Overview

Comprehensive Description

Biology

Spawning occurs in the sea; small eels ascend the rivers in schools; develop and grow in freshwater. The species may crawl over land at night from one place to another (Ref. 5258, 11230). Feeds on crustaceans, insects and fish (Ref. 5258). Maximum weight given (1889 g) has a maximum length of 100.8 cm TL in Ref. 82795. Utilized fresh, smoked, canned and frozen; eaten steamed, broiled and baked (Ref. 9988). Used in Chinese medicine (Ref. 12166).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Asia: Japan to the East China Sea, Taiwan, Korea, China and northern Philippines. Spawning grounds of this species are presumed to be in the western Mariana Islands, at a salinity front near 15°N and 140°E (Ref. 54488). Most expensive food fish in Japan. Introduced elsewhere.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eastern Asia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Vertebrae: 114 - 118
  • Smith, D.G. 1999 Anguillidae. Freshwater eels. p. 1630-1636. In K.E. Carpenter and V.H. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the WCP. Vol. 3. Batoid fishes, chimaeras and bony fishes part 1 (Elopidae to Linophrynidae). FAO, Rome. (Ref. 9828)   http://www.fishbase.org/references/FBRefSummary.php?id=9828&speccode=1274 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 1500 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

150 cm TL (male/unsexed; (Ref. 9828)); max. published weight: 1,889 g (Ref. 82795)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Plain-colored.
  • Smith, D.G. 1999 Anguillidae. Freshwater eels. p. 1630-1636. In K.E. Carpenter and V.H. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the WCP. Vol. 3. Batoid fishes, chimaeras and bony fishes part 1 (Elopidae to Linophrynidae). FAO, Rome. (Ref. 9828)   http://www.fishbase.org/references/FBRefSummary.php?id=9828&speccode=1274 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type for Anguilla japonica
Catalog Number: USNM 74118
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration; Radiograph
Collector(s): Y. Manabei
Locality: From a Rapid Near Koyadaira, a Village At the Foot of Mount Tsurugi, Shikoku, Awa, Japan, Shikoku, Tokushima Prefecture, Japan, Asia
  • Type: Jordan, D. S. 1913. Proceedings of the United States National Museum. 44 (1957): 359, pl. 57.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

demersal; catadromous (Ref. 51243); freshwater; brackish; marine; depth range 1 - 400 m (Ref. 6898)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Catadromous. Migrating from freshwater to the sea to spawn, e.g., European eels. Subdivision of diadromous. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Feeds on crustaceans, insects and fish. Spawning occurs in the sea; small eels ascend the rivers in schools; develop and grow in freshwater. The species may crawl over land at night from one place to another.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diseases and Parasites

Herpesviral Gill Filament Necrosis. Viral diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Enteric Septicaemia of Catfish. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Edwardsiellosis. Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Centrocestus Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Aeromonosis. Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Assuming reproductive mode to be the same as that of Anguilla anguilla.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Anguilla japonica

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGGCAATCACCCGTTGATTCTTTTCTACTAATCACAAAGACATTGGTACCCTATATCTAGTATTTGGTGCCTGAGCCGGAATAGTTGGAACCGCACTAAGCCTTCTAATCCGTGCCGAATTAAGTCAACCAGGCGCCCTTCTTGGAGACGACCAAATTTACAATGTCATCGTCACAGCGCATGCCTTTGTAATGATTTTCTTTATAGTAATACCAGTAATAATTGGAGGATTTGGCAACTGGCTCGTGCCGTTAATGATCGGCGCCCCAGACATAGCATTTCCCCGAATAAACAACATAAGCTTCTGACTTTTACCACCATCATTCCTTCTTCTGCTGGCCTCCTCAGGGGTAGAAGCTGGGGCCGGTACAGGTTGAACCGTATATCCTCCTCTAGCTGGAAACTTAGCCCATGCCGGAGCATCTGTTGACCTGACAATCTTTTCACTTCACCTTGCAGGGATTTCATCAATCCTAGGGGCCATTAATTTTATTACTACAATTATTAATATGAAGCCGCCTGCCATTACACAGTACCAAACCCCACTGTTTGTATGAGCTGTTTTAGTTACCGCTGTTCTACTACTTCTATCCCTCCCAGTCCTAGCTGCAGGTATTACAATACTTCTAACTGACCGAAATTTAAATACAACCTTCTTTGACCCTGCAGGGGGTGGAGACCCAATCCTCTACCAACACCTATTCTGATTCTTTGGTCACCCAGAAGTATACATTTTAATCCTACCAGGATTTGGAATAATCTCACACATTGTTGCCTATTATTCCGGTAAGAAAGAACCATTTGGATATATAGGAATAGTTTGAGCAATGATGGCTATCGGACTTCTAGGATTCATTGTATGAGCACACCATATGTTCACAGTAGGAATAGACGTAGACACTCGTGCTTACTTCACTTCCGCCACAATAATCATCGCAATTCCAACCGGAGTAAAAGTATTCAGCTGACTAGCCACATTACACGGAGGGGTCATCAAATGAGAAACCCCACTCCTTTGAGCTTTGGGTTTTATCTTCCTATTTACAGTCGGGGGCTTGACAGGTATCGTACTAGCAAACTCATCAATCGACATTGTATTACATGACACATACTATGTAGTAGCTCATTTCCATTATGTTCTATCTATAGGAGCAGTCTTTGCTATTATAGGAGGCTTTGTGCACTGATTCCCCCTGTTCTCAGGCTATACACTACACAGCACATGAACCAAAGTACACTTTGGAATTATATTCGTAGGAGTAAACCTAACTTTCTTCCCACAACATTTCCTAGGGTTAGCAGGAATACCACGACGTTATTCAGACTACCCAGATGCCTACACCCTGTGAAACACAATCTCCTCTATTGGGTCACTAATTTCTCTCACAGCCGTAATCCTGTTCCTATTTATCCTTTGAGAAGCATTCACTGCTAAACGAGAAGTAAAATGAGTAGAACTCACAGAAACAAATGTTGAATGACTACACGGATGTCCTCCACCATACCACACATTCGAAGAACCAGCGTACGTCCGAGTTCAACCGCCCTCAGAAGATCAAAAATCAGAAGCCAAAGCCCACATTCAAGAAAGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Anguilla japonica

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: highly commercial; aquaculture: commercial; price category: unknown; price reliability:
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Japanese eel

The Japanese eel, Anguilla japonica, is a species of anguillid eel found in Japan, Korea, China, Taiwan, and Vietnam[1] as well as the northern Philippines. Like all the eels of the genus Anguilla and the family Anguillidae, it is catadromous, meaning it spawns in the sea but lives parts of its life in freshwater. The spawning area of this species is in the North Equatorial Current in the western North Pacific to the west of the Mariana Islands. The larvae are called leptocephali and are carried westward by the North Equatorial Current and then northward by the Kuroshio Current to East Asia where they live in rivers, lakes and estuaries. The Japanese eel is an important food fish in East Asia where it is raised in aquaculture ponds in most countries in the region. In Japan, where they are called unagi, it is an important part of the food culture, with many restaurants serving grilled eel, which is called kabayaki. Eels also have uses in Chinese medicine.

Contents

Life history and habitat

The Japanese eel and other anguillid eels live in freshwater and estuaries where they feed and grow as yellow eels for a number of years before they begin to mature and become silver eels. The silver eels then migrate out of freshwater into the ocean and start their long journey to their spawning area. Adult Japanese eels migrate thousands of kilometers from freshwater rivers in East Asia to their spawning area without feeding.[2] The spawning area of this species was discovered in 1991 by collecting small leptocephali about 10 mm in size, and then in 2005 the same team of Japanese scientists at the University of Tokyo found a more precise location of spawning based on genetically identified specimens of newly hatched preleptocephali only 2 to 5 days old in a small area near the Suruga Seamount to the west of the Mariana Islands (14–17° N, 142–143° E).[3] In more recent years more preleptocephali have been collected, and even Japanese eel eggs have been collected and genetically identified at sea on the research vessel. The collections of eggs and recently hatched larvae have been made along the western side of the seamount chain of the West Mariana Ridge. Furthermore, mature adults of the Japanese eel and giant mottled eel were captured using large midwater trawls in 2008 by Japanese scientists at the Fisheries Research Agency.[4] The adult eels of the Japanese eel appear to spawn in the upper few hundred meters of the ocean based on the recent catches of their spawning adults, eggs and newly hatched larvae. The timing of catches of eggs and larvae and the ages of larger larvae have shown that Japanese eels only spawn during the few days just before the new moon period of each month of their spawning season.

After being born in the ocean the leptocephali are carried westward by the North Equatorial Current and then northward by the Kuroshio Current to East Asia. In the open ocean, the larvae feed on marine snow, before they metamorphose into the glass eel stage. The glass eels then enter the estuaries and headwaters of rivers and many travel upstream. In freshwater and estuaries the diet of yellow eels consists mainly of shrimp, other crustaceans, aquatic insects and small fishes.[5]

The Japanese eel population, along with anguillid eel populations worldwide, have declined drastically in recent years. This is presumably due to a combination of overfishing and habitat loss or changing water conditions in the ocean interfering with spawning and the transport of their leptocephali. In the case of the Japanese eel, spawning is likely affected by the north-south shifts of a salinity front created by an area of low salinity waters resulting from tropical rainfall. The front is thought to be detected by the adult spawning eels and to affect the latitudes at which they spawn. There appears to have been a northward shift in the front that occurred over the past 30 years, which could cause more larvae to be retained in eddies offshore in the region east of Taiwan, and southward shifts in the salinity front have been observed in recent years that could increase southward transport into the Mindanao Current that flows into the Celebes Sea. These types of unfavorable larval transport are thought to reduce the recruitment success of the Japanese eels that reach river mouths as glass eels.[6]

Commercial fisheries

Total production of Japanese eel in thousands of tonnes as reported by the FAO, 1950–2010[7]

Sustainable consumption

In 2010, Greenpeace International has added the Japanese eel to its seafood red list. "The Greenpeace International seafood red list is a list of fish that are commonly sold in supermarkets around the world, and which have a very high risk of being sourced from unsustainable fisheries."[8]

References

  1. ^ Vietnam Faunas,
  2. ^ Chow, S.; Kurogi, H; Katayama, S; Ambe, D; Okazaki, M; Watanabe, T; Ichikawa, T; Kodama, M et al. (2010), "Japanese eel Anguilla japonica do not assimilate nutrition during the oceanic spawning migration: evidence from stable isotope analysis", Marine Ecology Progress Series 402: 233–238, doi:10.3354/meps08448
  3. ^ Tsukamoto, Katsumi (23 February 2006), "Spawning of eels near a seamount", Nature 439 (7079): 929, doi:10.1038/439929a, PMID 16495988
  4. ^ Chow, S.; Kurogi, Hiroaki; Mochioka, Noritaka; Kaji, Shunji; Okazaki, Makoto; Tsukamoto, Katsumi (2009), "Discovery of mature freshwater eels in the open ocean", Fisheries Science 75: 257–259, doi:10.1007/s12562-008-0017-5
  5. ^ Man, S.H.; Hodgkiss, I.J. (1981), Hong Kong freshwater fishes, Hong Kong: Urban Council, Wishing Printing Company, p. 75
  6. ^ Kimura, S.; Inoue, Takashi; Sugimoto, Takashige (2001), "Fluctuation in the distribution of low-salinity water in the North Equatorial Current and its effect on the larval transport of the Japanese eel", Fisheries Oceanography 10: 51–60, doi:10.1046/j.1365-2419.2001.00159.x
  7. ^ a b c Based on data sourced from the FishStat database, FAO.
  8. ^ Greenpeace International Seafood Red list
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!