Articles on this page are available in 2 other languages: Spanish (2), Dutch (1) (learn more)

Overview

Brief Summary

Spurdogs are regularly caught by fishermen in the North Sea. In October 2008, the fishing vessel TX68 caught many spurdogs in its net in just one fishing attempt. The crew filled more than 60 crates just with this shark. This shark is named after the characteristic spines, or spurs, on the front of its dorsal fins, which are defense weapons. This creates a problem for fishermen when trying to remove them from their nets. Otherwise, spurdogs are harmless.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Said to be the most abundant living shark, the spiny dogfish is a slow, inactive swimmer and forms massive feeding aggregations of thousands of individuals. Tending to be same-sex and same-size shoals, they prey on shoals of bony fish, as well as octopuses, smaller sharks, squid, crabs and shark egg cases (3). They are highly migratory, moving towards the equatorial side of their range during winter (2). With estimates of between 20 years and 75 years, the spiny dogfish is thought to be a very long-lived fish that matures late and reproduces slowly, with gestation lasting two years – the longest of any vertebrate (1) (2) (3). An ovoviviparous species, spiny dogfish develop in eggs within the female, and gain nourishment from their yolk sacs, After four to six months, these eggs are shed, but the embryos continue to develop inside the female, still living off the yolk sac attached to their abdomens. Finally, after another 18 to 20 months of development, six to seven live young are born, measuring 20 to 33 centimetres. Despite possessing venom-delivering spines on each of its two dorsal fins, the spiny dogfish is eaten by cod, red hake, goosefish, other spiny dogfish, larger sharks, seals, and orcas (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The common name 'dogfish' was given by fisherman to small sharks due to their habit of hunting shoals of fish in 'packs' (3). The spiny dogfish is a small, slim fish with a narrow, pointed snout and distinctive white spots (4). The back is slate grey to brown and the belly is pale grey to white. It has two dorsal fins, the first of which is smaller (3). They both have a spine which can inject venom causing strong pain lasting for several hours, and very occasionally death in humans (4). The pectoral fins are curved and have rounded tips (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Biology

Possibly the most abundant living shark (Ref. 247). An inshore and offshore dogfish of the continental and insular shelf and upper slopes (Ref. 247, 11230). Usually near the bottom, but also in midwater and at the surface (Ref. 26346); occurs mainly between 10-200 m depth (Ref. 247). Males and gravid females usually found shallower than non-gravid females. Tolerates brackish water, often found in enclosed bays and estuaries. Reported to enter freshwater (Ref. 11980) but cannot survive there for more than a few hours (Ref. 247). Highly migratory species, used to be observed in large foraging schools with up to thousands of individuals, usually segregated by size and /or sex, with schools of large gravid females preferentially targeted by fisheries. Their latitudinal (north-south) and depth-related (nearshore-offshore) movements appear to be correlated with their preferred temperature (Ref. 247). Tagging experiments showed that populations in the northern North Sea and northwest Scotland made winter migrations to off Norway and summer migrations to Scotland (Ref. 88880, 88881). Transoceanic migrations recorded, but rare (Ref. 88864). Longevity in the northern Atlantic is about 35-50 years (Ref. 88882), but most live only 20-24 years (Ref. 88187). Growth is slow. At sexual maturity, males are 60-70 cm long, females 75-90 cm (Ref. 35388). Gestation period is 2 years (Ref. 36731). Ovoviviparous (Ref. 205). Feeds on a diversity of prey, ranging from comb jellyfish, squid, mackarel and herring to a wide array of benthic fishes, shrimps, crabs and even sea cucumbers (Ref. 93252). The only species of horned sharks that can inflict toxins with its tail. Detects weak electric fields generated by potential prey (Ref. 10311). Utilized for human consumption, liver oil, vitamins, sand paper, leather, fertilizer, etc. (Ref. 247, 27436). Eaten fried, broiled, and baked (Ref. 9988).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

  Common names: dogfish (English), mielga (Espanol)
 
Squalus acanthias Smith & Radcliffe, 1912

Pike dogfish


A slender cylindrical body; snout narrow, moderately long, pointed; eyes about midway between snout tip and gill slits; 5 gill slits; moderate sized spiracles just behind eyes; nasal flaps short, slender, not reaching mouth, with a minute or no secondary lobe, inner corners of nostrils closer to snout tip than to mouth; eyes without nictitating membrane; teeth low and blade-like, similar sized on both jaws, with strongly oblique tips; 2 dorsal fins with ungrooved spines (shorter spine on first dorsal), 2nd  smaller than first; origin of the first behind pectorals; pectoral fin narrow, sickle-shaped, posterior margin slightly concave, inner posterior tip slightly rounded; no anal fin; tail base with a pair of keels and a strong pit above; tip of tail fin without a notch on underside, rear of tail with angular notch separating two lobes; skin with small, 3 pointed denticles.

Color: grey above, white below; usually conspicuous white spots or bars on sides; dorsal fin edges dusky in juveniles, plain in adults.

Reaches 160cm

Intertidal to 1460m; from the surface to the bottom, usually near the bottom; often in bays and estuaries.

Antitropical; Pacific, Atlantic and Mediterranean, also SW Indian Ocean. From Alaska to the tip of Baja; also in Chile
   
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Squalus acanthias ZBK Linnaeus, 1758

Sea of Marmara : 1300-670 (2 spc.), 13.07.1995 , Offshore of Muerefte , trawl , 78 m, L. Eryilmaz ; 1300-671 (3 spc.), 14.07.1995 , Offshore of Karabiga-Karaburun , trawl , 65 m, L. Eryilmaz . Istanbul Fish Market : 1300-18 (6 spc.), 31.01.1971 .

  • Nurettin Meriç, Lütfiye Eryilmaz, Müfit Özulug (2007): A catalogue of the fishes held in the Istanbul University, Science Faculty, Hydrobiology Museum. Zootaxa 1472, 29-54: 32-32, URL:http://www.zoobank.org/urn:lsid:zoobank.org:pub:428F3980-C1B8-45FF-812E-0F4847AF6786
Public Domain

MagnoliaPress via Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Possibly the most abundant living shark (Ref. 247). An inshore and offshore dogfish of the continental and insular shelf and upper slopes (Ref. 247, 11230). Usually near the bottom, but also in midwater and at the surface (Ref. 26346); occurs mainly between 10-200 m depth (Ref. 247). Males and gravid females usually found shallower than non-gravid females. Tolerates brackish water, often found in enclosed bays and estuaries. Reported to enter freshwater (Ref. 11980) but cannot survive there for more than a few hours (Ref. 247). Highly migratory species, used to be observed in large foraging schools with up to thousands of individuals, usually segregated by size and /or sex, with schools of large gravid females preferentially targeted by fisheries. Their latitudinal (north-south) and depth-related (nearshore-offshore) movements appear to be correlated with their preferred temperature (Ref. 247). Tagging experiments showed that populations in the northern North Sea and northwest Scotland made winter migrations to off Norway and summer migrations to Scotland (Ref. 88880, 88881). Transoceanic migrations recorded, but rare (Ref. 88864). Longevity in the northern Atlantic is about 35-50 years (Ref. 88882), but most live only 20-24 years (Ref. 88187). Growth is slow. At sexual maturity, males are 60-70 cm long, females 75-90 cm (Ref. 35388). Gestation period is 2 years (Ref. 36731). Ovoviviparous (Ref. 205). The only species of horned sharks that can inflict toxins with its tail. Detects weak electric fields generated by potential prey (Ref. 10311). Utilized for human consumption, liver oil, vitamins, sand paper, leather, fertilizer, etc. (Ref. 247, 27436). Eaten fried, broiled, and baked (Ref. 9988).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

 The spiny dogfish or spurdog Squalus acanthias is a small member of the dogfish family reaching up to 1.6 m in length. It has a grey to brown dorsal colouring and a much paler belly. It can easily be distinguished from similar species by conspicuous white spots covering the entire body. It has two dorsal fins each with large spines. The caudal fin outline is smooth.One of the most abundant shark species in the world, Squalus acanthias is a well studied species and has been the subject of many studies focusing on heavy metal pollution and sensitivity to pollution studies (McMillan & Morse, 1999).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Depth

Depth Range (m): 1 (S) - 1460 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific 
 
Global Endemism: All species, TEP non-endemic, Circumtropical ( Indian + Pacific + Atlantic Oceans)

Regional Endemism: All species, Eastern Pacific non-endemic, Tropical Eastern Pacific (TEP) non-endemic, Temperate Eastern Pacific, primarily, California province, primarily, Continent, Continent only

Residency: Vagrant

Climate Zone: North Temperate (Californian Province &/or Northern Gulf of California), Northern Subtropical (Cortez Province + Sinaloan Gap)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Greenland to Argentina
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The spiny dogfish inhabits the temperate and subarctic latitudes of the North Atlantic and North Pacific oceans. Specimens have been found in the Black and Mediterranean seas.

Biogeographic Regions: arctic ocean (Native ); atlantic ocean (Native ); pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic: Greenland to Argentina; Eastern Atlantic: Iceland and and the Barents Sea to Western Sahara and the Canary Islands; Angola to South Africa. Indo-Pacific; the Mediterranean and Black Seas (Ref. 247) Reports from off New Guinea are doubtful (Ref. 6871). All records from North Pacific refer to Squalus suckleyi (Girard, 1855) (Ref. 85328). Appendix II (northern hemisphere populations) of the Bonn Convention (2009).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cosmoplitan, antritropical (including Mediterranean Sea, Black Sea, Baltic Sea, North Sea).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Both sides of the North Atlantic, chiefly in the temperate and subarctic belt. Found on both sides of the northern Pacific; represented in the corresponding thermal belt of the southern hemisphere by a close relative of questionable difference to the spiny-dog of the north.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Distributed along coastlines, the spiny dogfish is found in the western Atlantic, eastern Atlantic, western Pacific and eastern Pacific, as well as the Mediterranean Sea and the Black Sea (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Size

Length max (cm): 160.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The spiny dogfish can be recognized by its two dorsal fins, each with a spine; second dorsal is smaller than the first. Pectoral fins posses curved margins and rounded free rear tips. These sharks have narrow anterior nasal flaps. The teeth are oblique and smooth with a notch on the outer margin. Color is slate grey to brown above (often with scattered small white spots) and light grey to pure white on the belly. An albino was reported in Norwegian waters.

Range mass: 3.1 to 9.1 kg.

Other Physical Features: bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Dorsal spines (total): 2; Dorsal soft rays (total): 0; Analspines: 0; Analsoft rays: 0
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Max. size

160 cm TL (male/unsexed; (Ref. 247)); max. published weight: 9,100 g (Ref. 11389); max. reported age: 75 years (Ref. 39247)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum size: 1600 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

to 160 cm TL; 120 cm TL (female); max. weight: 9,100 g.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

This moderately sized species is distinguished by the following set of characters: very slender body, abdomen width 7.2-9.2% TL; narrow head, width at mouth 7.9-10.2% TL; mouth width 1.7-2.2 times its horizontal prenarial length; moderately long snout, preoral length 2.2-2.5 times horizontal prenarial length, 8.5-9.8% TL; single-lobed anterior nasal flap; small dorsal fins, raked, first dorsal-fin height 1.1-1.3 times its inner margin length, second dorsal-fin height 0.7-0.9 times its inner margin length; origin of first dorsal-fin located just posterior to pectoral-fin free rear tips; exposed bases of dorsal-fin spines relatively narrow, 0.4-0.7% TL; short spine of first dorsal fin, exposed length 1.7-2.7% TL; pectoral-fin anterior margin 1.9-3.1 times its inner margin length; preventral caudal margin 1.9-2.6 times inner margin of pelvic fin; pale caudal fin with poorly demarcated, whitish margin, blackish caudal blotch at the apex of upper lobe, anterior margins of both lobes whitish in juveniles; dark caudal bar absent; dorsal and lateral surfaces of body bluish grey with an irregular array of moderately-large white spots; whitish ventrally; flank denticles tricuspid; monospondylous centra 41-45, precaudal centra 74-79, total centra 100-105 (Ref. 58446).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 57072 specimens in 1 taxon.
Water temperature and chemistry ranges based on 37837 samples.

Environmental ranges
  Depth range (m): -9 - 1446.5
  Temperature range (°C): -1.960 - 24.665
  Nitrate (umol/L): 0.325 - 40.485
  Salinity (PPS): 30.218 - 38.642
  Oxygen (ml/l): 0.435 - 7.862
  Phosphate (umol/l): 0.099 - 3.118
  Silicate (umol/l): 0.000 - 78.143

Graphical representation

Depth range (m): -9 - 1446.5

Temperature range (°C): -1.960 - 24.665

Nitrate (umol/L): 0.325 - 40.485

Salinity (PPS): 30.218 - 38.642

Oxygen (ml/l): 0.435 - 7.862

Phosphate (umol/l): 0.099 - 3.118

Silicate (umol/l): 0.000 - 78.143
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Salinity: Marine, Brackish

Inshore/Offshore: Offshore, In & Offshore, Inshore

Water Column Position: Surface, Mid Water, Near Bottom, Bottom, Bottom + water column

Habitat: Soft bottom (mud, sand,gravel, beach, estuary & mangrove), Mud, Sand & gravel, Water column

FishBase Habitat: Bentho-Pelagic
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known from seamounts and knolls
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

nektonic
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Frequents coastal and inshore waters, found at temperatures of 6-15 C.
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Spiny dogfish exist in an oceanic environment of depths from the surface to 400 fathoms or more. They prefer a temperature range of 6-11 degrees centregade.

Aquatic Biomes: benthic ; coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

benthopelagic; oceanodromous (Ref. 51243); brackish; marine; depth range 0 - 1460 m (Ref. 26346), usually 50 - 300 m (Ref. 43939)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 57072 specimens in 1 taxon.
Water temperature and chemistry ranges based on 37837 samples.

Environmental ranges
  Depth range (m): -9 - 1446.5
  Temperature range (°C): -1.960 - 24.665
  Nitrate (umol/L): 0.325 - 40.485
  Salinity (PPS): 30.218 - 38.642
  Oxygen (ml/l): 0.435 - 7.862
  Phosphate (umol/l): 0.099 - 3.118
  Silicate (umol/l): 0.000 - 78.143

Graphical representation

Depth range (m): -9 - 1446.5

Temperature range (°C): -1.960 - 24.665

Nitrate (umol/L): 0.325 - 40.485

Salinity (PPS): 30.218 - 38.642

Oxygen (ml/l): 0.435 - 7.862

Phosphate (umol/l): 0.099 - 3.118

Silicate (umol/l): 0.000 - 78.143
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

 The spiny dogfish is a benthopelagic species occuring both inshore and offshore of the upper continental shelf. Tolerant of a wide range of salinities.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 1460m.
Recorded at 1460 meters.

Habitat: benthopelagic. Possibly the most abundant living shark. An inshore and offshore dogfish of the continental and insular shelf and upper slopes. Usually near the bottom but also found at the surface. Often found in enclosed bays and estuaries. Reported to enter freshwater (Ref. 11980) but cannot survive there for more than a few hours (Ref. 247). Ovoviviparous with 1-20 in a litter. Size at birth about 22 cm (Ref. 6871). Forms schools segregated by size and sex. Feeds on a wide variety of fishes and invertebrates. The only species of horned sharks that can inflict toxins with its tail. Utilized for human consumption, for liver oil, leather, fertilizer, etc. Eaten fried, broiled, and baked (Ref. 9988).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Benthopelagic; brackish; marine. Depth range: 0-1460 m. An inshore and offshore dogfish of the continental and insular shelf and upper slopes. Usually near the bottom, but also in midwater and at the surface. Often found in enclosed bays and estuaries. Reported to enter freshwater but cannot survive there for more than a few hours. Schools mainly segregated by size and sex; mixed schools also reported.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Found from the surface to a depth of 900 metres, the spiny dogfish is thought to tolerate in temperatures of between 7 and 15 degrees Celsius.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Feeding

Feeding Group: Carnivore

Diet: mobile benthic crustacea (shrimps/crabs), mobile benthic gastropods/bivalves, octopus/squid/cuttlefish, Pelagic crustacea, bony fishes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Spiny dogfish prey on bony fishes, smaller sharks, octopuses, squid, crabs, and eggcases of sharks and chimaeras.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Common in cold waters; usually at temperatures of 6-15°C (Ref. 5951); inhabits rocky regions (Ref. 9137). A carnivore (Ref. 9137) and opportunist feeder (Ref. 43115). Feeds on fishes (mackerel, sand lance, silver hake, white hake, haddock, pollock, Atlantic salmon, menhaden, winter flounder and longhorn sculpin), cephalopods (e.g. squids), amphipods, crabs, shrimps, molluscs, ctenophores, echinoderms (e.g. sea cucumber), polychaete worms, sea anemones, jellyfish, and red, green and brown algae; herring, capelin and cod found to be important foods (Ref. 5951, 28070). Smaller individuals (
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Feeds primarily on bony fishes, also mollusks, crustaceans and other invertebrates.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Known predators

Squalus acanthias (Spiny Dogfish) is prey of:
Squalus acanthias
Lophius americanus
Pomatomus saltatrix
Scombridae
Chondrichthyes
Homo sapiens

Based on studies in:
USA, Northeastern US contintental shelf (Coastal)

This list may not be complete but is based on published studies.
  • Link J (2002) Does food web theory work for marine ecosystems? Mar Ecol Prog Ser 230:1–9
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Squalus acanthias (Spiny Dogfish) preys on:
Ctenophora
Cnidaria
Crangon
Mysidae
Pandalidae
Decapoda
Gammaridae
Hyperiidae
Caprellidae
Isopoda
Cumacea
Stomatopoda
Porifera
Cancer
Brachyura
Hydrozoa
Polychaeta
Holothuroidea
Ostreoida
Bivalvia
Ammodytes marinus
Clupea harengus
Alosa pseudoharengus
Scomber
Peprilus triacanthus
Actinonaias ellipsiformis
Tridonta arctica
Pollachius pollachius
Merluccius bilinearis
Urophycis regia
Urophycis tenuis
Urophycis chuss
Gadidae
Melanogrammus aeglefinus
Myoxocephalus octodecemspinosus
Leucoraja erinacea
Leucoraja ocellata
Amblyraja radiata
Macrozoarces americanus
Brosme brosme
Anarhichas
Triglidae
Pleuronectes ferrugineus
Scophthalmus aquosus
Paralichthys dentatus
Glyptocephalus cynoglossus
Hippoglossina oblonga
Pleuronectes americanus
Hippoglossoides platessoides
Hippoglossus hippoglossus
Mustelus canis
Squalus acanthias
Pomatomus saltatrix

Based on studies in:
USA, Northeastern US contintental shelf (Coastal)

This list may not be complete but is based on published studies.
  • Link J (2002) Does food web theory work for marine ecosystems? Mar Ecol Prog Ser 230:1–9
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Diet

Opportunistic feeder, but primarily small fishes such as herrring, capelin and cod
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Ovoviviparous, with litters of 1 to 21 young (Ref. 247, 88865). Mating probably occurs in winter. Gestation period of 18 to 24 months, longest known of all chondrichthyans (Ref. 26346). Size at birth 18-30 cm (Ref. 26346). In the northeast Atlantic, pups are born in winter, with size at birth about 26-28 cm (Ref. 88864). Sex ratio at birth is 1:1. Gravid females congregate in enclosed shallow bays to give birth (Ref. 247). The mother shark experiences a series of rhythmic contractions, just like in mammals, and the young are delivered head first. Larger older females have bigger litters with larger pups; a female with 100 cm TL carries on average 4 times as many embryos compared to a 70 cm female and the former have higher survival rates than those born to small females (Ref. 4856, 88869, 88883).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Average lifespan

Status: wild:
60.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 75 years (wild) Observations: These animals take about 20 years to reach sexual maturity and are extremely long-lived (Das 1994). Although their exact longevity is unknown, some estimates indicate these animals can live up to 50-75 years (Cailliet et al. 2001).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Egg Type: Live birth, No pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

This shark is ovoviviparous. Males reach maturity between 80-100cm in length or at around 11 years of age; females mature at100-124 cm or in 18-21 years. Mating takes place during the winter months. As soon as the eggs are fertilized, the female secretes a thin, horny, transparent shell around them. The shells suround several eggs at once and are called candles. Gestation lasts between 22-24 months. Litters range between 2-11 pups and are between 20-30 cm at birth. They live for as long as 25-30 years.

Average age at sexual or reproductive maturity (male)

Sex: male:
3163 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
7668 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

These sharks are long-lived and mature late. Ovoviviparous, with litters of 1 to 20 young. Gestation period of 18 to 24 months, longest known of all chondrichthyans. Size at birth 18-30 cm. Sex ratio at birth is 1:1. Mating may occur in winter.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Chemical protects against viral infections: dogfish shark
 

Chemical compound, squalamine, in dogfish shark protects against viral infections by disrupting the membrane interactions needed for viral replication.

   
  Dogfish sharks have powerful natural immunity to viral infections. "Antiviral compounds that increase the resistance of host tissues represent an attractive class of therapeutic. Here, we show that squalamine, a compound previously isolated from the tissues of the dogfish shark (Squalus acanthias) and the sea lamprey (Petromyzon marinus), exhibits broad-spectrum antiviral activity against human pathogens, which were studied in vitro as well as in vivo. Both RNA- and DNA-enveloped viruses are shown to be susceptible. The proposed mechanism involves the capacity of squalamine, a cationic amphipathic sterol, to neutralize the negative electrostatic surface charge of intracellular membranes in a way that renders the cell less effective in supporting viral replication. Because squalamine can be readily synthesized and has a known safety profile in man, we believe its potential as a broad-spectrum human antiviral agent should be explored." (Zasloff et al. 2011: 15978)
  Learn more about this functional adaptation.
  • Zasloff M; Adams AP; Beckerman B; Ann Campbell A; Han Z; Luijten E; Meza I; Julander J; Mishra A; Qu W; Taylor JM; Weaver SC; Wong GCL. 2011. Squalamine as a broad-spectrum systemic antiviral agent with therapeutic potential. PNAS. 108(38): 15978-15983.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Functional adaptation

Tail creates double jets: shark
 

Tail of a shark creates double jets by actively changing the tail's rigidity in mid swing.

   
  "Understanding how moving organisms generate locomotor forces is fundamental to the analysis of aerodynamic and hydrodynamic flow patterns that are generated during body and appendage oscillation...The hydrodynamic wake consists of one set of dual-linked vortex rings produced per half tail beat. In addition, we use a simple passive shark-tail model under robotic control to show that the three-dimensional wake flows of the robotic tail differ from the active tail motion of a live shark, suggesting that active control of kinematics and tail stiffness plays a substantial role in the production of wake vortical patterns." (Flammang et al. 2011: 3670)

"As the tail crosses the midline, the radialis muscles within the tail are actively stiffening the tail against this increased hydrodynamic loading. And it is precisely at this time of maximum expected stiffness and greatest drag that the first vortex is produced (figure 3), resulting in a jet with strong lift and thrust components (table 2). The remaining vorticity is shed as the tail is cupped slightly and continues laterally until it changes direction at maximum lateral excursion" (Flammang et al. 2011: 3674)

Watch Video


  Learn more about this functional adaptation.
  • Flammang BE; Lauder GV; Troolin DR; Tyson Strand T. 2011. Volumetric imaging of shark tail hydrodynamics reveals a three-dimensional dual-ring vortex wake structure. Proc. R. Soc. B. 278: 3670–3678.
  • Pennisi E. 2011. How sharks go fast. ScienceNOW [Internet],
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Squalus acanthias

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 61 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGGCAATTAACCGTTGATTCTTTTCTACAAATCACAAAGATATCGGCACCCTTTATTTAATCTTTGGTGCATGAGCAGGAATAGTAGGTACCGCCCTTAGCTTACTTATTCGCGCAGAATTAAGCCAACCCGGAACACTTCTGGGAGATGATCAAATCTATAATGTTATCGTGACTGCTCACGCTTTTGTAATAATCTTTTTTATAGTTATGCCTGTAATAATTGGTGGATTCGGAAACTGATTGGTGCCCTTAATAATCGGCGCACCAGATATGGCTTTTCCACGAATAAATAATATAAGCTTTTGACTATTACCCCCCTCCCTCCTATTACTTTTAGCCTCAGCTGGTGTTGAGGCAGGAGCCGGAACCGGCTGAACAGTCTACCCCCCTCTCGCAGGTAACATAGCCCATGCTGGCGCATCTGTAGATCTAGCCATCTTCTCACTCCATTTAGCTGGTATTTCCTCAATTTTAGCCTCTATTAATTTTATCACAACTATTATTAACATAAAACCACCTGCCATTTCTCAGTATCAAACACCACTCTTTGTTTGATCCATTCTTGTAACCACCATTCTTCTTCTTCTTTCTCTTCCTGTTCTCGCAGCCGCAATTACGATACTATTAACTGACCGTAATTTAAACACAACATTTTTTGACCCTGCCGGAGGGGGAGACCCAATTCTTTACCAACATTTATTTTGATTCTTCGGCCACCCAGAAGTTTATATTTTAATTTTACCCGGTTTCGGAATAATTTCCCATGTAGTAGCCTATTATTCAGGTAAAAAAGAACCTTTTGGTTATATGGGTATAGTTTGAGCAATAATAGCAATTGGCCTGCTCGGCTTTATTGTATGGGCTCATCACATATTTACAGTAGGAATAGACGTTGATACCCGAGCCTATTTCACCTCAGCAACAATAATTATTGCTATCCCAACAGGTGTAAAAGTCTTCAGCTGACTGGCAACCCTTCACGGGGGCTCCATTAAATGAGAAACACCTCTCCTCTGAGCCCTAGGTTTTATTTTCTTATTCACGGTGGGGGGCCTAACAGGAATTGTTTTAGCTAACTCTTCTCTAGACATCGTTCTTCACGATACTTATTATGTAGTAGCCCACTTCCACTATGTATTATCAATAGGAGCCGTATTTGCAATTATAGCTGGTTTTATTCATTGATTCCCACTATTTTCAGGGTACACCCTCCACTCTACTTGAACAAAAACTCAATTCCTAGTAATATTTATTGGAGTCAACTTAACCTTCTTCCCTCAACATTTTCTGGGCCTAGCTGGCATGCCACGACGATATTCTGACTACCCAGACGCATACGCCCTTTGAAATACAGTTTCCTCAATCGGCTCACTAATCTCCTTAGTTGCTGTAATTATGTTTTTATTTATTATTTGAGAAGCATTTGCGCCAAGCGGGAAGGTTCTATCCGTTGAACTACCCCACACAAATGTAGAATGACTCCATGGTTGCCCTCCACCATATCACACCTATGAAGAACCAGCATTTGTTCAAGTTCAACGAACTTATTTTTAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Squalus acanthias

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 55
Specimens with Barcodes: 249
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 6 specimens with morphological vouchers housed at Queensland Museum
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 1 specimen with morphological vouchers housed at Bermuda Aquarium, Museum and Zoo
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List: Listed, Vulnerable

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

No special status.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N3 - Vulnerable

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Vulnerable (VU) on the IUCN Red List.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Vulnerable (VU) (A2bd+3bd+4bd)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The spiny dogfish is considered to be the most abundant living shark, yet two particular subpopulations in the northwest and northeast Atlantic Ocean are considered to be at risk due to massive fishing pressure. This shark is caught for food, liver oil, and used to make sand paper, vitamins, leather, fertiliser, pet food and fish meal (1) (4). At a time of peak abundance between 1900 and 1910, it is estimated that up to 27 million spiny dogfish were caught off the Massachusetts coast every year (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation

These sharks are especially vulnerable to over-fishing as they are slow to mature, have a very long gestation period, and produce very few young. Demand for these fish is highest in Europe, but they were commonly caught in American waters for export to Europe. The American National Marine Fisheries Services closed American waters to dogfish fishing in July 2003 on evidence that the population was on the edge of collapse (2). WWF have created a suggested recovery plan that aims to reduce exploitation to very low rates to allow recovery, and to reduce by-catch by avoiding areas with spiny dogfish. Monitoring and research on the spatial and seasonal patterns of distribution are also planned (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

This fish causes tremendous damage when packs of them become entangled in commercial fishing nets.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

This species is used for its oil and as fish meal. It is also a popular labratory animal. In some areas (Europe more than the U.S.), it is a popular food fish.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Importance

fisheries: commercial; gamefish: yes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Spiny dogfish

The spiny dogfish, spurdog, mud shark, or piked dogfish, Squalus acanthias, is one of the best known species of the Squalidae (dogfish) family of sharks, which is part of the Squaliformes order. While these common names may apply to several species, Squalus acanthias is distinguished by having two spines (one anterior to each dorsal fin) and lacks an anal fin. It is found mostly in shallow waters and further offshore in most parts of the world, especially in temperate waters.

Morphology and behavior[edit]

Close-up of the head.

The spiny dogfish has dorsal spines, no anal fin, and white spots along its back. The caudal fin has asymmetrical lobes, forming a heterocercal tail. The species name acanthias refers to the shark's two spines. These are used defensively. If captured, the shark can arch its back to pierce its captor. Glands at the base of the spines secrete a mild poison.

Males mature at around 11 years of age, growing to 80–100 cm (2.6–3.3 ft) in length; females mature in 18–21 years and are slightly larger than males, reaching 98.5–159 cm (3.23–5.22 ft).[2] Both sexes are greyish brown in color and are countershaded. Males are identified by a pair of pelvic fins modified as sperm-transfer organs, or "claspers". The male inserts one clasper into the female cloaca during copulation.

Reproduction is aplacental viviparous, which was before called ovoviviparity. Fertilization is internal. The male inserts one clasper into the female oviduct orifice and injects sperm along a groove on the clasper's dorsal section. Immediately following fertilization, the eggs are surrounded by thin shells called "candles" with one candle usually surrounding several eggs. Mating takes place in the winter months with gestation lasting 22–24 months. Litters range between 2 and 11 but average 6 or 7.

Spiny dogfish are bottom-dwellers They are commonly found at depths of around 50-149m, but have been found deeper than 700m.[3]

Life span is estimated to be more than 100 years and their gestation period is 18 to 24 months, which may be the longest of any known animal.[4]

Commercial use[edit]

Spiny dogfish are fished for food in Europe, the United States, Canada, New Zealand and Chile. The meat is primarily consumed in England, France, the Benelux countries and Germany. The fins and tails are processed into fin needles and are used in less expensive versions of shark fin soup in Chinese cuisine. In England this and other dogfish are sold in fish and chip shops as "rock salmon" or "huss", in France it is sold as "small salmon" (saumonette) and in Belgium and Germany it is sold as "sea eel" (zeepaling and Seeaal, respectively). It is also used as fertilizer, liver oil, and pet food, and, because of its availability, cartilaginous skull, and manageable size, as a popular vertebrate dissection specimen, in both high schools and universities. Reported catches in 2000–2009 varied between 13,800 (2008) and 31,700 (2000) tonnes.[5]

Bottom trawlers and sink gillnets are the primary equipment used to harvest spiny dogfish. In Mid-Atlantic and Southern New England fisheries, they are often caught when harvesting larger groundfish, classified as bycatch, and discarded. Recreational fishing accounts for an insignificant portion of the spiny dogfish harvest.[6]

Conservation status and management[edit]

A large catch of spiny dogfish

Once the most abundant shark species in the world, populations of Squalus acanthias have declined significantly. They are classified in the IUCN Red List of threatened species as Vulnerable globally and Critically endangered in the Northeast Atlantic, meaning stocks around Europe have decreased by at least 95%. This is a direct result of overfishing to supply northern Europe's taste for rock salmon, saumonette or zeepaling. Despite these alarming figures, very few management or conservation measures are in place for Squalus acanthias.[1] In EU waters, a Total Allowable Catch (TAC) has been in place since 1999, but until 2007 it only applied to ICES Areas IIa and IV. It was also set well above the actual weight of fish being caught until 2005, rendering it meaningless. Since 2009 a maximum landing size of 100 cm has been imposed in order to protect the most valuable mature females. The TAC for 2011 was set at 0t, ending targeted fishing for the species in EU waters. It remains to be seen if populations will be able to recover.[7]

In the recent past the European market for spiny dogfish has increased dramatically, which led to the overfishing and decline of the species. This drastic increase led to the creation and implementation of many fishery management policies placing restrictions on the fishing of spiny dogfish. However, since the species is a late maturing fish, it takes a while to rebuild the population.

In 2010, Greenpeace International added the spiny dogfish to its seafood red list. "The Greenpeace International seafood red list is a list of fish that are commonly sold in supermarkets around the world, and which have a very high risk of being sourced from unsustainable fisheries."[8] In the same year, the Convention on Migratory Species (CMS; also known as the Bonn Convention) listed the species (Northern Hemisphere populations) under Annex I of its Migratory Shark Memorandum of Understanding.[9]

In recent years however, the US has implemented fishing controls and opened up the fishery. The current proposed quota for 2011 is 35.5m lbs. with a trip limit of 4000 lbs. This is a gain over past years in which the quota has ranged from 5m lbs. to 20m lbs. with trip limits from 2000 to 3000 lbs.[10] In 2010, NOAA announced the Eastern US Atlantic spiny dogfish stocks to be rebuilt[11] and in 2011 concerns about dogfish posing a serious predatory threat to other stocks resulted in an emergency amendment of the quota with nearly 15 million pounds being added.[12]

Gallery[edit]

See also[edit]

References[edit]

  1. ^ a b Fordham, S., Fowler, S.L., Coelho, R., Goldman, K.J. & Francis, M. (2006). "Squalus acanthias". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. Retrieved 7 September 2012. 
  2. ^ Kindersley, Dorling (2001,2005). Animal. New York City: DK Publishing. ISBN 0-7894-7764-5.  Check date values in: |date= (help)
  3. ^ Jose Castro, Diane Peeble (2011). ''The Sharks of North America.'' pg 58. Books.google.be. 2011-07-28. Retrieved 2013-11-06. 
  4. ^ Spiny dogfish. Memorandum of Understanding on the Conservation of Migratory Sharks.
  5. ^ FAO (Food and Agriculture Organization of the United Nations) (2011). Yearbook of fishery and aquaculture statistics 2009. Capture production. Rome: FAO. pp. 302–303. 
  6. ^ Katherine Sosebee, Paul Rago (December 2006). "Status of Fishery Resources off the Northeastern US: Spiny dogfish (Squalus acanthias)". NEFSC – Resource Evaluation and Assessment Division. 
  7. ^ "Spurdog in the Northeast Atlantic". Advice September 2011. ICES, Copenhagen. 2011. Retrieved 7 September 2012. [dead link]
  8. ^ Greenpeace International Seafood Red list[dead link]
  9. ^ http://www.cms.int/species/sharks/MoU/Migratory_Shark_MoU_Eng.pdf
  10. ^ "Mid- Atlantic Council on Dogfish". 
  11. ^ "NOAA Announces Spiny Dogfish Stocks to be Rebuilt". NOAA. 
  12. ^ "Spiny Dogfish Threaten Other Fish Stocks". 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Jones and Geen (1976) re-evaluated the taxonomy of Squalus acanthias in the northeastern Pacific ocean to conclude the recognition of the species Squalus suckleyi. Ebert et al. (2010) also conclude to recognize the north Pacific taxon as distinct from S. acanthias. Verissimo et al. (2010) outline two genetically distinct groups - one for the north Pacific and one from the south Pacific/Atlantic locations. These latter authors conclude that the available data strongly argue for the taxonomic separation of S. suckleyi from S. acanthias. This record represents the division of the two taxon as separate species.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!