You are viewing this Taxon as classified by:

Overview

Comprehensive Description

Biology

Inhabits coastal reefs, in shallow silty areas, and in mangroves (Ref. 9710).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Red Sea, western Indian Ocean: Gulf of Oman and East Africa to Madagascar; Mediterranean Sea immigrant.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Indian Ocean: Red Sea and Persian Gulf south to Mozambique, Aldabra and Madagascar. Immigrant in the eastern Mediterranean, occasionally off Israel (Ref. 4738).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 8; Dorsal soft rays (total): 8 - 9; Analspines: 2; Analsoft rays: 6 - 8
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 170 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

17.0 cm TL (male/unsexed; (Ref. 559))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Eyes slightly larger than snout. Preopercular edge serrated, preopercular ridge smooth, weakly denticulate at angle. Brownish or silver grey. 3 darker vertical bands on each side, the first including a black ocellus with yellow or white ring, last band near the base of caudal fin.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth: 5 - 20m.
From 5 to 20 meters.

Habitat: demersal. Inhabits coastal reefs, in shallow silty areas, and in mangroves (Ref. 9710).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 5 - 20 m (Ref. 559)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 8 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2 samples.

Environmental ranges
  Depth range (m): 1 - 71
  Temperature range (°C): 26.469 - 26.469
  Nitrate (umol/L): 2.154 - 2.154
  Salinity (PPS): 36.012 - 36.012
  Oxygen (ml/l): 4.698 - 4.698
  Phosphate (umol/l): 0.506 - 0.506
  Silicate (umol/l): 3.013 - 3.013

Graphical representation

Depth range (m): 1 - 71
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Inhabits coastal reefs, in shallow silty areas, and in mangroves (Ref. 9710), lagoons and floodplains (Ref. 9137).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Mouthbrooders (Ref. 240). Distinct pairing during courtship and spawning (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Apogonichthyoides taeniatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apogon taeniatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATTTAGTATTTGGTGCTTGAGCAGGGATAGTGGGGACAGCCCTCAGCCTTCTTATCCGAGCTGAGCTGAGCCAACCCGGAGCCCTCCTTGGCGACGACCAGATCTATAATGTTATTGTTACCGCTCACGCATTTGTAATGATTTTCTTCATAGTGATGCCAATTATAATTGGCGGCTTTGGGAACTGGTTGATTCCCTTAATGATCGGTGCCCCCGATATAGCGTTCCCCCGAATAAACAATATAAGCTTTTGACTTCTGCCCCCCTCGTTTCTTCTCCTACTGGCTTCTTCTGGCGTAGAAGCCGGTGCCGGGACCGGATGGACTGTTTACCCCCCCCTCGCAGGCAACCTAGCCCATGCAGGGGCCTCCGTAGACTTAGCAATCTTCTCCCTTCATCTTGCAGGCGTGTCATCAATTCTGGGGGCTATTAACTTCATTACCACGATCATTAACATGAAACCCCCCGCTATTACTCAGTACCAAACCCCCCTGTTTGTGTGGGCAGTGTTAATTACCGCTGTGCTCCTCCTCCTCTCTTTACCCGTCTTAGCCGCCGGTATCACGATACTTCTTACAGACCGAAACCTAAACACGACATTCTTTGACCCTGCTGGGGGAGGGGACCCAATCCTCTACCAACACCTG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apogon taeniatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!