Overview

Comprehensive Description

Biology

Occurs in open water habitats. Piscivorous but may also eat Caridina and insects (Ref. 28714). Affinities: easily distinguished from two other species in West Africa from number of scale-rows below lateral line (3 instead of 2).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Africa: Occurs only in Sudano-Sahalian basins (Ref. 2880, 81279): Nile, Chad, Niger/Bénoué, Volta, Senegal and Gambia (Ref. 2880, 5331).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Sudan.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Maximum size: 860 mm ---
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

86.0 cm TL (male/unsexed; (Ref. 3799)); max. published weight: 8,250 g (Ref. 2880)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Diagnosis: eye
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

demersal; potamodromous (Ref. 51243); freshwater
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Potamodromous. Migrating within streams, migratory in rivers, e.g. Saliminus, Moxostoma, Labeo. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Occurs in open water habitats. Piscivorous but may also eat Caridina and insects (Ref. 28714).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Hydrocynus brevis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CTCTACCTCGTATTTGGTGCTTGAGCCGGCATGGTGGGGACTGCTCTTAGCCTCCTAATTCGAGCGGAACTGAGCCAACCGGGATCCCTCCTGGGAGACGACCAGATTTACAATGTTATTGTTACAGCACATGCATTCGTAATAATCTTTTTTATGGTCATGCCAATTATAATTGGCGGCTTCGGAAACTGACTGGTGCCCCTAATAATTGGTGCCCCCGATATAGCATTCCCGCGAATAAATAATATAAGCTTCTGACTCCTCCCGCCATCCTTCCTTCTTCTTTTAGCCTCTTCAGGGGTGGAAGCAGGGGCAGGAACAGGCTGGACAGTGTACCCCCCTCTCGCTGGGAACCTTGCCCACGCAGGGGCCTCCGTTGACCTAACCATCTTCTCGCTTCACCTTGCAGGAGTCTCTTCAATCCTGGGTGCAATTAACTTCATCACGACCATCATCAACATAAAACCCCCTGCCATCTCACAGTACCAGACCCCTTTGTTCGTGTGAGCCGTTTTAATTACAGCAGTTCTCCTATTGCTCTCCCTCCCTGTCCTAGCTGCAGGCATCACAATGCTTTTAACAGATCGTAACTTAAACACCACCTTCTTTGACCCTGCCGGCGGAGGAGACCCAATTCTTTACCAACACTTG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Hydrocynus brevis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Hydrocynus brevis

Hydrocynus brevis, also known as the tigerfish, Nile tigerfish or Sahelian tigerfish, is a predatory freshwater fish distributed throughout Africa.

Appearance[edit]

The tigerfish is silver in colour when young, with thin black horizontal stripes and an elongated body that tapers at both ends. As the fish grows, it will develop a bronze coloration and the stripes will fade. The ventral and caudal fins have a slight red-orange tint, and the adipose fin is grey to black. It grows to a length of 86 centimetres (34 in) SL.[1]

Distribution[edit]

This species has a wide distribution. It is found from Senegal to Ethiopia, throughout the Nile. In Northeast Africa it is found in the Ghazal and Jebel systems, Sudan, as well as Baro River, Ethiopia. In Western Africa it is known from Chad, Niger/Bénoué, Volta, Senegal and Gambia.

Habitat and ecology[edit]

A demersal, potamodromous freshwater species, Hydrocynus brevis prefers open-water habitats. It feeds mainly on fish and shrimps, with smaller individuals consuming aquatic insects.

Population and conservation status[edit]

This species is rather common over most of its range, without any known widespread threats. There is, however, a conservation policy in place in Ghana, and one potential threat is overfishing, as well as deforestation and pollution. There currently is a lack of research regarding the population of the species and its range. Habitat maintenance and restoration may also be required.[2]

Head detail.

References[edit]

  1. ^ "Hydrocynus Brevis (Gunther, 1864)." FishBase. N.p., n.d. Web. 22 Dec. 2013.
  2. ^ "Hydrocynus Brevis." IUCN Red List of Threatened Species. N.p., n.d. Web. 22 Dec. 2013.


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!