Articles on this page are available in 2 other languages: Spanish (2), Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

An oceanic and mesopelagic species (Ref. 4739, 58302), mainly at 300-650 m (Ref. 4054), 170-500 m at night and 350-600 m during day (Ref. 58302). May make short diel migrations (Ref. 4739). Smaller individuals feed on copepods and ostracods; larger ones feed on euphausiids, salps and chaetognaths (Ref. 4739). Adult complement of photophores acquired at about 14 mm SL (Ref. 4739). Oviparous, with planktonic eggs and larvae (Ref. 35838).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

Dorsal-fin rays 9; anal-fin rays 12–13; pectoral-fin rays (rarely 10) 11; total gill rakers 18–22; vertebrae 38–39 (rarely 40). Medium size species rarely exceeding 70 mm SL; body more evenly tapered than others in genus; body depth at end of dorsal greater than 3.5 times into SL; caudal peduncle long and narrow, its depth less length of subcaudal photophore group; spine low, its height less one-third its length; post-temporal short; jaws large; teeth short, recurved, spine short; postabdominal spines of equal size, curving; dorsal pre-opercle spine directed latero-anteriorly; ventral preopercle spine long, curved anteriorly; jaws large; teeth short, recurved, better developed in lower jaw; gill rakers long, closely set ; in preservative, trunk region exhibits cross pigment striations with well-defined, midlateral line.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Kenaley, Christopher

Source: Deep-sea Fishes of the World

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Data on Catalog of Fishes

View data on Catalog of Fishes here.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Kenaley, Christopher

Source: Deep-sea Fishes of the World

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type locality

Off Antilles, 15°24'40"N, 63°31'30"W, Albatross station 2117, depth 683 fathoms.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Kenaley, Christopher

Source: Deep-sea Fishes of the World

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type specimen(s)

Holotype: USNM 44593.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Kenaley, Christopher

Source: Deep-sea Fishes of the World

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Main Reference

Baird RC. 1971. The Systematics, Distribution, and Zoogeography of the Marine Hatchetfishes (family Sternoptychidae). Bulletin of the Museum of Comparative Zooology 142(1):1–128.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Kenaley, Christopher

Source: Deep-sea Fishes of the World

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Scotian Shelf into the gulf of Mexico and the Caribbean
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Atlantic: occasionally between Azores and Madeira (Ref. 4739), also from Senegal to Gulf of Guinea. Western Atlantic: 30°N-30°S, including the Gulf of Mexico (Ref. 27768). Northwest Atlantic: Canada (Ref. 5951). Indian Ocean: 20°N-20°S. Eastern Pacific: 35°N-35°S. Western Pacific: 30°N-10°S. South China Sea (Ref.74511).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Horizontal distribution: Taken abundantly in the Gulf of Guinea, off California, Chile, and in the northern Indian Ocean; moderate catches are recorded from the northern Gulf of Mexico and the coast of Venezuela in the Caribbean; smaller catches which may represent possible populations are recorded southeast of Hawaii, south of Jaya, and off the southeast coast of the United States; scattered samples representing this species appear in the Bay of Bengal, Gulf of Aden, tropical Atlantic, and off the southeast coast of Brazil. (Additional records: Atlantic, occasional catches between Azores and Madeira; Pacific, moderate catches near the coast of northern Peru.)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Kenaley, Christopher

Source: Deep-sea Fishes of the World

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Circumglobal in tropical and subtropical seas, including Hawaiian Islands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 8 - 9; Analspines: 0; Analsoft rays: 12 - 14; Vertebrae: 38 - 41
  • Badcock, J. 1984 Sternoptychidae. p. 302-317. In P.J.P. Whitehead, M.-L. Bauchot, J.-C. Hureau, J. Nielsen and E. Tortonese (eds.) Fishes of the north-eastern Atlantic and the Mediterranean. volume 1. UNESCO, Paris. (Ref. 4739)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 84 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

8.4 cm SL (male/unsexed; (Ref. 4462))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

To about 70 mm SL.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Kenaley, Christopher

Source: Deep-sea Fishes of the World

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Scales deciduous; swim bladder well developed, gas-filled, euphysoclistous; branchiostegal rays 10, 3 on epihyal; post-abdominal spines (iliac) short, equal in length; abdominal keels shallow (Ref. 4739).
  • Badcock, J. 1984 Sternoptychidae. p. 302-317. In P.J.P. Whitehead, M.-L. Bauchot, J.-C. Hureau, J. Nielsen and E. Tortonese (eds.) Fishes of the north-eastern Atlantic and the Mediterranean. volume 1. UNESCO, Paris. (Ref. 4739)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Supra-abdominal, preanal, anal, and subcaudal photophores in a nearly continuous in a straight line; subcaudal photophores separate, an appreciable gap between each photophore; 3 separate hypural elements in lower caudal lobe. Dorsal blade low, its height less than one-third its length; body margin not markedly raised posterior to dorsal blade; ventral keel scales do not extend far below abdominal photophores; no laterally directed sphenotic spine near dorsal, posterior edge of orbit. Differs from A. gigas, the most similar species, by its narrower body depth and trunk; less distinct trunk striations; relatively longer teeth in lower jaw; less well-developed post-temporal spines; smooth dorsal body surface; and less well-developed neurocranial crests (frontals, sphenotics, and parietals).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Kenaley, Christopher

Source: Deep-sea Fishes of the World

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Holotype for Argyropelecus affinis
Catalog Number: USNM 164000
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): W. Gosline, Hayes, Keen & Ellis
Year Collected: 1950
Locality: Hawaii, Kona, Mauna Loa Lava Flow, Hawaii, United States, Hawaiian Islands, Pacific
  • Holotype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Argyropelecus affinis
Catalog Number: USNM 87563
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1911
Locality: SW. of Abreojos Pt., West Coast, Lower California, Baja California Sur, Mexico, Pacific
Depth (m): 1701 to 1701
Vessel: Albatross
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Argyropelecus affinis
Catalog Number: USNM 177930
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): Y. Yamaguchi
Year Collected: 1950
Locality: Hawaii: Mauna Loa Lava Flow, Kona, Hawaii, United States, Hawaiian Islands, Pacific
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Argyropelecus affinis
Catalog Number: USNM 44593
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Year Collected: 1884
Locality: Caribbean Sea: Near Lesser Antilles, Caribbean Sea, Atlantic
Depth (m): 1249 to 1249
Vessel: Albatross
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Known from seamounts and knolls
  • Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

nektonic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Occasionally found in Canadian Atlantic waters. Found at depths of 300-650m.
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

bathypelagic; oceanodromous (Ref. 51243); marine; depth range 1 - 3872 m (Ref. 13608), usually 1 - 600 m (Ref. 35838)
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
  • Uyeno, T., K. Matsuura and E. Fujii (eds.) 1983 Fishes trawled off Suriname and French Guiana. Japan Marine Fishery Resource Research Center, Tokyo, Japan. 519 p. (Ref. 13608)
  • Watson, W. 1996 Sternoptychidae: hatchetfishes. p. 268-283. In H.G. Moser (ed.) The early stages of fishes in the California Current Region. California Cooperative Oceanic Fisheries Investigations (CalCOFI) Atlas No. 33. Allen Press, Inc., Lawrence, Kansas. 1505 p. (Ref. 35838)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 38 specimens in 1 taxon.
Water temperature and chemistry ranges based on 29 samples.

Environmental ranges
  Depth range (m): 200 - 4600
  Temperature range (°C): 1.433 - 14.966
  Nitrate (umol/L): 9.890 - 44.278
  Salinity (PPS): 34.029 - 35.986
  Oxygen (ml/l): 0.298 - 6.274
  Phosphate (umol/l): 0.579 - 3.228
  Silicate (umol/l): 4.008 - 153.790

Graphical representation

Depth range (m): 200 - 4600

Temperature range (°C): 1.433 - 14.966

Nitrate (umol/L): 9.890 - 44.278

Salinity (PPS): 34.029 - 35.986

Oxygen (ml/l): 0.298 - 6.274

Phosphate (umol/l): 0.579 - 3.228

Silicate (umol/l): 4.008 - 153.790
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Appears concentrated between 350 m and 600 m by day with the highest concentrations in the vicinity of 400 m; by night the distribution is somewhat more shallow, major concentrations occurring from 170 m to 400 m. With the possible exception of the Gulf of Guinea, there are no indications of marked geographic variation in depth distribution.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Kenaley, Christopher

Source: Deep-sea Fishes of the World

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 170 - 3872m.
From 170 to 3872 meters.

Habitat: bathypelagic. Mesopelagic, mainly in 300-650 m (Ref. 4054). Occasionally migrating. Smaller fish feed on copepods and ostracods; larger ones feed on euphausiids, salps and chaetognaths. Dioecious, adults developing photophores at about 14 mm SL (Ref. 4739).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Diet

Feeds on copepods, ostracods, euphausiids, salps and chaetognaths
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Oviparous (Ref. 35838).
  • Badcock, J. 1984 Sternoptychidae. p. 302-317. In P.J.P. Whitehead, M.-L. Bauchot, J.-C. Hureau, J. Nielsen and E. Tortonese (eds.) Fishes of the north-eastern Atlantic and the Mediterranean. volume 1. UNESCO, Paris. (Ref. 4739)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Argyropelecus affinis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CCTCTACCTAGTATTTGGTGCCTGAGCCGGGATAGTTGGTACAGCCTTAAGCTTACTCATCCGGGCAGAACTGAGTCAACCTGGCGCCCTCATAGGCGATGACCAAATCTACAATGTCCTAGTTACAGCACATGCTTTTGTAATAATCTTCTTCATAGTAATACCCATCATAATTGGAGGTTTCGGAAACTGGTTAGTCCCACTTATAATTGGTGCCCCAGATATGGCGTTTCCCCGAATGAATAACATAAGCTTTTGACTCCTTCCTCCCTCCTTTCTTCTTCTACTTGCCTCTTCGGGTGTTGAAGCTGGGGCCGGAACCGGGTGGACTGTTTATCCCCCTCTTTCCAGCAACTTAGCTCATGCAGGCGCCTCCGTTGATTTGACCATCTTCTCCCTTCACCTCGCCGGTATCTCCTCTATCCTTGGGGCCATTAACTTTATTACCACAATTATTAATATAAAACCCCCAGCCATCTCTCAATACCAGACGCCCCTTTTCGTTTGATCTGTTCTTGTCACCGCCGTACTTCTTCTTCTCTCCTTGCCCGTCCTAGCCGCTGGTATTACAATACTTTTAACAGATCGGAACCTAAACACAACCTTTTTTGACCCGGCAGGAGGGGGAGATCCCATTCTCTACCAACACCTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Argyropelecus affinis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest
  • Weitzman, S.H. 1986 Sternoptychidae. p. 253-259. In M.M. Smith and P.C. Heemstra (eds.) Smiths' sea fishes. Springer-Verlag, Berlin. (Ref. 4054)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!