Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Brief Summary

The Japanese eel, Anguilla japonica, is one of 19 species in the freshwater eel family Anguillidae (all in genus Anguilla).  Despite their common name anguilid eels don’t spend their whole lives in fresh water, they have a unique catadromous lifecycle in which they travel thousands of miles from inland water bodies, sometimes crawling over land at night, then swimming to far-out, restricted oceanic spawning spots (Tsukamoto 2006).  The larvae hatch at sea and return to shallow waters where they metamorphose into the glass eel larval stage and travel in schools to freshwater inland rivers, lakes, streams and estuaries where they complete their development.  The Japanese eel is native to the area from Japan to the East China Sea, Taiwan, Korea, China and northern Philippines.  It is snake-like, with small scales, uniform brown coloration and coated with mucus.  A carnivore, it feeds on benthic crustaceans, insects and fish, and grows to a maximum length of 150 cm (5 ft.) although more typically found at about 40 cm (16 in.; Food and Agriculture Organization of the UN 2013a, b; Froese and Pauly 2013).

Extremely popular in Asian cuisine, especially smoked and used in sushi (unagi), the Japanese eel is said to be the most expensive fish in Japan (Froese and Pauly 2011).  Japanese eels have long been farmed, however the aquaculture industry is dependent on culturing glass eel stage larvae captured in the wild; breeding in captivity has not been successful.  Currently demand for Japanese eel exceeds availability, and population levels have declined dramatically, to the extent that Monterey Aquarium Seafood Watch and Greenpeace International have declared the Japanese eel unsustainable (Greenpeace 2013; Halpin 2007).  There is worry that there may be too few fish left to successfully reproduce (FAO fisheries 2013).  Furthermore, aquaculture practices have significant problems that make the industry questionable.  The IUCN is currently assessing the vulnerability status of A. japonica (Kanda and Sadakuni 2013).  Market pressure for unagi has extended to other Anguilla species, especially the European eel (A. anguilla) which is now critically endangered (Freyhof and Kottelat 2010) and the American eel (A. rostrata) which is declining and its status under assessment (Shepard 2011).

The spawning site of Anguilla japonica adults has only recently been discovered as happening during new moons around several open ocean seamounts just west of the Mariana Islands at depths of 150-200 m (500-650 feet).  The location of their spawning site is crucial to positioning the larvae in the Kuroshio current, the mechanism whereby the larvae can return to their appropriate continental freshwater habitats.  These findings are a culmination of 50 years research on larval hatch dates and appearances; understanding the spawning behavior of A. japonica is clearly important in helping to protect their migrations from disruption (Tsukamoto 2011; Froese and Pauly 2011).

Creative Commons Attribution 3.0 (CC BY 3.0)

© Dana Campbell

Supplier: Dana Campbell

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Biology

Spawning occurs in the sea; small eels ascend the rivers in schools; develop and grow in freshwater. The species may crawl over land at night from one place to another (Ref. 5258, 11230). Adults feed on crustaceans, insects and fish (Ref. 5258). Maximum weight given (1889 g) has a maximum length of 100.8 cm TL in Ref. 82795. Utilized fresh, smoked, canned and frozen; eaten steamed, broiled and baked (Ref. 9988). Used in Chinese medicine (Ref. 12166).
  • Masuda, H., K. Amaoka, C. Araga, T. Uyeno and T. Yoshino 1984 The fishes of the Japanese Archipelago. Vol. 1. Tokai University Press, Tokyo, Japan. 437 p. (text). (Ref. 559)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

It is known that A. japonica occurs as a native species in Japan, China, Taiwan and Korea. The range of this species extends from the southern Pacific coast of Japan and further south to Hainan Island covering large areas of mainland China, Taiwan and the Republic of Korea. There are some records of recruitment along the coasts of the Sea of Japan, Yellow Sea and rarely in Northern Luzon Island, Philippines. It is a rare vagrant to the Chao Phraya basin in Thailand, Viet Nam and Cambodia. It is thought that these vagrant individuals might not contribute greatly to the population as they are outside the influence of currents that are essential to the successful completion of the life cycle and thus recruitment to countries such as the Philippines can fluctuate substantially.

Preleptocephali for this species have been collected in the North Equatorial Current (NEC) along the western side of the West Mariana Ridge (14–17o N, 142–143o E) to the west of the Mariana Islands and were only captured during new moon periods (Tsukamoto 2006, 2009; Tsukamoto et al. 2011). This implicates this area, west of the Mariana Islands, as the spawning area for this species. The latitude of spawning events, however, changes among years depending upon oceanic conditions (Kimura and Tsukamoto 2006, Miller et al. 2009, Tsukamoto et al. 2011) although the NEC and Kuroshio are the predominant transport mechanisms for this species (Tzeng et al. 2012). Spawning is thought to occur between April and August (Shinoda et al. 2011) and the recruitment of glass eels to estuaries occurs in the following order in East Asia. The first few Japanese glass eels are found around the north-eastern coast of Luzon Island in the Philippines and then in greater abundance in Taiwan in late October, with the main fishing season there being between November and February. After 2-4 weeks, recruitment occurs in the Fujian Province of China and the Pacific coast of southern Japan, where the main fishing season is between December and February. In the Zhejiang and Guangdong Provinces of China, Jeju Island, and Pacific coast of central Japan, the main fishing season occurs between January and March. Later, from February to April, recruitment is concentrated in the southern Jiangsu Province of China (around Changjiang River estuary), the southern coast of Korea, and east coast of Japan. In the northern Jiangsu Province of China and the west coast of Korea, the main fishing seasons are between March and May. The final recruits occur on the northwestern coast of Korea and Yalu River between April and June (Cheng and Tzeng 1996, Han 2011).

The true range of A. japonica within countries such as Japan is difficult to determine because of widespread restocking by fisheries cooperatives. Research is currently under way to determine the relative abundance of wild and stocked eels in a few specific localities. Early indications suggest that there is little recruitment of wild eels to the Sea of Japan coastal localities such as the Hayase River system and that therefore most of the eels present in these areas are stocked eels. To date it has not been proved that stocked fish are able to contribute to the wild spawning stock and often these individuals comprise eels which have be deemed unsuitable for farming. It has been inferred that there has been a recent decline in recruitment, comparable to historical data, along the coastline of the Sea of Japan (Kaifu et al. 2013a).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Asia: Japan to the East China Sea, Taiwan, Korea, China and northern Philippines. Spawning grounds of this species are presumed to be in the western Mariana Islands, at a salinity front near 15°N and 140°E (Ref. 54488). Most expensive food fish in Japan. Introduced elsewhere.
  • Masuda, H., K. Amaoka, C. Araga, T. Uyeno and T. Yoshino 1984 The fishes of the Japanese Archipelago. Vol. 1. Tokai University Press, Tokyo, Japan. 437 p. (text). (Ref. 559)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Asia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Vertebrae: 114 - 118
  • Smith, D.G. 1999 Anguillidae. Freshwater eels. p. 1630-1636. In K.E. Carpenter and V.H. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the WCP. Vol. 3. Batoid fishes, chimaeras and bony fishes part 1 (Elopidae to Linophrynidae). FAO, Rome. (Ref. 9828)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 1500 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

150 cm TL (male/unsexed; (Ref. 9828)); max. published weight: 1,889 g (Ref. 82795)
  • Okamura, A., Y. Yamada, S. Tanaka, N. Horie, T. Utoh, N. Mikawa, A. Akazawa and H.P. Oka 2002 Atmospheric depression as the final trigger for the seaward migration of the Japanese eel Anguilla japonica. Mar. Ecol. Prog. Ser. 234:281-288. (Ref. 82795)
  • Smith, D.G. 1999 Anguillidae. Freshwater eels. p. 1630-1636. In K.E. Carpenter and V.H. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the WCP. Vol. 3. Batoid fishes, chimaeras and bony fishes part 1 (Elopidae to Linophrynidae). FAO, Rome. (Ref. 9828)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Plain-colored.
  • Smith, D.G. 1999 Anguillidae. Freshwater eels. p. 1630-1636. In K.E. Carpenter and V.H. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the WCP. Vol. 3. Batoid fishes, chimaeras and bony fishes part 1 (Elopidae to Linophrynidae). FAO, Rome. (Ref. 9828)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Anguilla japonica
Catalog Number: USNM 74118
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration; Radiograph
Collector(s): Y. Manabei
Locality: From a Rapid Near Koyadaira, a Village At the Foot of Mount Tsurugi, Shikoku, Awa, Japan, Shikoku, Tokushima Prefecture, Japan, Asia
  • Type: Jordan, D. S. 1913. Proceedings of the United States National Museum. 44 (1957): 359, pl. 57.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology

The species is catadromous, spending its lifetime in freshwater, estuaries and coastal environments, including rivers, streams and wetlands, but migrates thousands of kilometres to spawn. While anguillids are often referred to as ‘freshwater eels’, it is known that they can exhibit inter-habitat migration and movements and the proportion of yellow eels that remain in saline waters, rarely, if ever, entering fresh water, is particularly poorly understood which makes management problematic.

Little is known about the marine component of anguillid life histories in general, but A. japonica stands alone in having a well-studied spawning ecology (Kimura and Tsukamoto 2006, Tsukamoto 2009, Tsukamoto et al. 2011). The Japanese Eel’s spawning area has been identified as the region along the western side of the seamount chain of the Mariana Ridge (Tsukamoto 1992, 2006, 2009; Tsukamoto et al. 2003). The eggs and the spawning adults were discovered in the west of Mariana Ridge (Chow et al. 2009, Kurogi et al. 2011, Tsukamoto et al. 2011). The depths where adults and newly hatched larvae were captured indicate that spawning occurs in shallower layers of 150–200 m and not at great depths (Tsukamoto et al. 2011).

Its larvae develop as leaf-shaped leptocephali in the pelagic ocean environment and over the course of five to six months they drift towards their estuarine recruitment areas (Kuroki et al. 2009, Shinoda et al. 2011) on oceanic currents and then metamorphose into transparent glass eels before becoming pigmented elvers in estuaries. Pigmentation stages of glass eels of A. japonica are described by Fukuda et al. (2013). Age upon arrival to estuaries is estimated between 154 and 182 days while age at metamorphosis as between 115-137 days. Therefore, time from metamorphosis to estuarine arrival is thought to be between 32 and 45 days. As such the total time between spawning and completion of metamorphosis is likely to be a principle factor in the long distance dispersal of this species (Cheng and Tzeng 1996). A full description of the timing of glass eel recruitment to different shores is given in the Geographic Range section. The subsequent timing of upstream migration of glass eels depends on the water temperature, tidal current and moon phase (Tzeng 1985). In Korea, glass eels are caught in the Geum River when temperatures are between 5 and 15°C and the annual catch in this river is highly representative of catch throughout the rest of Korean freshwater habitat (T.W. Lee unpub. data).

Following this metamorphosis, a proportion of the population then moves upstream to feed and grow. However, some A. japonica never enter freshwater, but remain in estuaries or nearby marine habitats and have been referred to as marine residents or ‘sea eels’ (Tsukamoto et al. 1998). Analysis of the strontium;calcium ratios within the otoliths of maturing eels reveals a signature of the transition between these environments and it has been estimated that between 40-50% of the eels in some areas might be estuarine/marine residents (Kotake et al. 2005). This suggests that there is some flexibility in the continental migration of some A. japonica, which shows an ability to adapt to various habitats and salinities and implies that movement into freshwater is clearly not obligatory as evidenced by these different ecophenotypes. As such A. japonica are deemed facultatively catadromous (Tsukamoto and Arai 2001; Tzeng et al. 2002, 2003). During their growth phase, A. japonica feed mostly on invertebrates such as benthic crustaceans and insect larvae, and also on small fishes (Kaifu et al. 2013b). The maximum size this species attains is approximately 100 cm TL and 1.5 kg in weight (Kotake et al. 2007).

As with many eel species, the generation times for A. japonica are highly variable depending on sex, individual variation and locality/latitude. For example, Kotake et al. (2007) studied A. japonica from three different latitudes and found that the age of males at maturity ranged from 4 to 10 years and females from 3 to 17 years, but younger, small males were likely not adequately sampled. Other studies on the average age of silver-phase Japanese Eels, provide estimates of 6.9 and 7.8 years (Kotake et al. 2005) and 8.3 and 9.9 years (Yokouchi et al. 2009) for male and female eels, respectively, suggesting that the average generation length of A. japonica lies somewhere between 7 and 10 years.

As with many eel species environmental conditions may strongly influence recruitment and indeterminate growth rates and individual variability restrict our ability to predict how the Japanese Eel is likely to deal with environmental change.


Systems
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; catadromous (Ref. 51243); freshwater; brackish; marine; depth range 1 - 400 m (Ref. 6898)
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
  • Shao, K.-T. and P.L. Lim 1991 Fishes of freshwater and estuary. Encyclopedia of field guide in Taiwan. Recreation Press, Co., Ltd., Taipei. vol. 31. 240 p. (in Chinese). (Ref. 6898)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Catadromous. Migrating from freshwater to the sea to spawn, e.g., European eels. Subdivision of diadromous. Migrations should be cyclical and predictable and cover more than 100 km.
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Feeds on crustaceans, insects and fish. Spawning occurs in the sea; small eels ascend the rivers in schools; develop and grow in freshwater. The species may crawl over land at night from one place to another.
  • Man, S.H. and I.J. Hodgkiss 1981 Hong Kong freshwater fishes. Urban Council, Wishing Printing Company, Hong Kong, 75 p. (Ref. 5258)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diseases and Parasites

Herpesviral Gill Filament Necrosis. Viral diseases
  • Lee, N.S., J. Kobayashi and T. Miyazaki 1999 Gill filament necrosis in farmed Japanese eels, Anguilla japonica (Temminck & Schlegel), infected with Herpesvirus anguillae. J. Fish Dis. 22:457-463. (Ref. 47542)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Enteric Septicaemia of Catfish. Parasitic infestations (protozoa, worms, etc.)
  • Plumb, J.A. 1999 Edwardsiella Septicaemias. p.479-521. In P.T.K. Woo and D.W. Bruno (eds.) Fish Diseases and Disorders, Vol. 3: Viral, Bacterial and Fungal Infections. CAB Int'l. (Ref. 48850)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Edwardsiellosis. Bacterial diseases
  • Plumb, J.A. 1999 Edwardsiella Septicaemias. p.479-521. In P.T.K. Woo and D.W. Bruno (eds.) Fish Diseases and Disorders, Vol. 3: Viral, Bacterial and Fungal Infections. CAB Int'l. (Ref. 48850)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Centrocestus Infestation. Parasitic infestations (protozoa, worms, etc.)
  • Paperna, I. 1996 Parasites, infections and diseases of fishes in Africa. An update. CIFA Tech. Pap. No. 31. 220 p. FAO, Rome. (Ref. 45600)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Aeromonosis. Bacterial diseases
  • Aoki, T. 1999 Motile Aeromonads (Aeromonas hydrophila). p.427-453. In P.T.K. Woo and D.W. Bruno (eds.) Fish Diseases and Disorders, Vol. 3: Viral, Bacterial and Fungal Infections. CAB Int'l. (Ref. 48848)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Assuming reproductive mode to be the same as that of Anguilla anguilla.
  • Thresher, R.E. 1984 Reproduction in reef fishes. T.F.H. Publications, Inc. Ltd., Neptune City, New Jersey. 399 p. (Ref. 240)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Anguilla japonica

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGGCAATCACCCGTTGATTCTTTTCTACTAATCACAAAGACATTGGTACCCTATATCTAGTATTTGGTGCCTGAGCCGGAATAGTTGGAACCGCACTAAGCCTTCTAATCCGTGCCGAATTAAGTCAACCAGGCGCCCTTCTTGGAGACGACCAAATTTACAATGTCATCGTCACAGCGCATGCCTTTGTAATGATTTTCTTTATAGTAATACCAGTAATAATTGGAGGATTTGGCAACTGGCTCGTGCCGTTAATGATCGGCGCCCCAGACATAGCATTTCCCCGAATAAACAACATAAGCTTCTGACTTTTACCACCATCATTCCTTCTTCTGCTGGCCTCCTCAGGGGTAGAAGCTGGGGCCGGTACAGGTTGAACCGTATATCCTCCTCTAGCTGGAAACTTAGCCCATGCCGGAGCATCTGTTGACCTGACAATCTTTTCACTTCACCTTGCAGGGATTTCATCAATCCTAGGGGCCATTAATTTTATTACTACAATTATTAATATGAAGCCGCCTGCCATTACACAGTACCAAACCCCACTGTTTGTATGAGCTGTTTTAGTTACCGCTGTTCTACTACTTCTATCCCTCCCAGTCCTAGCTGCAGGTATTACAATACTTCTAACTGACCGAAATTTAAATACAACCTTCTTTGACCCTGCAGGGGGTGGAGACCCAATCCTCTACCAACACCTATTCTGATTCTTTGGTCACCCAGAAGTATACATTTTAATCCTACCAGGATTTGGAATAATCTCACACATTGTTGCCTATTATTCCGGTAAGAAAGAACCATTTGGATATATAGGAATAGTTTGAGCAATGATGGCTATCGGACTTCTAGGATTCATTGTATGAGCACACCATATGTTCACAGTAGGAATAGACGTAGACACTCGTGCTTACTTCACTTCCGCCACAATAATCATCGCAATTCCAACCGGAGTAAAAGTATTCAGCTGACTAGCCACATTACACGGAGGGGTCATCAAATGAGAAACCCCACTCCTTTGAGCTTTGGGTTTTATCTTCCTATTTACAGTCGGGGGCTTGACAGGTATCGTACTAGCAAACTCATCAATCGACATTGTATTACATGACACATACTATGTAGTAGCTCATTTCCATTATGTTCTATCTATAGGAGCAGTCTTTGCTATTATAGGAGGCTTTGTGCACTGATTCCCCCTGTTCTCAGGCTATACACTACACAGCACATGAACCAAAGTACACTTTGGAATTATATTCGTAGGAGTAAACCTAACTTTCTTCCCACAACATTTCCTAGGGTTAGCAGGAATACCACGACGTTATTCAGACTACCCAGATGCCTACACCCTGTGAAACACAATCTCCTCTATTGGGTCACTAATTTCTCTCACAGCCGTAATCCTGTTCCTATTTATCCTTTGAGAAGCATTCACTGCTAAACGAGAAGTAAAATGAGTAGAACTCACAGAAACAAATGTTGAATGACTACACGGATGTCCTCCACCATACCACACATTCGAAGAACCAGCGTACGTCCGAGTTCAACCGCCCTCAGAAGATCAAAAATCAGAAGCCAAAGCCCACATTCAAGAAAGG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Anguilla japonica

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
A2bc

Version
3.1

Year Assessed
2014

Assessor/s
Jacoby, D. & Gollock, M.

Reviewer/s
Tzeng, W., Miller, J, Han, Y., Aoyama, J., Harrison, I.J. & Tsukamoto, K.

Contributor/s
Ahn, H., Bennett, L., Casselman, J., Crook, V., DeLucia, M., Kaifu, k., Kurwie, T., Sasal, P., Silfvergrip, A., Uchida, K., Walker, M & Turnock, S.

Justification

Anguilla japonica exhibits facultative catadromy (Tsukamoto and Arai 2001), has multiple life stages, is semelparous (Tsukamoto et al. 2011) and panmictic (Ishikawa et al. 2001, Han et al. 2010, Minegishi et al. 2012) and these life history traits made application of the IUCN Red List criteria more challenging.

Ideally, IUCN Red List criteria would be applied to mature eels at their spawning areas, and in the absence of such data, the criteria would be applied to silver eels starting their spawning migration (in the case of Japanese Eels, leaving ‘continental’ waters), as these represent the maximum estimate of spawning stock biomass. These data sets however, are very rare. As such data from eel fisheries and monitoring data (glass, yellow and silver eel stage) from freshwater and coastal habitats have been used as a proxy, although the relationships between recruitment, yellow eel populations, silver eel escapement and spawner stock biomass are poorly understood. The IUCN Red List criteria have to be applied to an amalgamation of multiple life stages, which may not exactly mirror the mature spawning stock. The Japanese Eel is a panmictic species, i.e. they come from one spawning stock. Assuming equal importance of the continental populations, the difficulty that this potentially poses is that escapement from a specific river/country/region is not equivalent to the subsequent recruitment as this relies on the spawning stock as a whole, irrespective of escapement location. However, there are hypotheses that certain regions may have greater importance for the spawning stock, and as data are only available from certain parts of the species' range it is important that conservation initiatives and management actions are adjusted as new data become available. Due to the location of the spawning area for the Japanese eel, which has been identified as west of the Mariana Islands in the Western Pacific Ocean (Tsukamoto et al. 2011), the waters of Japan are likely to receive a high proportion (20-50%) of the total recruitment of eel larvae/glass eels annually with China, Korea and Taiwan also recruiting a significant proportion of the remainder (Y-S Han; K Tsukamoto 2014 pers. comm.). In addition, it is thought that those individuals that do silver in and around Japanese waters are more likely to succeed in reaching the spawning grounds on their return migration (Otake et al. unpub.) and as such Japan’s – and to a lesser extent, China, Korea and Taiwan’s - proportion of A. japonica are a crucial indicator for the health of the population as a whole.

Available data for glass, yellow and silver eels indicate that this species has declined in abundance across its range over the last 30 years (ca. three generations) and has been assessed as Endangered under A2bc indicating that the spawning population has at least halved in this time period. Across East Asia, A. japonica is an important fishery resource with a long cultural tradition and thus is of high economic and cultural value. As such one of the proposed main drivers of the declines is exploitation for consumption and stocking culture facilities. Another factor that has been proposed as causing declines in the Japanese Eel is short term changes in oceanic conditions (e.g., El Niño, typhoons, mid-scale eddies, bifurcation, global warming) which influence larval survival or transport. These in turn are potentially exacerbated by multiple and more localised threats that include barriers to upstream and downstream migration, loss of habitat, pollution caused by industrial and agricultural runoff and modifications of coastal, riverine and other suitable habitat.

Estimating population dynamics in anguillid eels is particularly challenging and due to a considerable lack of fisheries-independent monitoring data for eels in East Asia, for this assessment we predominantly used fisheries catch data with some standardised catch per unit effort (CPUE) data from countries/regions across the distribution of A. japonica. The quality and quantity of data is disproportionate across the species’ range with the most extensive data sets coming from Japan. It is generally agreed that more fisheries-independent monitoring of eel populations is required throughout the range of the Japanese Eel. However, until such data become available a precautionary approach must be to assess trends in the fisheries time series in order to highlight potential threats and apparent trends as a guide for future research and conservation. Furthermore, as with other anguillid species, the available data relating to A. japonica is gained from fisheries statistics in freshwater. Increased monitoring of the brackish and sea water residents and also of individuals migrating to open ocean for spawning is clearly required to accurately and fully assess the impact of the proposed threats on the population as a whole.

While more monitoring is clearly needed, conservation progress is being made. In Japan in 2009, the Eel River Project was set up by the East Asia Eel Resource Consortium (EASEC) designed to sample and monitor glass eel recruitment year round across a number of prefectures in Japan and Taiwan. To date however, the EASEC remains without official support from the Japanese government and as such their influence to implement change can be limited. More recently in 2012, the capture of silver eel was prohibited or restricted in three of the principal glass eel-fishing prefectures (Miyazaki, Kumamoto and Kagoshima), with the intention of preserving spawning eels in these productive areas. And furthermore, restocking of young eels also occurs in some localities throughout its range and since 2013 Japan, Korea, China and Taiwan just started to plan co-operation to manage fisheries and introduce traceability of eel products at the international level. Reassessment of this species in five years will hopefully gauge the success of some of these current conservation initiatives at a time when there is hoped to be more monitoring data available to better understand the population status of this species.

Assessment of the species was carried out during a workshop held at the Zoological Society of London from July 1st-5th, 2013.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population

Population genetic studies indicate that A. japonica consists of one genetically homogenous, panmictic population (Ishikawa et al. 2001, Satoshi et al. 2001, Han et al. 2010, Minegishi et al. 2012). Several studies using microsatellite analysis have suggested that Japanese juvenile yellow eels show little genetic variation among years. A genetic study carried out by Tseng et al. (2003) for example suggests that the effective population size (EPS) of the Japanese Eel is declining and the authors speculate that historically this has been due to large scale oceanographic changes. Bonhommeau et al. (2008), however, give a clearer account of the potential impact of changing climate-driven processes on temperate eel recruitment. While EPS does not offer a true measure of the number of mature, reproductive individuals in the population, a reduction in this value suggests an overall loss of adaptive genetic variation. There remains considerable uncertainty, however, surrounding the role of changing oceanographic conditions on all anguillid eel population dynamics and further research is required in order to understand the influence of natural climatic fluctuations (such as the El Niǹo) and anthropogenic effects. Because changing oceanic conditions are beyond our direct control, fisheries management is the most feasible rapid response to these declines, although these actions should not be carried out in isolation from other management measures e.g. habitat restoration and/or mitigation against pollution.

Although numbers of glass eels may fluctuate in 5 to 6 year cycles in relation to their reproductive cycle (Han et al. 2009) or to solar activity in Taiwan (Tzeng et al. 2012), fisheries catches of wild Japanese glass eels have been steadily declining since the 1970s (FAO 2013). Catch effort can be variable in fishing data, and under-reporting and, in some cases, an absence of reporting of landings is a serious problem across the range of the Japanese Eel. Thus landings data cannot be accepted as a precise measure of stock status. However, trends in the reported catch data will, to some extent, reflect true changes in fishing yields. These declines are thought to be caused by multiple factors (see Threats).

Glass Eels:
The data sets used in the analysis were as follows: Ministry of Agriculture, Forest and Fisheries (MAFF) compiled glass eel data (Japan), Food and Agricultural Organisation (FAO) eel catch statistics (Asia)*, national glass eel catch (Taiwan), national glass eel catch (China), Lake Kasumigaura glass eel CPUE (Japan) and CPUE glass eel catch for five Japanese prefectures (Ibaraki, Kanagawa, Kagawa, Fukuoka and Kumamoto). (*These catch data include all life stages and comprise a composite of multiple data from Asia including some MAFF data).

According to a study that modelled eel larvae transport and recruitment, of the spawning stock of Anguilla japonica, the Japanese population constitutes between 20-50% of the larvae that hatch due to the proximity of Japan to the spawning area and the likelihood of successful recruitment to growth habitats, which may decline as a function of distance travelled by the leptocephali (Kim et al. 2007). Media reports in Japan suggest that the Japanese Fisheries Agency recently announced that the catch of eel fry in December-April 2013 in Japan was 25% lower than the previous season’s haul. Due to a poor catch for the fourth year in a row (2009-2013), the trading price for young eels, has again exceeded the previous year, reaching record highs for this species. According to MAFF statistics from between 1957 and 2010 there has been a remarkable decrease in the numbers of 'natural seeds', namely glass eels and young yellow eels in inland Japanese waters with an as much as 90% decline over the last 30 years (three generations). The proportion of the population that comprise eels living in estuaries and nearby marine habitats however, is a huge discussion point.

When considering glass eel CPUE data from five different Japanese prefectures prominent for eels, and from glass eel statistics in Taiwan, the declines in catches range between 54 and 74%, with one study in Lake Kasumigaura reporting numbers that are stable but at very low levels. While Japan appears to be the epicentre for glass eel recruitment, mainland China has also seen an 80% decline in glass eel recruitment over the last six years (S. Z. Dou, pers. comm.). More data, however, are required from the proportion of the population that reside in Chinese inland and coastal waters.

Yellow/Silver Eels:
The data sets used in the analysis were as follows: Ministry of Agriculture, Forest and Fisheries (MAFF) compiled yellow/silver eel data (Japan), Lake Kasumigaura, long line CPUE (Japan).

According to FAO landing statistics published by ICES (2002), 2,164 tonnes of A. japonica were caught in 1974 and catch declined year on year thereafter (2,125 t in 1984; 1,042 t in 1994; 765 t in 2000). Recent FAO statistics (2013) suggest that catch is as low as 306 t although there is no indication of effort from these data. More recently the Japanese Eel was described as 'Endangered' on the Japanese Red List (published by the Ministry of Environment, based on the catch data of inland adult eels compiled by the Ministry of Agriculture, Forestry and Fisheries (MAFF)). This report indicated a 70-90% decline in the species over the last three generations. Total annual yellow and silver eel catch across the 47 prefectures significantly decreased from 1,920 t to 229 t during 1981-2011, a reduction rate of between 79.7-88.1% over three generations (Anon. 1958-2011). Catches of yellow and silver stage eels in Okayama for example, have significantly decreased during the period of 1989-2009 and also between 2003-2009, suggesting that the abundance of A. japonica in this water system has not been restored following the closure of the Kojima Bay-Asahi River fisheries, which remains closed today (K. Kaifu unpub. data). Although these data suggest widespread declines across the 47 prefectures of Japan (Anon. 1958-2011), the MAFF data only consider eels in inland waters (i.e., rivers/lakes) and it is estimated that 40-50% of eels in Japan remain in estuarine /saline waters throughout their lives (Kotake et al. 2005, Mochioka et al. 2012). Another study suggested that the proportion of the population which comprise eels living primarily in the marine/estuarine environment was more than 85% of all silver eels (ca. 600 fish) collected in the coastal water around Japan while the eels that grew in the freshwater habitats were only less than 15% (Tsukamoto et al. 2009), suggesting that the eels in this region were was maintained by these eels existing in primarily brackish and marine habitats. The stock status of eels in saline waters, however, is not known and, like many anguillid species, subpopulations are currently only assessed on aspects of their freshwater life histories.

Studies of this species in Taiwan have reported substantial declines in numbers during the last 15-20 years. Han and Tzeng (2006) report an 81-88% female bias in sex ratio of yellow and silver eels caught at one locality, the Kaoping River in south-western Taiwan. Furthermore in the lower reaches of this river population, density was revealed to be as low as 0.01 eels/m² in 2001 and 2002 and the abundance ranged from 7,137 to 31,360 individuals in 2001, and from 3,324 to 22,040 individuals in 2002 (Han and Tzeng 2006). The eels in the Kaoping River were found to be heavily female biased when density was low but males dominated at higher densities.

On consideration of all the available data on its multiple life-history stages, A. japonica is estimated to have suffered at least a 50% decline in mature spawner abundance over a period of three generations (30 years). As such, this species qualifies as Endangered under the IUCN Red List criterion A2bc.


Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats

Threats to this species include overfishing, loss of habitat and changes to oceanic conditions among other threats and as a result the FAO have suggested that Japanese eel stocks are outside safe biological limits and in recent years the fishery has not been sustainable (FAO 2013). These declines have, in the past, driven culture facilities to source glass eels of other species from elsewhere in Asia (e.g. A. bicolor, A. marmorata), Europe (A. anguilla) and America (A. rostrata) (Han et al. 2002).

It is argued that fishing of A. japonica glass eels to stock farming facilities on a national/international scale likely constitutes a major threat to the population. Indeed, the severe decline of Japanese Eel in freshwater habitats in Taiwan may be a result of overfishing of glass eels for farming and degradation of suitable growth habitat. Restocking does occur in Japan and although some studies are beginning to address the issue (Lin et al. 2010) it is still very much unknown what percentage of the yellow and silver eel fisheries data are made up of stocked eels. In 2003, a study was published documenting the first successful captive production of glass eels in Japan from reared larvae and the life cycle was fully closed in 2010 (Masuda et al. 2012). For mass production of eels in Japan to become biologically and economically viable, however, better feed and a simplification and shortening of the rearing process is still required. Although other target species of freshwater eels are now also being used to stock farms, the threat from overfishing persists in many parts of its range because A. japonica remains a premium eel species and the species of choice for consumption in Japan.

Environmental phenomena, such as El Niǹo and sunspots, have been proposed to influence larval transport and survival, and as a consequence impact upon recruitment of glass eels to coastal and freshwater habitats (Kimura et al. 2001, Bonhommeau et al. 2008, Miller et al. 2009, Tzeng et al. 2012). Such environmental factors are proposed to have fluctuating effects on recruitment of glass eels, while exploitation and river habitat modification and degradation have a more consistent effect. However, the role that changing ocean currents play in driving population level changes such as recruitment remains unclear. Additionally, like other eel species, A. japonica is host to the nematode (Anguillicola crassus) that parasitizes the swim bladder which has been proposed to affect survivorship and migration behaviour. Japanese Eels, however, appear to show more evidence of acquired immunity and significantly reduced pathological effects than the European Eel (Knopf 2006) possibly because of longer historical exposure to this parasite (Münderle et al. 2006).

As with other anguillid eels, the upstream and downstream migration of the Japanese Eel has been impacted due to the presence of barriers in waterways. In Japan, construction of dams has reduced eel catches in some areas (Tatsukawa 2003). The reduction rates of yellow and silver eel catches (216 rivers) were significantly positively correlated to the numbers of barriers preventing the upstream migration of fishes, indicating that fragmented rivers lose their carrying capacities for eels (Hakoyama unpub. data). Annual eel (yellow and silver) catch data during 1953 to 2009 were obtained from the database of the Ministry of Agriculture, Forestry and Fisheries (MAFF), Japan and Yoshimura et al. (2005) report that in Japan alone there are 2,675 dams that are higher than 15 m and thus are considered impassable to eels.

Other threats include the loss of river habitat due to agricultural, urban and industrial development, which in Japan has resulted in the extensive revetment of the shorelines of rivers and lakes for flood control purposes (Yoshimura et al. 2005, Itakura et al. 2014). This is now thought to have stabilised in Japan but continues to occur in other parts of this species’ range. Development has also increased the amounts of pollution caused by industrial effluent/agricultural runoff/herbicides/pesticides, all of which are known to negatively impact eel numbers through displacement, reduced reproductive success and direct mortality (e.g. Tzeng et al. 2006).

Given the relative lack of understanding of the threats we have attempted to quantify this using the IUCN ‘Threat Classification Scheme’, however, this is by no means definitive.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Endangered (EN) (A2bc)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions

Although the larval/oceanic phases of A. japonica life histories are by far the most well studied of all the anguillids, there are still significant gaps in our knowledge of this species. Coupled with their broad range and multiple life stages, this makes conservation measures difficult to implement. In 2009 however, the Eel River Project was set up by the East Asia Eel Resource Consortium (EASEC) and was designed to sample and monitor glass eel recruitment year round across a number of key localities in Japan, mainland China and Taiwan. At the time of writing however, the EASEC is still without official support of the Japanese government which limits it power to make changes. Current resources appear to be focused on the aquaculture industry, although some recent studies (e.g. Lin et al. 2010) have begun to address the survival rates and ecology of reared eels back into their natural habitat (i.e. restocking).

In Japan, catch of juvenile eels is prohibited and a special license for catch is issued in order to capture seed for aquaculture or research within a limited fishing period. Illegal fishing still remains a big problem, with catch potentially representing at least double that of the licensed fishery nationally. Since 2013, the capture of silver eel is prohibited or restricted in three of the principal glass eel-fishing prefectures (Miyazaki, Kumamoto and Kagoshima), with the aim of preserving spawning eels in these productive areas. Restocking rivers and lakes with young eels for stock enhancement has also been carried out for many years in Japan and studies on its effectiveness are currently being conducted. However, non-native species have been used (Miyai et al. 2004) and the quality of the restocking material has been suggested as being variable (J. Aoyama and K. Kaifu, 2014 pers. comm.).

In China, the number of licenses is restricted. In Taiwan, closed seasons (1st Mar – 31st Oct) have been imposed on glass eel fishing since 2013 and the capture of eels of TL >8 cm is now prohibited in all major rivers except rivers in Taitung and Hu-Lien prefectures, eastern Taiwan. In these rivers catch is dominated by A. marmorata not A. japonica and restocking of yellow and hormone-stimulated silver eels has been conducted since 1976. Also in Taiwan, year-round, systematic, fisheries independent monitoring occurs at the Yilan River and has been monitoring recruitment since July 2010. At the international level, co-operation among Japan, China and Taiwan was started in 2012 for the conservation of Japanese eel, which is aimed at establishing proper management of eel fisheries as well as introduction of traceability schemes. In summary, there has been a heavy focus to date on fisheries regulation and conservation relating to the many other threats facing A. japonica is essential.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: highly commercial; aquaculture: commercial; price category: unknown; price reliability:
  • FAO 1997 Aquaculture production statistics 1986-1995. FAO Fish. Circ. 815, Rev. 9. 195 p. (Ref. 26920)
  • Food and Agriculture Organization of the United Nations 1992 FAO yearbook 1990. Fishery statistics. Catches and landings. FAO Fish. Ser. (38). FAO Stat. Ser. 70:(105):647 p. (Ref. 4931)
  • Robins, C.R., R.M. Bailey, C.E. Bond, J.R. Brooker, E.A. Lachner, R.N. Lea and W.B. Scott 1991 World fishes important to North Americans. Exclusive of species from the continental waters of the United States and Canada. Am. Fish. Soc. Spec. Publ. (21):243 p. (Ref. 4537)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Japanese eel

The Japanese eel (Anguilla japonica; Japanese: 日本鰻 nihon'unagi[2]) is a species of anguillid eel found in Japan, Korea, China, Taiwan, and Vietnam[3] as well as the northern Philippines. Like all the eels of the genus Anguilla and the family Anguillidae, it is catadromous, meaning it spawns in the sea but lives parts of its life in freshwater. The spawning area of this species is in the North Equatorial Current in the western North Pacific to the west of the Mariana Islands. The larvae are called leptocephali and are carried westward by the North Equatorial Current and then northward by the Kuroshio Current to East Asia where they live in rivers, lakes and estuaries. The Japanese eel is an important food fish in East Asia where it is raised in aquaculture ponds in most countries in the region. In Japan, where they are called unagi, it is an important part of the food culture, with many restaurants serving grilled eel, which is called kabayaki. Eels also have uses in Chinese medicine.

Life history and habitat[edit]

Japanese eel

The Japanese eel and other anguillid eels live in freshwater and estuaries where they feed and grow as yellow eels for a number of years before they begin to mature and become silver eels. The silver eels then migrate out of freshwater into the ocean and start their long journey to their spawning area. Adult Japanese eels migrate thousands of kilometers from freshwater rivers in East Asia to their spawning area without feeding.[4] The spawning area of this species was discovered in 1991 by collecting small leptocephali about 10 mm in size, and then in 2005 the same team of Japanese scientists at the University of Tokyo found a more precise location of spawning based on genetically identified specimens of newly hatched preleptocephali only 2 to 5 days old in a small area near the Suruga Seamount to the west of the Mariana Islands (14–17° N, 142–143° E).[5] In more recent years more preleptocephali have been collected, and even Japanese eel eggs have been collected and genetically identified at sea on the research vessel. The collections of eggs and recently hatched larvae have been made along the western side of the seamount chain of the West Mariana Ridge. Furthermore, mature adults of the Japanese eel and giant mottled eel were captured using large midwater trawls in 2008 by Japanese scientists at the Fisheries Research Agency.[6] The adult eels of the Japanese eel appear to spawn in the upper few hundred meters of the ocean based on the recent catches of their spawning adults, eggs and newly hatched larvae. The timing of catches of eggs and larvae and the ages of larger larvae have shown that Japanese eels only spawn during the few days just before the new moon period of each month of their spawning season.

After being born in the ocean the leptocephali are carried westward by the North Equatorial Current and then northward by the Kuroshio Current to East Asia. In the open ocean, the larvae feed on marine snow, before they metamorphose into the glass eel stage. The glass eels then enter the estuaries and headwaters of rivers and many travel upstream. In freshwater and estuaries the diet of yellow eels consists mainly of shrimp, other crustaceans, aquatic insects and small fishes.[7]

The Japanese eel population, along with anguillid eel populations worldwide, have declined drastically in recent years. This is presumably due to a combination of overfishing and habitat loss or changing water conditions in the ocean interfering with spawning and the transport of their leptocephali. In the case of the Japanese eel, spawning is likely affected by the north-south shifts of a salinity front created by an area of low salinity waters resulting from tropical rainfall. The front is thought to be detected by the adult spawning eels and to affect the latitudes at which they spawn. There appears to have been a northward shift in the front that occurred over the past 30 years, which could cause more larvae to be retained in eddies offshore in the region east of Taiwan, and southward shifts in the salinity front have been observed in recent years that could increase southward transport into the Mindanao Current that flows into the Celebes Sea. These types of unfavorable larval transport are thought to reduce the recruitment success of the Japanese eels that reach river mouths as glass eels.[8]

Commercial fisheries[edit]

Green water culture system for Japanese eel
Total production of Japanese eel in thousands of tonnes as reported by the FAO, 1950–2010[9]

Medical use[edit]

The Japanese freshwater eel is the only vertebrate known to produce a fluorescent protein. This protein is the basis of a new test to assess dangerous blood toxins that can trigger liver disease. [10]

References[edit]

  1. ^ Jacoby, D. & Gollock, M. (2014). "Anguilla japonica". IUCN Red List of Threatened Species. Version 2014.1. International Union for Conservation of Nature. Retrieved 1 July 2014. 
  2. ^ "日本鰻". Local Sensei. Retrieved 27 May 2014. 
  3. ^ Vietnam Faunas, vncreatures.net
  4. ^ Chow, S.; Kurogi, H; Katayama, S; Ambe, D; Okazaki, M; Watanabe, T; Ichikawa, T; Kodama, M; Aoyama, J; Shinoda, A; Watanabe, S; Tsukamoto, K; Miyazaki, S; Kimiura, S; Yamada, Y; Nomura, K; Tanaka, H; Kazeto, Y; Hata, K; Handa, T; Tawa, A; Mochioka, N (2010), "Japanese eel Anguilla japonica do not assimilate nutrition during the oceanic spawning migration: evidence from stable isotope analysis", Marine Ecology Progress Series 402: 233–238, doi:10.3354/meps08448 
  5. ^ Tsukamoto, Katsumi (23 February 2006), "Spawning of eels near a seamount", Nature 439 (7079): 929, doi:10.1038/439929a, PMID 16495988 
  6. ^ Chow, S.; Kurogi, Hiroaki; Mochioka, Noritaka; Kaji, Shunji; Okazaki, Makoto; Tsukamoto, Katsumi (2009), "Discovery of mature freshwater eels in the open ocean", Fisheries Science 75: 257–259, doi:10.1007/s12562-008-0017-5 
  7. ^ Man, S.H.; Hodgkiss, I.J. (1981), Hong Kong freshwater fishes, Hong Kong: Urban Council, Wishing Printing Company, p. 75 
  8. ^ Kimura, S.; Inoue, Takashi; Sugimoto, Takashige (2001), "Fluctuation in the distribution of low-salinity water in the North Equatorial Current and its effect on the larval transport of the Japanese eel", Fisheries Oceanography 10: 51–60, doi:10.1046/j.1365-2419.2001.00159.x 
  9. ^ a b c Based on data sourced from the FishStat database, FAO.
  10. ^ Sandle, Tim (2013) The glowing eel can help assess blood toxins". Digital journal
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!