Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

An oceanic and mesopelagic species concentrated at 300-600 m by day and 100-300 by night (Refs. 4462, 4739). A selective dusk-time feeder mainly on conchoecid ostracods, to lesser extent on copepods, decapod larvae, fish larvae, etc (Ref. 4739). Adult photophore developing at about 15 mm SL (Ref. 4739). Also Ref. 58302.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

Dorsal-fin rays 9; anal-fin rays 12; pectoral-fin rays 10–11; total gill rakers 15–17; vertebrae 34–36. Large species, often exceeding 70 mm SL; body very deep, depth at end of dorsal less than 1.4 into SL: dorsal spine quite high, its height about equal to its length; post-temporal spines present; dorsal surface of post-temporal with distinct serrations: postabdominal spines well developed, the posterior much larger than anterior; ventral keel extends well below body margin near postabdominal spines; preopercle spines short, both pointing ventrally; jaws large, teeth long, recurved, with two enlarged canines in lower jaw; spines present below and in front of subcaudal photophores; gill rakers medium to short, with dentate inner surfaces; pigment diffuse on trunk, no marked pigment on midline, pigment concentration above subcaudals present, pigmentless bar anterior to caudal peduncle in young.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Kenaley, Christopher

Source: Deep-sea Fishes of the World

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

References

Baird RC. 1971. The Systematics, Distribution, and Zoogeography of the Marine Hatchetfishes (family Sternoptychidae). Bulletin of the Museum of Comparative Zooology 142(1):1–128.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Kenaley, Christopher

Source: Deep-sea Fishes of the World

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Data on Catalog of Fishes

View data on Catalog of Fishes here.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Kenaley, Christopher

Source: Deep-sea Fishes of the World

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type locality

Azores, Portugal, eastern Atlantic.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Kenaley, Christopher

Source: Deep-sea Fishes of the World

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type specimen(s)

Holotype: MNHN 0000-1817.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Kenaley, Christopher

Source: Deep-sea Fishes of the World

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Main Reference

Baird RC. 1971. The Systematics, Distribution, and Zoogeography of the Marine Hatchetfishes (family Sternoptychidae). Bulletin of the Museum of Comparative Zooology 142(1):1–128.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Kenaley, Christopher

Source: Deep-sea Fishes of the World

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Grand Banks to the Caribbean
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Atlantic: Portugal to Senegal; reported from Namibia (Ref. 27121). Western Atlantic: 40°N-10°N and 15°S-35°S; specimens taken off the Guianas (Ref. 13608). Northwest Atlantic: Canada (Ref. 5951). Indian Ocean: 0°-35°S. Western Pacific: 35°N-35°S. Southeast Pacific: 30°S-35°S. Recently reported in Aden Gulf, Arabian Sea (Ref. 85285).
  • Quéro, J.-C., J.C. Njock and M.M. de la Hoz 1990 Sternoptychidae. p. 275-282. In J.C. Quero, J.C. Hureau, C. Karrer, A. Post and L. Saldanha (eds.) Check-list of the fishes of the eastern tropical Atlantic (CLOFETA). JNICT, Lisbon; SEI, Paris; and UNESCO, Paris. Vol. 1. (Ref. 4462)   http://www.fishbase.org/references/FBRefSummary.php?id=4462&speccode=40 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Taken in the Caribbean and Gulf of Mexico; in the North Atlantic to about 40°N and 35°W; occurs in the northeastern Atlantic south of about 35°N along the North African coast associated islands; essentially absent from the tropical Atlantic; small to moderate catches in the southwestern Atlantic represent this species; taken in the central Indian Ocean from about 10°S to 40°S reported off the eastern South African coast; a few records scattered along the western Pacific from north of New Guinae to Japan in the Pacific; a number of moderate catches indicate its presence in the north central Pacific; also off eastern Australia, Chile.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Kenaley, Christopher

Source: Deep-sea Fishes of the World

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Circumglobal in tropical, subtropical and temperate seas (including Mascarenes, Hawaiian Islands). Mesopelagic at 150-500 m depth.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 9; Analspines: 0; Analsoft rays: 12
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 75 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

8.3 cm SL (male/unsexed; (Ref. 57911))
  • Bernardes, R.Á., J.L. de Figueiredo, A.R. Rodrigues, L.G. Fischer, C.M. Vooren, M. Haimovici and C.L.D.B. Rossi-Wongtschowski 2005 Peixes de Zona Econômica Exclusiva da Região Sudeste-Sul do Brasil: Levantamento com armadilhas, pargueiras e rede de arrasto de fundo. São Paulo: Editora da Universidade de São Paulo. 295 p. (Ref. 57911)   http://www.fishbase.org/references/FBRefSummary.php?id=57911&speccode=102 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Often exceeding 70 mm SL.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Kenaley, Christopher

Source: Deep-sea Fishes of the World

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum Length 7.5 cm
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Deep body, lower opercular spine straight downward and curved outward. Upper opercular spine short, pointing outward (Ref. 37473).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Supra-abdominal, preanal, anal, and subcaudal photophores not in a continuous straight line; subcaudal photophore group in a single glandular cluster, no appreciable gap between each photophore; two separate hypural elements in lower caudal lobe. Two separate postabdominal spines; anal subcaudal gap fewer than 2.0 times anal-preanal gap; dorsal-fin rays 9. Posterior postabdominal spine directed posterioventrally and markedly larger than the anterior; anterior margin of posteriormost abdominal keel scale slants markedly forward; standard length fewer than 3.4 times body depth; pair of enlarged canine teeth present in lower jaw; subcaudal spines present.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Kenaley, Christopher

Source: Deep-sea Fishes of the World

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Paratype for Argyropelecus aculeatus
Catalog Number: USNM 102987
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1884
Locality: Off Cape Cod, Mass., Massachusetts, United States, Atlantic
Vessel: Albatross
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Argyropelecus aculeatus
Catalog Number: USNM 43855
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1886
Locality: Nantucket To Cape Charles
Depth (m): 2954 to 2954
Vessel: Albatross
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Argyropelecus aculeatus
Catalog Number: USNM 35561
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1884
Locality: North Atlantic, Off R.I., 1080 Fm, Rhode Island, United States, Atlantic
Vessel: Albatross
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Argyropelecus aculeatus
Catalog Number: USNM 33393
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Year Collected: 1883
Locality: Nantucket To Cape Sable, N.S., Massachusetts, United States, Atlantic
Depth (m): 1564 to 1564
Vessel: Albatross
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Holotype for Argyropelecus aculeatus
Catalog Number: USNM 102989
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1933
Locality: Puerto Rico, Greater Antilles, Caribbean Sea, Atlantic
Depth (m): 457 to 585
Vessel: Caroline
  • Holotype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Known from seamounts and knolls
  • Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

nektonic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

An oceanic and mesopelagic species concentrated at 300-600 m by day and 100-300 m by night.
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

bathypelagic; marine; depth range 100 - 600 m (Ref. 4462)
  • Quéro, J.-C., J.C. Njock and M.M. de la Hoz 1990 Sternoptychidae. p. 275-282. In J.C. Quero, J.C. Hureau, C. Karrer, A. Post and L. Saldanha (eds.) Check-list of the fishes of the eastern tropical Atlantic (CLOFETA). JNICT, Lisbon; SEI, Paris; and UNESCO, Paris. Vol. 1. (Ref. 4462)   http://www.fishbase.org/references/FBRefSummary.php?id=4462&speccode=40 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 598 specimens in 1 taxon.
Water temperature and chemistry ranges based on 556 samples.

Environmental ranges
  Depth range (m): 0 - 3800
  Temperature range (°C): 1.433 - 22.330
  Nitrate (umol/L): 0.122 - 38.897
  Salinity (PPS): 33.398 - 36.622
  Oxygen (ml/l): 0.400 - 6.465
  Phosphate (umol/l): 0.028 - 2.777
  Silicate (umol/l): 0.799 - 130.945

Graphical representation

Depth range (m): 0 - 3800

Temperature range (°C): 1.433 - 22.330

Nitrate (umol/L): 0.122 - 38.897

Salinity (PPS): 33.398 - 36.622

Oxygen (ml/l): 0.400 - 6.465

Phosphate (umol/l): 0.028 - 2.777

Silicate (umol/l): 0.799 - 130.945
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Occurs 200–600 m by day with the greatest concentrations from 350-450 m; marked diurnal movement with major concentrations at 80–200 m at night.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Kenaley, Christopher

Source: Deep-sea Fishes of the World

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 100 - 600m.
From 100 to 600 meters.

Habitat: bathypelagic. Concentrated at 300-600 m by day and 100-300 by night. A selective dusk-time feeder mainly on conchoecid ostracods, to lesser extent on copepods, decapod larvae, fish larvae, etc. Dioecious, adult photophore developing at about 15 mm SL (Ref. 4739).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

An oceanic and mesopelagic species concentrated at 300-600 m by day and 100-300 by night (Refs. 4462, 4739). A selective dusk-time feeder mainly on conchoecid ostracods, to lesser extent on copepods, decapod larvae, fish larvae, etc (Ref. 4739). Adult photophore developing at about 15 mm SL (Ref. 4739).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Diet

Feeds on ostracods, copepods, decapod larvae and fish larvae
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Argyropelecus aculeatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CCTTTACCTGGTATTCGGTGCCTGAGCCGGAATAGTCGGCACAGCCTTAAGCCTGCTCATCCGAGCAGAGCTGAGCCAACCCGGCGCCCTTATAGGCGACGACCAAATCTATAATGTCCTCGTCACAGCACACGCCTTTGTAATAATCTTCTTCATGGTAATGCCCATCATAATCGGCGGCTTCGGAAACTGACTGATCCCTCTTATGATTGGCGCCCCTGACATAGCATTCCCCCGAATAAACAACATAAGCTTCTGACTTCTCCCTCCGTCCTTCCTCCTTCTACTGGCCTCTTCAGGTGTTGAAGCAGGGGCAGGGACCGGGTGAACAGTCTATCCCCCTCTTTCCAGCAACTTGGCACATGCAGGAGCCTCTGTCGACTTAACCATCTTCTCCCTTCACCTTGCAGGTATCTCCTCAATCTTAGGGGCAATTAACTTTATTACCACAATTATTAATATAAAACCCCCAGCAATCTCTCAATACCAAACACCTCTCTTTATCTGATCCGTCCTGATTACTGCTGTACTCCTCCTCCTTTCCCTGCCCGTCTTAGCTGCCGGCATTACAATGCTTCTAACAGACCGAAATCTAAACACAACCTTCTTTGACCCCGCAGGAGGAGGAGACCCTATCCTCTACCAACACCTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Argyropelecus aculeatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 38
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Argyropelecus aculeatus

The Lovely Hatchetfish or Atlantic Silver Hatchetfish (Argyropelecus aculeatus) is a species of fish in the Sternoptychidae family. It may exceed 70 millimetres (2.8 in) standard length (SL). It lives in the mesopelagic zone of all oceans and performs diel vertical migration.[1] A. aculeatus feeds on a large range of prey items; in the Gulf of Mexico ostracods and copepods dominated the diet of small individuals (<30 mm SL) and euphausiids, molluscs, and fish the diet of larger ones.[2]

References[edit]

  1. ^ Baird, R. C. (1971). "The systematics, distribution, and zoogeography of the marine hatchetfishes (family Sternoptychidae)". Bulletin of The Museum of Comparative Zoology 142: 1–128. 
  2. ^ Hopkins, Thomas L.; Ronald C. Baird (1985). "Feeding ecology of four hatchetfishes (Sternoptychidae) in the eastern Gulf of Mexico". Bulletin of Marine Science 36 (2): 260–277. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!