Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Schooling species, usually occurring in seaward reefs at depths greater than 9 m (Ref. 1602). Adults mainly on deep coastal reef slopes and outer reef walls, often on deep shipwrecks. Juviniles found on algae-rocky reef (Ref. 48637). Benthopelagic (Ref. 58302). Occur singly or in groups (Ref. 37816). Feed on surface film of fine green and blue-green algae, diatoms, and detritus covering sand (Ref. 1602). Pair-spawner (Ref. 37816). Mainly diurnal. (Ref. 1602). Utilized as a food fish (Ref. 3146).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Acanthurus dussumieri is found from the eastern coast of Africa to the southern Arabian Peninsula, northwards to southern Japan, southwards to New South Wales, Australia, and eastwards to New Caledonia, Guam and Hawaii. This species is not recorded from eastern Micronesia or most parts of the Central Pacific (R. Myers pers. comm. 2010).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-Pacific: East Africa (including the Mascarene Islands, Ref. 37792) to the Hawaiian and Line islands, north to southern Japan, south to Rowley Shoals, southern Great Barrier Reef and Lord Howe Island. Absent from most of central Pacific.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific: East Africa, South Africa, Seychelles, Madagascar and western Mascarenes east to Hawaiian Islands and Line Islands, north to southern Japan and Ogasawara Islands, south to Rowley Shoals (Western Australia), Lord Howe Island and New Cale
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 9; Dorsal soft rays (total): 25 - 27; Analspines: 3; Analsoft rays: 24 - 26
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 540 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

54.0 cm TL (male/unsexed; (Ref. 3145))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

A schooling species, usually occurring in seaward reefs at depths greater than 9 m. Feeds on surface film of fine green and bluegreen algae, diatoms, and detritus covering sand. It is mainly diurnal. (Ref. 1602).
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Pale brown body; broader, irregular lines on head; orange band between eyes, continued behind each eye to gill cover. Each side of caudal peduncle with single, sharp, forward-pointing erectile spine; spine largely covered by cream sheath; groove surrounded by a black area. Dorsal fin with soft part having longer base than spinous part. Minute scales. Gill rakers 22-26 in anterior row, 23-27 in posterior row. Caudal fin lunate in adults (Ref. 1602).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Acanthurus dussumieri is generally found on seaward reefs, usually at depths greater than 10 m. Submarine observations in Hawaii to 131 m (Chave and Mundy 1994). It is usually seen as a solitary fish but may also occur in small groups. It feeds on detritus and sediment (Choat et al. 2004). It is classified as a grazer/detritivore (Choat and Bellwood pers. obs. in Green and Bellwood 2009).

The sexes are separate among the acanthurids (Reeson 1983). Acanthurids do not display obvious sexual dimorphism, males assume courtship colours (J.H. Choat pers. comm. 2010). It is reported as a pair spawner (Randall 2001b). Maximum age recorded from the Great Barrier Reef is at 28 years (Choat and Robertson 2002).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 4 - 131 m (Ref. 9710), usually 9 - 130 m (Ref. 27115)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 24 specimens in 1 taxon.
Water temperature and chemistry ranges based on 17 samples.

Environmental ranges
  Depth range (m): 0.65 - 72
  Temperature range (°C): 24.821 - 28.529
  Nitrate (umol/L): 0.049 - 3.115
  Salinity (PPS): 34.449 - 35.312
  Oxygen (ml/l): 3.519 - 4.727
  Phosphate (umol/l): 0.122 - 0.569
  Silicate (umol/l): 0.983 - 4.953

Graphical representation

Depth range (m): 0.65 - 72

Temperature range (°C): 24.821 - 28.529

Nitrate (umol/L): 0.049 - 3.115

Salinity (PPS): 34.449 - 35.312

Oxygen (ml/l): 3.519 - 4.727

Phosphate (umol/l): 0.122 - 0.569

Silicate (umol/l): 0.983 - 4.953
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 4 - 131m.
From 4 to 131 meters.

Habitat: reef-associated. A schooling species, usually occurring in seaward reefs at depths greater than 9 m (Ref. 1602). Feeds on surface film of fine green and blue-green algae, diatoms, and detritus covering sand (Ref. 1602). It is mainly diurnal. (Ref. 1602). Utilized as a food fish (Ref. 3146).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Also occurs in bays (Ref. 6110).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Paired spawning (Ref. 240).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Acanthurus dussumieri

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTTTATTTAGTATTCGGTGCTTGAGCTGGGATAGTGGGGACGGCTCTAAGCCTCCTAATCCGAGCAGAATTAAGCCAACCAGGCGCCCTCCTAGGAGATGATCAAATTTATAATGTAATTGTTACAGCACACGCATTCGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGTGGATTTGGAAACTGATTAATCCCACTAATGATTGGAGCTCCTGATATGGCATTCCCACGAATAAACAACATGAGCTTTTGACTACTACCACCGTCTTTCCTGCTCCTACTCGCATCCTCTGCAGTAGAATCCGGTGCTGGTACGGGATGAACAGTTTATCCTCCTTTAGCTGGCAACCTTGCACATGCAGGGGCATCCGTGGACCTAACTATCTTCTCCCTTCACCTCGCAGGAATTTCCTCAATTCTTGGGGCTATTAACTTTATTACAACAATTATTAATATGAAACCTCCTGCTACTTCTCAATATCAAACTCCTTTATTTGTGTGGGCAGTCTTAATTACTGCTGTTCTACTACTCCTTTCACTTCCTGTTCTTGCTGCTGGTATTACAATACTACTTACAGACCGAAACCTAAATACCACCTTCTTTGACCCGGCAGGCGGAGGAGACCCCATTCTATATCAACATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Acanthurus dussumieri

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 17
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
Choat, J.H., McIlwain, J., Abesamis, R., Clements, K.D., Myers, R., Nanola, C., Rocha, L.A., Russell, B. & Stockwell, B.

Reviewer/s
Davidson, L., Edgar, G. & Kulbicki, M.

Contributor/s

Justification
Acanthurus dussumieri is widespread throughout the Indo-Pacific. It is uncommon in some parts of its range. Although heavily fished in some areas (e.g., Hawaii), there is no evidence of global population declines. It has a wide habitat range and is found in inter-reefal depths down to 131 m, thus provided with refuge. Its distribution encompasses a number of marine protected areas. Given this species' wide distributional and habitat range and occurrence in marine reserves, it is therefore listed as Least Concern.


Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Acanthurus dussumieri was recorded as occasional in terms of relative abundance in Milne Bay, Papua New Guinea (Allen 2003). It is uncommon from survey data in Guam and rare in the Guam and Saipan fishery (DAWR and P. Houk unpub. data). This species makes up 35% of acanthurid fishery in Hawaii at 11,200 kg in 2007. Catch has declined from 16,000 kg in 1997 but there is no corresponding effort data (DAR unpub. data).
This species is collected as an aquarium fish in West Hawaii. The total number of individuals caught from FY 2005-2009 was 2,363 with a total value of $3,753 (Walsh et al. 2010). A. dussumieri is uncommon to rare in the Philippines (R. Abesamis, B. Stockwell and C. Nanola pers. comm. 2010).

In Kenya, landings during 1978-1982 for families that are less important in commercial catches (e.g., scarinae and Acanthuridae) showed rising catches (1978-1984) followed by a general decline during the 1990s, but the landings for the scarinae showed a rising trend in recent years (Kaunda-Arara et al. 2003).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Acanthurus dussumieri is a targeted food fish in parts of its range. It is the most landed Acanthurid species in the Hawaii commercial fishery. In parts of its distribution (e.g., Coral Triangle), it is harvested in areas with known occurrence of illegal fishing practices.

Surgeonfishes show varying degrees of habitat preference and utilization of coral reef habitats, with some species spending the majority of their life stages on coral reef while others primarily utilize seagrass beds, mangroves, algal beds, and /or rocky reefs. The majority of surgeonfishes are exclusively found on coral reef habitat, and of these, approximately 80% are experiencing a greater than 30% loss of coral reef area and degradation of coral reef habitat quality across their distributions. However, more research is needed to understand the long-term effects of coral reef habitat loss and degradation on these species' populations. Widespread coral reef loss and declining habitat conditions are particularly worrying for species that recruit into areas with live coral cover, especially as studies have shown that protection of pristine habitats facilitate the persistence of adult populations in species that have spatially separated adult and juvenile habitats (Comeros-Raynal et al. 2012).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species-specific conservation measures in place for this species. Its distribution overlaps several marine protected areas in parts of its range. In Queensland, Australia, there is a recreational catch limit of five per species and a minimum size limit of 25 cm (Department of Primary Industries accessed 8 April 2010).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial; price category: medium; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Acanthurus dussumieri

Acanthurus dussumieri is a Tang from the Indo-Pacific. It occasionally makes its way into the aquarium trade. It grows to a size of 54 cm in length.

A school of juvenile Ornate surgeonfish cruising around the shallow water of Waimushan, Kee-Lung, TAIWAN. This kind of surgeonfish is very common and can be easily found in all the coral reef area of TAIWAN

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!