Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Adults inhabit steep slopes, often in turbid waters, generally in the vicinity of coral reefs (Ref. 58652) or rocky bottoms. They form resident spawning aggregations (Ref. 27825, 48637). Adults often seen in schools, feeding mid-water on plankton (Ref. 48637). Feed on zooplankton. Marketed fresh. Flesh is almost never poisonous (Ref. 4795).
  • Randall, J.E. 1987 Three nomenclatorial changes in Indo-Pacific surgeonfishes (Acanthurinae). Pac. Sci. 41(1-4):54-61. (Ref. 1921)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Acanthurus mata is found from the Red Sea and Gulf of Oman, south to Natal, eastwards to Society and Marquesan Islands, northwards to southern Japan, southwards to New South Wales and New Caledonia. Juveniles occur as far south as Sydney (R. Myers pers. comm. 2010). It is reported from Western Australia (Allen and Swainston 1988), south to Shark Bay. It is not known to occur from the Hawaiian Islands, Pitcairn Islands and Rapa (Randall 2001a).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-Pacific: Red Sea south to Natal, South Africa and east to the Marquesas and Tuamoto islands, north to southern Japan, south to the southern Great Barrier Reef and New Caledonia.
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red Sea, Indo-West Pacific: East Africa, South Africa, Madagascar and western Mascarenes east to Tuamotu Archipelago and Marquesas Islands, north to southern Japan and Ogasawara Islands, south to Queensland (Australia) and New Caledonia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 9; Dorsal soft rays (total): 24 - 26; Analspines: 3; Analsoft rays: 23 - 24
  • Randall, J.E. 1956 A revision of the surgeonfish genus Acanthurus. Pac. Sci. 10(2):159-235. (Ref. 1920)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Max. size

50.0 cm TL (male/unsexed; (Ref. 3145)); max. reported age: 23 years (Ref. 52229)
  • Randall, J.E. 1986 Acanthuridae. p. 811-823. In M.M. Smith and P.C. Heemstra (eds.) Smiths' sea fishes. Springer-Verlag, Berlin. (Ref. 3145)
  • Choat, J.H. and D.R. Robertson 2002 Age-based studies on coral reef fishes. p. 57-80. In P.F. Sale (ed.) Coral reef fishes: dynamics and diversity in a complex ecosystem. Academic Press. (Ref. 52229)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum size: 500 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Body brown; head banded; fins brown. Capable of changing color to pale bluish overall. Behind eye a yellow area and 2 yellow bands extending anterior from eye. A single, sharp, forward-pointing erectile spine which folds down into a horizontal groove on each side of the caudal peduncle; spine in white sheath. Gill rakers 13-15 in both anterior and posterior rows. Scales minute.Description: Characterized further by having small caudal spine; slender body, greatest depth 2.1-2.5 in SL (Ref. 90102).
  • Randall, J.E. 1956 A revision of the surgeonfish genus Acanthurus. Pac. Sci. 10(2):159-235. (Ref. 1920)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

Inhabits steep slopes, often in turbid waters, generally in the vicinity of coral reefs or rocky bottoms. May form aggregations. Feeds on zooplankton. Marketed fresh. Its flesh is almost never poisonous (Ref. 4795).
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Acanthurus mata generally feeds above the bottom on zooplankton, often in small schools. It is more inclined than other surgeonfishes to enter turbid water (Randall 2001a). It is found on coral reefs or over rocky substrata, generally at depths greater than 15 m. Juveniles feed on benthic algae, adults primarily on zooplankton. It was observed within and below schools of Caranx sexfasciatus feeding on fecal material (Randall 2001a). It is sometimes seen in aggregations (Randall 2001b). It is a very mobile pelagic species. Maximum age was 23 years (Choat and Robertson 2002).

Reproduction

The sexes are separate among the acanthurids (Reeson 1983). Acanthurids do not display obvious sexual dimorphism, males assume courtship colours (J.H. Choat pers. comm. 2010). This species was observed to form very large spawning aggregations on the reef flat of Palau around both full and new moons of May (Johannes 1981). A. mata is likely to form resident spawning aggregations (Domeier and Colin 1997). It is also known to form spawning aggregations on the Great Barrier Reef (Johannes 1981).


Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 5 - 100 m (Ref. 28016), usually 5 - 45 m (Ref. 27115)
  • al Sakaff, H. and M. Esseen 1999 Occurrence and distribution of fish species off Yemen (Gulf of Aden and Arabian Sea). Naga ICLARM Q. 22(1):43-47. (Ref. 28016)
  • Baensch, H.A. and H. Debelius 1997 Meerwasser atlas. Mergus Verlag GmbH, Postfach 86, 49302, Melle, Germany. 1216 p. 3rd edition. (Ref. 27115)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 16 specimens in 1 taxon.
Water temperature and chemistry ranges based on 6 samples.

Environmental ranges
  Depth range (m): 3 - 71
  Temperature range (°C): 24.299 - 28.122
  Nitrate (umol/L): 0.046 - 12.830
  Salinity (PPS): 34.379 - 35.547
  Oxygen (ml/l): 2.533 - 4.851
  Phosphate (umol/l): 0.111 - 0.836
  Silicate (umol/l): 1.142 - 7.220

Graphical representation

Depth range (m): 3 - 71

Temperature range (°C): 24.299 - 28.122

Nitrate (umol/L): 0.046 - 12.830

Salinity (PPS): 34.379 - 35.547

Oxygen (ml/l): 2.533 - 4.851

Phosphate (umol/l): 0.111 - 0.836

Silicate (umol/l): 1.142 - 7.220
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 50 - 100m.
From 50 to 100 meters.

Habitat: reef-associated. Inhabits steep slopes, often in turbid waters, generally in the vicinity of coral reefs or rocky bottoms. May form aggregations. Feeds on zooplankton. Marketed fresh. Its flesh is almost never poisonous (Ref. 4795).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Inhabits steep slopes, often in turbid waters, generally in the vicinity of coral reefs or rocky bottoms. May form aggregations. Feeds on zooplankton (Ref. 1921).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Form resident spawning aggregations (Ref. 27825).
  • Breder, C.M. and D.E. Rosen 1966 Modes of reproduction in fishes. T.F.H. Publications, Neptune City, New Jersey. 941 p. (Ref. 205)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Acanthurus mata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CCTTTATCTAGTATTCGGTGCTTGAGCTGGGATAGTAGGAACGGCTCTAAGCCTCCTAATCCGAGCAGAATTAAGCCAACCAGGCGCCCTCCTAGGGGATGACCAGATTTATAATGTAATTGTTACAGCACATGCATTCGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGTGGGTTTGGAAACTGATTAATTCCACTAATGATTGGAGCTCCTGATATAGCATTCCCACGAATGAACAATATGAGCTTTTGACTACTACCGCCATCTTTCCTATTATTACTTGCATCCTCCGCAGTTGAATCCGGCGCCGGTACGGGATGAACAGTTTATCCCCCTCTAGCCGGTAACCTTGCACATGCAGGAGCATCCGTAGACTTGACTATTTTCTCCCTCCACCTCGCAGGAATTTCCTCAATTCTTGGGGCTATTAACTTTATTACAACAATTATTAATATAAAACCCCCTGCTACTTCTCAATATCAAACCCCTTTATTTGTATGAGCAGTATTAATTACTGCCGTTCTACTACTCCTTTCACTTCCCGTTCTTGCTGCTGGAATCACAATACTACTCACAGACCGAAACCTAAATACCACCTTCTTTGACCCGGCAGGCGGAGGAGATCCCATTCTATATCAACATTTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Acanthurus mata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 18
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
Abesamis, R., Clements, K.D., Choat, J.H., McIlwain, J., Myers, R., Nanola, C., Rocha, L.A., Russell, B. & Stockwell, B.

Reviewer/s
Davidson, L., Edgar, G. & Kulbicki, M.

Contributor/s

Justification
Acanthurus mata is widespread in the Indo-Pacific and common in parts of its range. It is a targeted food fish in the Coral Triangle Region and is one of the more important surgeonfish harvested. Fishing is not considered a major threat globally and it occurs in a number of marine reserves in parts of its distribution. It is therefore listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Acanthurus mata is common in parts of its range. Visual census surveys along Aceh coast, Weh Island, Indonesia recorded fish densities of 4 individuals/750 m2 at Pantai sirkui and 6 individuals/750 m2 at Teupin Layeu (Faculty of Mathematics and Natural Science 2007). This species was recorded as moderately common in terms of relative abundance in the northern Bismarck Sea and Milne Bay, Papua New Guinea (Allen 2003, 2009). At Raja Ampat, Indonesia, it is moderately common, usually on drop-offs in turbid water (Allen 2003b). It is occasionally found in Calamianes Islands and El Nido, Philippines; mostly juveniles and subadults were seen (Werner and Allen 2000). It is rare in the American Samoa National Park (National Park of Samoa Checklist of Fishes accessed 21 April 2010).

In Kenya, landings during 1978-2001 for families that are less important in commercial catches (e.g., scarinae and Acanthuridae) showed rising catches (1978-1984) followed by a general decline during the 1990s, but the landings for the scarinae showed a rising trend in recent years (Kaunda-Arara et al. 2003).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Acanthurus mata is targeted in areas where illegal fishing practices are known to occur (i.e., Coral Triangle Region).

Surgeonfishes show varying degrees of habitat preference and utilization of coral reef habitats, with some species spending the majority of their life stages on coral reef while others primarily utilize seagrass beds, mangroves, algal beds, and /or rocky reefs. The majority of surgeonfishes are exclusively found on coral reef habitat, and of these, approximately 80% are experiencing a greater than 30% loss of coral reef area and degradation of coral reef habitat quality across their distributions. However, more research is needed to understand the long-term effects of coral reef habitat loss and degradation on these species' populations. Widespread coral reef loss and declining habitat conditions are particularly worrying for species that recruit into areas with live coral cover, especially as studies have shown that protection of pristine habitats facilitate the persistence of adult populations in species that have spatially separated adult and juvenile habitats (Comeros-Raynal et al. 2012).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species-specific conservation measures in place for this species. Its distribution overlaps several marine protected areas in parts of its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; aquarium: commercial
  • Robins, C.R., R.M. Bailey, C.E. Bond, J.R. Brooker, E.A. Lachner, R.N. Lea and W.B. Scott 1991 World fishes important to North Americans. Exclusive of species from the continental waters of the United States and Canada. Am. Fish. Soc. Spec. Publ. (21):243 p. (Ref. 4537)
  • Sommer, C., W. Schneider and J.-M. Poutiers 1996 FAO species identification field guide for fishery purposes. The living marine resources of Somalia. FAO, Rome. 376 p. (Ref. 30573)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Elongate surgeonfish

Acanthurus mata is a marine tropical fish belonging to the family of the Acanthuridae or surgeonfishes. Its common names are Elongate surgeonfish and Blue-lined surgeonfish.[2]

A. mata with a cleaner wrasse (Komodo, Indonesia)

Description[edit]

Middle size fish that can reach a maximum size of 50 cm length. The body has an oval shape and is compressed laterally. Like other surgeonfishes, Acanthurus mata swims with its pectoral fins. The caudal fin has a crescent shape. The mouth is small and pointed.[3] Its body is streaked with horizontal bluish lines on a brown background color although over time it is able to change colour to become grey-blue overall.A longitudinal yellow stripe runs across the eye and splits in two lines extending anterior the eye. The superior lip is also yellow.[4] The dorsal and anal fin are bluish with a yellow reflection, the base of latters is underlined by a fine black line. The slit of erectile scalpel is darker. Its erectile spine, sharp as surgeon's scalpel, located at the base of the tail is a dread defensive weapon.

Distribution[edit]

This fish has a wide distribution in tropical waters going from the west part of the Indian Ocean to the archipelagos in the middle of Ocean Pacific, so it's widespread all over the Indo-Pacific.[5]

Habitat[edit]

Acanthurus mata inhabits usually steep slopes around coral reefs in depth range from 5 to 45m.[4]

Feeding[edit]

Elongate surgeonfish is a Planktivore with a preference for the zooplankton.[3]

Behaviour[edit]

Acanthurus mata has a diurnal activity.It is solitary when resting on the reef but may form small aggregation in the open water during feeding.[4]

References[edit]

  1. ^ Abesamis, R., Clements, K.D., Choat, J.H., McIlwain, J., Myers, R., Nanola, C., Rocha, L.A., Russell, B. & Stockwell, B. 2012. Acanthurus mata. In: IUCN 2013. IUCN Red List of Threatened Species. Version 2013.1. <www.iucnredlist.org>. Downloaded on 26 August 2013.
  2. ^ WoRMS - World Register of Marine Species - Acanthurus mata (Cuvier, 1829)
  3. ^ a b Froese, Rainer and Pauly, Daniel, eds. (2014). "Acanthurus mata" in FishBase. February 2014 version.
  4. ^ a b c Descriptions and articles about the Elongate Surgeonfish (Acanthurus mata) - Encyclopedia of Life
  5. ^ SOUS LES MERS : Acanthurus mata - chirurgien à queue blanche
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!