Overview

Comprehensive Description

Biology

Found on the eastern Pacific upper continental slope. Oviparous, with a single egg laid per oviduct.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

A. kampae occurs from central California to the Gulf of California. Compagno (1984) noted uncertainty over the identification of A. kampae from the Galapagos Islands, however, Nakaya and Sato (1999) recognized the occurrence of this species there. An undescribed species closely resembling A. kampae may occur off California and juvenile A. stenseni may also be confused with A. kampae (Compagno 1984).

A similar, undescribed species with large gill slits, a high rounded anal fin and a white margin to the terminal lobe of the caudal fin occurs in New Zealand and Australia (Apristurus sp., D Last and Stevens 1994; Apristurus sp., E Paulin et al. 1989).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eastern Central Pacific: central and southern California, USA and Gulf of California. A report of a specimen from the Galapagos may be another species of uncertain identity (Ref. 6478) or a conspecific of this species.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eastern Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Max. size

58.4 cm TL (male/unsexed; (Ref. 244)); 52 cm TL (female)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The biology and distribution of A. kampae is poorly known due to confusion with other Apristurus species, and its deepwater habitat. It occurs near the bottom over the upper continental slope down to 1,888 m depth. Maximum reported size is 58.4 cm TL (Nakaya and Sato 1999). Reproduction is oviparous, with a single egg laid per oviduct.

Apristurus egg cases are usually thick-walled and about 5 to 6.8 cm long and 2.5 to 2.9 cm wide. The anterior end of the case has a long weak fibrous thread on each corner. The posterior end usually has two small processes, each with a long coiled tendril. As in shallow water scyliorhinids the coiled tendrils are probably used to attach the egg cases to hard substrates and/or biogenic structures as they are laid. Where reported the diet of Apristurus species usually includes crustaceans (penaeid shrimps, euphausiids), squids and small fishes.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

bathydemersal; marine; depth range 1830 - 1888 m (Ref. 58018)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 9 specimens in 1 taxon.
Water temperature and chemistry ranges based on 6 samples.

Environmental ranges
  Depth range (m): 490 - 1859
  Temperature range (°C): 2.870 - 3.388
  Nitrate (umol/L): 41.321 - 45.257
  Salinity (PPS): 34.497 - 34.611
  Oxygen (ml/l): 0.713 - 1.007
  Phosphate (umol/l): 3.228 - 3.351
  Silicate (umol/l): 134.145 - 167.628

Graphical representation

Depth range (m): 490 - 1859

Temperature range (°C): 2.870 - 3.388

Nitrate (umol/L): 41.321 - 45.257

Salinity (PPS): 34.497 - 34.611

Oxygen (ml/l): 0.713 - 1.007

Phosphate (umol/l): 3.228 - 3.351

Silicate (umol/l): 134.145 - 167.628
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 1888m.
Recorded at 1888 meters.

Habitat: bathydemersal. Found on the eastern Pacific upper continental slope. Oviparous, with a single egg laid per oviduct.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous, paired eggs are laid. Embryos feed solely on yolk (Ref. 50449).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Apristurus kampae

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATACCTAATTTTTGGTGCATGAGCAGGTATGGTTGGAATGGCCTTAAGTTTATTAATTCGTGCGGAGTTGGGTCAACCTGGGTCTCTTTTGGGGGATGACCAGATTTATAATGTAGTCGTAACTGCCCATGCCTTTGTAATAATTTTTTTTATGGTTATACCAGTAATAATCGGCGGCTTTGGAAACTGACTCGTCCCTTTAATAATTGGCGCACCAGACATAGCATTCCCGCGAATAAATAATATAAGTTTTTGACTCCTTCCTCCTTCTTTCTTACTTCTCCTAGCCTCCGCAGGGGTGGAGGCAGGGGCCGGAACAGGATGAACGGTTTACCCGCCTTTAGCAGGCAATCTGGCACACGCCGGACCCTCCGTAGACCTGGCTATTTTCTCCCTTCATTTGGCCGGTATCTCATCCATCTTAGCCTCAATTAATTTTATTACAACAATTATTAATATAAAACCGCCAGCTATTTCTCAATATCAAACGCCTTTGTTTGTTTGATCAATCCTTATTACCACCGTCCTTCTTCTTCTTGCCCTCCCAGTTCTTGCAGCCGGAATCACAATACTACTTACAGACCGCAACCTTAACACCACTTTCTTTGACCCTGCTGGCGGGGGAGACCCAATCCTTTACCAACACCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Apristurus kampae

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2004

Assessor/s
Duffy, C. & Huveneers, C.

Reviewer/s
Kyne, P.M., Cavanagh, R.D. & Fowler, S.L. (Shark Red List Authority)

Contributor/s

Justification
A poorly-known deepwater catshark recorded from the Eastern Pacific off Central California to the Gulf of California. Records from the Galapagos Islands may represent the closely-related Apristurus stenseni or another undescribed species. The biology and distribution of A. kampae is poorly known due to confusion with other Apristurus species, and its deepwater habitat (upper continental slope down to 1,888 m depth). Maximum reported size is 58.4 cm total length (TL). Taken incidentally as bycatch in deepwater trawls and sablefish traps off California. Insufficient information is available to assess the species beyond Data Deficient.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Taken as in bycatch in deepwater trawls and sablefish traps off California. Other species of deepwater Chondrichthyans are known to be captured as bycatch in deepwater fisheries. As these fisheries expand globally, consideration needs to be given to the fact that this species too may be captured incidentally in deepwater fisheries.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Data deficient (DD)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
No conservation measures are currently in place for this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: subsistence fisheries
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Longnose catshark

The longnose catshark, Apristurus kampae, is a catshark of the family Scyliorhinidae found in the eastern central Pacific from central and southern California and the Gulf of California, between latitudes 38° N and 23° N, at depths down to 1,890. Its length is up to 58 cm.[1]

References[edit]

  1. ^ "Longnose Catshark". Retrieved 27 April 2011. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!