Overview

Comprehensive Description

Biology

Found on the eastern Pacific upper continental slope. Oviparous, with a single egg laid per oviduct.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Longnose Catshark occurs from Oregon to the Gulf of California (Ebert et al. 2013). This species has also be identified in the waters surrounding the Galpagos Islands (Nakaya and Sato 1999), however Compagno (1984) noted that the identification was uncertain. An undescribed species closely resembling Longnose Catshark may occur off California and juvenile Panama Ghost Catshark (Apristurus stenseni) may also be confused with this species (Compagno 1984). A similar, undescribed species with large gill slits, a high rounded anal fin and a white margin to the terminal lobe of the caudal fin occurs in New Zealand and Australia (Apristurus sp. D, Last and Stevens 1994; Apristurus sp. E, Paulin et al. 1989). The limits of this species' distribution are unknown (Castro 2011).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Central Pacific: central and southern California, USA and Gulf of California. A report of a specimen from the Galapagos may be another species of uncertain identity (Ref. 6478) or a conspecific of this species.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Max. size

58.4 cm TL (male/unsexed; (Ref. 244)); 52 cm TL (female)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The biology and distribution of Longnose Catshark is poorly known due to confusion with other Apristurus species, and because of its low encounter rate due to its deepwater habitat. It occurs near the bottom over the upper continental slope from 180-1,888 m depth, with gravid females and juveniles usually occurring at depths between 1,000 and 1,200 m deep (Flammang et al. 2011, Ebert et al. 2013).

Length at 50% maturity is 485 mm total length (TL) for males, and 490 mm TL for females (Flammang et al. 2008). The maximum reported size for this species is 647 mm TL (Flammang et al. 2008). Reproduction is oviparous, with a single egg laid per oviduct. Apristurus spp. egg cases are usually thick-walled and about 5-6.8 cm long and 2.5-2.9 cm wide. Size at hatching is reported to be 140 mm TL (Ebert 2003). The anterior end of the case has a long weak fibrous thread on each corner. The posterior end usually has two small processes, each with a long coiled tendril. As in shallow water scyliorhinids the coiled tendrils are probably used to attach the egg cases to hard substrates and/or biogenic structures as they are laid.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 9 specimens in 1 taxon.
Water temperature and chemistry ranges based on 6 samples.

Environmental ranges
  Depth range (m): 490 - 1859
  Temperature range (°C): 2.870 - 3.388
  Nitrate (umol/L): 41.321 - 45.257
  Salinity (PPS): 34.497 - 34.611
  Oxygen (ml/l): 0.713 - 1.007
  Phosphate (umol/l): 3.228 - 3.351
  Silicate (umol/l): 134.145 - 167.628

Graphical representation

Depth range (m): 490 - 1859

Temperature range (°C): 2.870 - 3.388

Nitrate (umol/L): 41.321 - 45.257

Salinity (PPS): 34.497 - 34.611

Oxygen (ml/l): 0.713 - 1.007

Phosphate (umol/l): 3.228 - 3.351

Silicate (umol/l): 134.145 - 167.628
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

bathydemersal; marine; depth range 1830 - 1888 m (Ref. 58018)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 9 specimens in 1 taxon.
Water temperature and chemistry ranges based on 6 samples.

Environmental ranges
  Depth range (m): 490 - 1859
  Temperature range (°C): 2.870 - 3.388
  Nitrate (umol/L): 41.321 - 45.257
  Salinity (PPS): 34.497 - 34.611
  Oxygen (ml/l): 0.713 - 1.007
  Phosphate (umol/l): 3.228 - 3.351
  Silicate (umol/l): 134.145 - 167.628

Graphical representation

Depth range (m): 490 - 1859

Temperature range (°C): 2.870 - 3.388

Nitrate (umol/L): 41.321 - 45.257

Salinity (PPS): 34.497 - 34.611

Oxygen (ml/l): 0.713 - 1.007

Phosphate (umol/l): 3.228 - 3.351

Silicate (umol/l): 134.145 - 167.628
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 1888m.
Recorded at 1888 meters.

Habitat: bathydemersal. Found on the eastern Pacific upper continental slope. Oviparous, with a single egg laid per oviduct.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous, paired eggs are laid. Embryos feed solely on yolk (Ref. 50449).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Apristurus kampae

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATACCTAATTTTTGGTGCATGAGCAGGTATGGTTGGAATGGCCTTAAGTTTATTAATTCGTGCGGAGTTGGGTCAACCTGGGTCTCTTTTGGGGGATGACCAGATTTATAATGTAGTCGTAACTGCCCATGCCTTTGTAATAATTTTTTTTATGGTTATACCAGTAATAATCGGCGGCTTTGGAAACTGACTCGTCCCTTTAATAATTGGCGCACCAGACATAGCATTCCCGCGAATAAATAATATAAGTTTTTGACTCCTTCCTCCTTCTTTCTTACTTCTCCTAGCCTCCGCAGGGGTGGAGGCAGGGGCCGGAACAGGATGAACGGTTTACCCGCCTTTAGCAGGCAATCTGGCACACGCCGGACCCTCCGTAGACCTGGCTATTTTCTCCCTTCATTTGGCCGGTATCTCATCCATCTTAGCCTCAATTAATTTTATTACAACAATTATTAATATAAAACCGCCAGCTATTTCTCAATATCAAACGCCTTTGTTTGTTTGATCAATCCTTATTACCACCGTCCTTCTTCTTCTTGCCCTCCCAGTTCTTGCAGCCGGAATCACAATACTACTTACAGACCGCAACCTTAACACCACTTTCTTTGACCCTGCTGGCGGGGGAGACCCAATCCTTTACCAACACCTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apristurus kampae

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2015

Assessor/s
Huveneers, C., Duffy, C.A.J., Cordova, J. & Ebert, D.A.

Reviewer/s
Jew, M.L. & Nehmens, M.C.

Contributor/s

Justification

Longnose Catshark (Apristurus kampae) is a poorly-known deepwater catshark found on the upper continental slope from 180-1,888 m depth. It has been recorded in the Eastern Pacific off Oregon to the Gulf of California. It has also been reported in the waters surrounding the Galpagos Islands, but given difficulties in identification among Apristurus species, this record is contested. The biology and distribution of Longnose Catshark is poorly known given these identification issues, but also because it is rarely encountered in its deepwater habitat. Length at 50% maturity is 485 mm total length for males, and 490 mm total length for females, with a maximum reported size for this species is 647 mm total length. Reproduction is oviparous, with a single egg laid per oviduct. This species is taken incidentally as bycatch in deepwater trawls and sablefish traps off California, and no management or conservation measures are currently in place. Insufficient information is available to assess the species beyond Data Deficient.


History
  • 2004
    Data Deficient (DD)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
There is no population structure or abundance information available for this species.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Longnose Catshark, and other species of deepwater Chondricthyans, are often taken as in bycatch in deepwater trawls and sablefish traps off California. Deepwater fisheries have expand at an annual rate of 62.5 m depth per decade from 1950-2004 (Watson and Morato 2013). If they continue to expand this species should be monitored, and assessed. However, species-specific identification is often challenging due to the soft bodies of these sharks, which are often damaged during the fishing process (Castro 2011).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Data deficient (DD)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
No management measures are currently in place for this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: subsistence fisheries
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Longnose catshark

The longnose catshark, Apristurus kampae, is a catshark of the family Scyliorhinidae found in the eastern central Pacific from central and southern California and the Gulf of California, between latitudes 38° N and 23° N, at depths down to 1,890. Its length is up to 58 cm.[1]

References[edit]

  1. ^ "Longnose Catshark". Retrieved 27 April 2011. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!