You are viewing this Taxon as classified by:

Overview

Comprehensive Description

Biology

Inhabits coastal reefs, in shallow silty areas, and in mangroves (Ref. 9710).
  • Tortonese, E. 1986 Apogonidae. p. 803-809. In P.J.P. Whitehead, M.-L. Bauchot, J.-C. Hureau, J. Nielsen and E. Tortonese (eds.) Fishes of the north-eastern Atlantic and the Mediterranean. UNESCO, Paris. vol. 2. (Ref. 4738)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Western Indian Ocean: Red Sea and Persian Gulf south to Mozambique, Aldabra and Madagascar.
  • Randall, J.E. 1995 Coastal fishes of Oman. University of Hawaii Press, Honolulu, Hawaii. 439 p. (Ref. 11441)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red Sea, western Indian Ocean: Gulf of Oman and East Africa to Madagascar; Mediterranean Sea immigrant.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 8; Dorsal soft rays (total): 8 - 9; Analspines: 2; Analsoft rays: 6 - 8
  • Whitehead, P.J.P., M.-L. Bauchot, J.-C. Hureau, J. Nielsen and E. Tortonese (eds.) 1986 Fishes of the North-eastern Atlantic and the Mediterranean. UNESCO, Paris. Vols. I-III:1473 p. (Ref. 232)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 170 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

17.0 cm TL (male/unsexed; (Ref. 559))
  • Masuda, H., K. Amaoka, C. Araga, T. Uyeno and T. Yoshino 1984 The fishes of the Japanese Archipelago. Vol. 1. Tokai University Press, Tokyo, Japan. 437 p. (text). (Ref. 559)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Eyes slightly larger than snout. Preopercular edge serrated, preopercular ridge smooth, weakly denticulate at angle. Brownish or silver grey. 3 darker vertical bands on each side, the first including a black ocellus with yellow or white ring, last band near the base of caudal fin.
  • Whitehead, P.J.P., M.-L. Bauchot, J.-C. Hureau, J. Nielsen and E. Tortonese (eds.) 1986 Fishes of the North-eastern Atlantic and the Mediterranean. UNESCO, Paris. Vols. I-III:1473 p. (Ref. 232)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth: 5 - 20m.
From 5 to 20 meters.

Habitat: demersal. Inhabits coastal reefs, in shallow silty areas, and in mangroves (Ref. 9710).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 5 - 20 m (Ref. 559)
  • Masuda, H., K. Amaoka, C. Araga, T. Uyeno and T. Yoshino 1984 The fishes of the Japanese Archipelago. Vol. 1. Tokai University Press, Tokyo, Japan. 437 p. (text). (Ref. 559)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 8 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2 samples.

Environmental ranges
  Depth range (m): 1 - 71
  Temperature range (°C): 26.469 - 26.469
  Nitrate (umol/L): 2.154 - 2.154
  Salinity (PPS): 36.012 - 36.012
  Oxygen (ml/l): 4.698 - 4.698
  Phosphate (umol/l): 0.506 - 0.506
  Silicate (umol/l): 3.013 - 3.013

Graphical representation

Depth range (m): 1 - 71
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Inhabits coastal reefs, in shallow silty areas, and in mangroves (Ref. 9710), lagoons and floodplains (Ref. 9137).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Mouthbrooders (Ref. 240). Distinct pairing during courtship and spawning (Ref. 205).
  • Thresher, R.E. 1984 Reproduction in reef fishes. T.F.H. Publications, Inc. Ltd., Neptune City, New Jersey. 399 p. (Ref. 240)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Apogonichthyoides taeniatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apogon taeniatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATTTAGTATTTGGTGCTTGAGCAGGGATAGTGGGGACAGCCCTCAGCCTTCTTATCCGAGCTGAGCTGAGCCAACCCGGAGCCCTCCTTGGCGACGACCAGATCTATAATGTTATTGTTACCGCTCACGCATTTGTAATGATTTTCTTCATAGTGATGCCAATTATAATTGGCGGCTTTGGGAACTGGTTGATTCCCTTAATGATCGGTGCCCCCGATATAGCGTTCCCCCGAATAAACAATATAAGCTTTTGACTTCTGCCCCCCTCGTTTCTTCTCCTACTGGCTTCTTCTGGCGTAGAAGCCGGTGCCGGGACCGGATGGACTGTTTACCCCCCCCTCGCAGGCAACCTAGCCCATGCAGGGGCCTCCGTAGACTTAGCAATCTTCTCCCTTCATCTTGCAGGCGTGTCATCAATTCTGGGGGCTATTAACTTCATTACCACGATCATTAACATGAAACCCCCCGCTATTACTCAGTACCAAACCCCCCTGTTTGTGTGGGCAGTGTTAATTACCGCTGTGCTCCTCCTCCTCTCTTTACCCGTCTTAGCCGCCGGTATCACGATACTTCTTACAGACCGAAACCTAAACACGACATTCTTTGACCCTGCTGGGGGAGGGGACCCAATCCTCTACCAACACCTG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apogon taeniatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!