like cordwood and used to fuel steamboats. Once its value was realized, "They were taken by every available means from spearing and jigging to set lines of baited or unbaited hooks laid on the bottom to trapnets, poundnets and gillnets."[7] Over 5 million pounds were taken from Lake Erie in a single year. The fishery collapsed, largely by 1900. They have never recovered. Like most sturgeons, the lake sturgeon is rare now, and is protected in many areas.

In addition to overharvesting, it has also been negatively affected by pollution and loss of migratory waterways. It is vulnerable to population declines through overfishing due to its extremely slow reproductive cycle; most individuals caught before twenty years of age have never bred and females spawn only once every four or five years. The specific harvesting of breeding females for their roe is also damaging to population size. Few individuals ever reach the extreme old age or large size that those of previous generations often did.

Today, limited sturgeon fishing seasons are permitted in only a few areas including some locations in Minnesota, Wisconsin and Michigan. Fishing for sturgeon is allowed on Black Lake in Michigan, for example, but the fishery is limited to five total fish taken each year, each over 36 inches (910 mm) and taken through the ice with spears.

Anglers in Minnesota have the opportunity to harvest one lake sturgeon per calendar year between 45 and 50 inches on the Rainy River and Lake of the Woods on the Canadian border. The early season runs from April 24 to May 7 each year with the late season running from July 1 to September 30. Anglers must have a valid Minnesota fishing license and purchase a sturgeon tag to harvest a lake sturgeon.

There is also an annual sturgeon spearing season on Lake Winnebago in Wisconsin. It has changed from a 16 day season in the past to a season with a marked quota, however, the season can still run for the full 16 days. If 90–99% of the quota is reached on any day the season is over at 12:30 pm the following day. If 100% (or more) of the quota is reached the Wisconsin Department of Natural Resources can enable an emergency stoppage rule.[8] In 2012, the largest sturgeon ever harvested on Lake Winnebago (a female) was 125 years old, weighed 240 pounds, and measured 87.5 inches in length.[9]

The sturgeon is also present in Quebec in the St. Lawrence River, where it is targeted by commercial fisheries. It is also a game fish with an harvest limit of 1 per day. It is probably the only place where it is fairly common to catch one.

Wolf Lake State Fish Hatchery located in Kalamazoo,MI raises and releases lake sturgeon , and is the only fish hatchery in Michigan to do so. The lake sturgeon are produced mainly for inland waters although a few are stocked in Great Lakes waters.

Gallery[edit]

See also[edit]

References[edit]

  1. ^ St. Pierre, R. & Runstrom, A. (U.S. Fish & Wildlife Service) (2004). Acipenser fulvescens. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 23 February 2009.
  2. ^ Scott, W.B. and E.J. Crossman. 1972. Freshwater Fisheries of Canada. Fisheries Research Board of Canada, Department of the Environment, Ottawa. p. 82-89.
  3. ^ Scott, W.B. and E.J. Crossman. 1972. Freshwater Fisheries of Canada. Fisheries Research Board of Canada, Department of the Environment, Ottawa. p. 83-84.
  4. ^ http://www.toledoblade.com/StevePollick/2005/06/12/At-last-a-use-for-trashy-Erie-gobies-sturgeon-bait.html
  5. ^ Scott, W.B. and E.J. Crossman. 1972. Freshwater Fisheries of Canada. Fisheries Research Board of Canada, Department of the Environment, Ottawa. p. 87.
  6. ^ Scott, W.B. and E.J. Crossman. 1972. Freshwater Fisheries of Canada. Fisheries Research Board of Canada, Department of the Environment, Ottawa. p. 88.
  7. ^ Scott, W.B. and E.J. Crossman. 1972. Freshwater Fisheries of Canada. Fisheries Research Board of Canada, Department of the Environment, Ottawa. p. 88.
  8. ^ [1]
  9. ^ [2]
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Distinctive ESUs likely do not exist within this species (see Starnes 1995).

Gene sequencing data of Birstein and DeSalle (1998) indicate that there are least three main clades within Acipenser: A. sturio-A. oxyrinchus, A. schrenckii-A. transmontanus, and all Ponto-Caspian species plus A. dabrysnus and A. brevirostrum.

Krieger et al. (2000) examined phylogenetic relationships of North American sturgeons based on mtDNA sequences and found that (1) nucleotide sequences for all four examined genes for the three Scaphirhynchus species were identical; (2) the two Acipenser oxyrinchus subspecies were very similar in sequence; (3) A. transmontanus and A. medirostris were sister taxa, as were A. fulvescens and A. brevirostrum (in contrast to Birstein and DeSalle 1998).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!