Articles on this page are available in 1 other language: Spanish (2) (learn more)

Overview

Brief Summary

Biology

Said to be the most abundant living shark, the spiny dogfish is a slow, inactive swimmer and forms massive feeding aggregations of thousands of individuals. Tending to be same-sex and same-size shoals, they prey on shoals of bony fish, as well as octopuses, smaller sharks, squid, crabs and shark egg cases (3). They are highly migratory, moving towards the equatorial side of their range during winter (2). With estimates of between 20 years and 75 years, the spiny dogfish is thought to be a very long-lived fish that matures late and reproduces slowly, with gestation lasting two years – the longest of any vertebrate (1) (2) (3). An ovoviviparous species, spiny dogfish develop in eggs within the female, and gain nourishment from their yolk sacs, After four to six months, these eggs are shed, but the embryos continue to develop inside the female, still living off the yolk sac attached to their abdomens. Finally, after another 18 to 20 months of development, six to seven live young are born, measuring 20 to 33 centimetres. Despite possessing venom-delivering spines on each of its two dorsal fins, the spiny dogfish is eaten by cod, red hake, goosefish, other spiny dogfish, larger sharks, seals, and orcas (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology

Possibly the most abundant living shark (Ref. 247). An inshore and offshore dogfish of the continental and insular shelf and upper slopes (Ref. 247, 11230). Usually near the bottom, but also in midwater and at the surface (Ref. 26346); occurs mainly between 10-200 m depth (Ref. 247). Males and gravid females usually found shallower than non-gravid females. Tolerates brackish water, often found in enclosed bays and estuaries. Reported to enter freshwater (Ref. 11980) but cannot survive there for more than a few hours (Ref. 247). Highly migratory species, used to be observed in large foraging schools with up to thousands of individuals, usually segregated by size and /or sex, with schools of large gravid females preferentially targeted by fisheries. Their latitudinal (north-south) and depth-related (nearshore-offshore) movements appear to be correlated with their preferred temperature (Ref. 247). Tagging experiments showed that populations in the northern North Sea and northwest Scotland made winter migrations to off Norway and summer migrations to Scotland (Ref. 88880, 88881). Transoceanic migrations recorded, but rare (Ref. 88864). Longevity in the northern Atlantic is about 35-50 years (Ref. 88882), but most live only 20-24 years (Ref. 88187). Growth is slow. At sexual maturity, males are 60-70 cm long, females 75-90 cm (Ref. 35388). Gestation period is 2 years (Ref. 36731). Ovoviviparous (Ref. 205). The only species of horned sharks that can inflict toxins with its tail. Detects weak electric fields generated by potential prey (Ref. 10311). Utilized for human consumption, liver oil, vitamins, sand paper, leather, fertilizer, etc. (Ref. 247, 27436). Eaten fried, broiled, and baked (Ref. 9988).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

 The spiny dogfish or spurdog Squalus acanthias is a small member of the dogfish family reaching up to 1.6 m in length. It has a grey to brown dorsal colouring and a much paler belly. It can easily be distinguished from similar species by conspicuous white spots covering the entire body. It has two dorsal fins each with large spines. The caudal fin outline is smooth.One of the most abundant shark species in the world, Squalus acanthias is a well studied species and has been the subject of many studies focusing on heavy metal pollution and sensitivity to pollution studies (McMillan & Morse, 1999).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Common names: dogfish (English), mielga (Espanol)
 
Squalus acanthias Smith & Radcliffe, 1912

Pike dogfish


A slender cylindrical body; snout narrow, moderately long, pointed; eyes about midway between snout tip and gill slits; 5 gill slits; moderate sized spiracles just behind eyes; nasal flaps short, slender, not reaching mouth, with a minute or no secondary lobe, inner corners of nostrils closer to snout tip than to mouth; eyes without nictitating membrane; teeth low and blade-like, similar sized on both jaws, with strongly oblique tips; 2 dorsal fins with ungrooved spines (shorter spine on first dorsal), 2nd  smaller than first; origin of the first behind pectorals; pectoral fin narrow, sickle-shaped, posterior margin slightly concave, inner posterior tip slightly rounded; no anal fin; tail base with a pair of keels and a strong pit above; tip of tail fin without a notch on underside, rear of tail with angular notch separating two lobes; skin with small, 3 pointed denticles.

Color: grey above, white below; usually conspicuous white spots or bars on sides; dorsal fin edges dusky in juveniles, plain in adults.

Reaches 160cm

Intertidal to 1460m; from the surface to the bottom, usually near the bottom; often in bays and estuaries.

Antitropical; Pacific, Atlantic and Mediterranean, also SW Indian Ocean. From Alaska to the tip of Baja; also in Chile

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The common name 'dogfish' was given by fisherman to small sharks due to their habit of hunting shoals of fish in 'packs' (3). The spiny dogfish is a small, slim fish with a narrow, pointed snout and distinctive white spots (4). The back is slate grey to brown and the belly is pale grey to white. It has two dorsal fins, the first of which is smaller (3). They both have a spine which can inject venom causing strong pain lasting for several hours, and very occasionally death in humans (4). The pectoral fins are curved and have rounded tips (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Spiny dogfish are a boreal and temperate cosmopolitan species with principal populations found in the east and west North Atlantic, the eastern South Pacific, the South Atlantic off South America, the Cape coast of South Africa, the southern coasts of Australia and New Zealand, and in the east and west North Pacific. (Compagno 1984).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

The spiny dogfish inhabits the temperate and subarctic latitudes of the North Atlantic and North Pacific oceans. Specimens have been found in the Black and Mediterranean seas.

Biogeographic Regions: arctic ocean (Native ); atlantic ocean (Native ); pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Greenland to Argentina
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Baltic sea, Belgian Exclusive Economic Zone, Black Sea, British Columbia, British Isles, Canadian Exclusive Economic Zone [Pacific part], Coastal Waters of Southeast Alaska and British Columbia, European waters (ERMS scope), FAO fishing area 67, Greek Exclusive Economic Zone, Gulf of Maine, Gulf of Mexico, Gulf of St. Lawrence, IJsselmeer, Irish Exclusive economic Zone, Israeli Exclusive Economic Zone [Mediterranean part], Mauritius, New Zealand Exclusive Economic Zone, North East Pacific, North Pacific, North West Atlantic, Oosterschelde, Portugese Exclusive Economic Zone, Reunion, South Africa (country), Spanish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone, Westerschelde, Wimereux, Zeeschelde
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic: Greenland to Argentina. Eastern Atlantic: Iceland and and the Barents Sea to Western Sahara and the Canary Islands and in the Mediterranean and Black Seas (Ref. 247) and Angola to South Africa. Indo-Pacific. Reports from off New Guinea are doubtful (Ref. 6871). Records from North Pacific refer to Squalus suckleyi (Ref. 85328). Appendix II (northern hemisphere populations) of the Bonn Convention (2009).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Both sides of the North Atlantic, chiefly in the temperate and subarctic belt. Found on both sides of the northern Pacific; represented in the corresponding thermal belt of the southern hemisphere by a close relative of questionable difference to the spiny-dog of the north.
  • Bigelow, H. B. and Schroeder, W. C., 1953; Compagno, L. J. V., 1984; McAllister, D. E., 1990; Cox, G. and M. Francis, 1997.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth

Depth Range (m): 1 (S) - 1460 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific


 
Global Endemism: All species, TEP non-endemic, Circumtropical ( Indian + Pacific + Atlantic Oceans)

Regional Endemism: All species, Eastern Pacific non-endemic, Tropical Eastern Pacific (TEP) non-endemic, Temperate Eastern Pacific, primarily, California province, primarily, Continent, Continent only

Residency: Vagrant

Climate Zone: North Temperate (Californian Province &/or Northern Gulf of California), Northern Subtropical (Cortez Province + Sinaloan Gap)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Distributed along coastlines, the spiny dogfish is found in the western Atlantic, eastern Atlantic, western Pacific and eastern Pacific, as well as the Mediterranean Sea and the Black Sea (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The spiny dogfish can be recognized by its two dorsal fins, each with a spine; second dorsal is smaller than the first. Pectoral fins posses curved margins and rounded free rear tips. These sharks have narrow anterior nasal flaps. The teeth are oblique and smooth with a notch on the outer margin. Color is slate grey to brown above (often with scattered small white spots) and light grey to pure white on the belly. An albino was reported in Norwegian waters.

Range mass: 3.1 to 9.1 kg.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Dorsal spines (total): 2; Dorsal soft rays (total): 0; Analspines: 0; Analsoft rays: 0
  • White, W.T., G.K. Yearsley and P.R. Last 2007 Clarification of the status of Squalus taiwanensis and a diagnosis of Squalus acanthias from Australia, including a key to the Indo-Australasian species of Squalus. pp. 109-115. In P.R. Last, W.T. White and J.J. Pogonoski Descriptions of new dogfishes of the genus Squalus (Squaloidea: Squalidae). CSIRO Marine and Atmospheric Research Paper No. 014. 130 pp. (Ref. 58446)   http://www.fishbase.org/references/FBRefSummary.php?id=58446&speccode=139 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length max (cm): 160.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 1600 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

to 160 cm TL; 120 cm TL (female); max. weight: 9,100 g.
  • Bigelow, H. B. and Schroeder, W. C., 1953; Compagno, L. J. V., 1984; McAllister, D. E., 1990; Cox, G. and M. Francis, 1997.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

160 cm TL (male/unsexed; (Ref. 247)); 120 cm TL (female); max. published weight: 9,100 g (Ref. 11389); max. reported age: 75 years (Ref. 39247)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

This moderately sized species is distinguished by the following set of characters: very slender body, abdomen width 7.2-9.2% TL; narrow head, width at mouth 7.9-10.2% TL; mouth width 1.7-2.2 times its horizontal prenarial length; moderately long snout, preoral length 2.2-2.5 times horizontal prenarial length, 8.5-9.8% TL; single-lobed anterior nasal flap; small dorsal fins, raked, first dorsal-fin height 1.1-1.3 times its inner margin length, second dorsal-fin height 0.7-0.9 times its inner margin length; origin of first dorsal-fin located just posterior to pectoral-fin free rear tips; exposed bases of dorsal-fin spines relatively narrow, 0.4-0.7% TL; short spine of first dorsal fin, exposed length 1.7-2.7% TL; pectoral-fin anterior margin 1.9-3.1 times its inner margin length; preventral caudal margin 1.9-2.6 times inner margin of pelvic fin; pale caudal fin with poorly demarcated, whitish margin, blackish caudal blotch at the apex of upper lobe, anterior margins of both lobes whitish in juveniles; dark caudal bar absent; dorsal and lateral surfaces of body bluish grey with an irregular array of moderately-large white spots; whitish ventrally; flank denticles tricuspid; monospondylous centra 41-45, precaudal centra 74-79, total centra 100-105 (Ref. 58446).
  • White, W.T., G.K. Yearsley and P.R. Last 2007 Clarification of the status of Squalus taiwanensis and a diagnosis of Squalus acanthias from Australia, including a key to the Indo-Australasian species of Squalus. pp. 109-115. In P.R. Last, W.T. White and J.J. Pogonoski Descriptions of new dogfishes of the genus Squalus (Squaloidea: Squalidae). CSIRO Marine and Atmospheric Research Paper No. 014. 130 pp. (Ref. 58446)   http://www.fishbase.org/references/FBRefSummary.php?id=58446&speccode=139 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Spiny dogfish are ovoviviparous. Their 18 to 22 month gestation period (Compagno 1984) is among the longest of any animal. Pups measure between 20 and 30 cm at birth (Castro 1983). Fecundity increases with size (Templeman 1944, Nammack et al. 1985). Castro (1983) reported that, in the North Atlantic, dogfish pup offshore in deepwater wintering grounds, while Templeman (1944) suggested mature females off Newfoundland pup inshore January through May. Spiny dogfish move into the waters off the San Juan Islands of Washington (US) to pup in July and August (Camhi 1999).

Spiny dogfish prey opportunistically on a variety of small fish and invertebrates (Castro 1983). Aside from humans, adult dogfish have few enemies. They are eaten by larger sharks, large bony fishes, seals, and killer whales (Castro 1983, Compagno 1984). Although dogfish are regularly blamed for preying heavily on economically valuable groundfish, stomach content analyses reveal that most groundfish are uncommon in dogfish diets and the amount of groundfish removed by dogfish is a small fraction of fishery removal and stock sizes (Link et al. 2002).

Spiny dogfish are highly migratory, travelling in large, dense "packs", segregated by size and sex. Primarily epibenthic, they are not known to associate with any particular habitat (McMillan and Morse 1999). They are thought to mate in winter (Castro 1983, Compagno 1984). In Australia, breeding occurs in large bays and estuaries (Last and Stevens 1994), while North Atlantic mating grounds are still unknown.

Spiny dogfish reach maturity late and are very long-lived. Nammack et al. (1985) reported that individuals in the Pacific grow more slowly and larger than those in the Atlantic. Life history characteristics are summarized below. Smith et al. (1998) found spiny dogfish to have the lowest intrinsic rebound potential of 26 shark species analysed.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Spiny dogfish exist in an oceanic environment of depths from the surface to 400 fathoms or more. They prefer a temperature range of 6-11 degrees centregade.

Aquatic Biomes: benthic ; coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Frequents coastal and inshore waters, found at temperatures of 6-15 C.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

nektonic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Known from seamounts and knolls
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 57072 specimens in 1 taxon.
Water temperature and chemistry ranges based on 37837 samples.

Environmental ranges
  Depth range (m): -9 - 1446.5
  Temperature range (°C): -1.960 - 24.665
  Nitrate (umol/L): 0.325 - 40.485
  Salinity (PPS): 30.218 - 38.642
  Oxygen (ml/l): 0.435 - 7.862
  Phosphate (umol/l): 0.099 - 3.118
  Silicate (umol/l): 0.000 - 78.143

Graphical representation

Depth range (m): -9 - 1446.5

Temperature range (°C): -1.960 - 24.665

Nitrate (umol/L): 0.325 - 40.485

Salinity (PPS): 30.218 - 38.642

Oxygen (ml/l): 0.435 - 7.862

Phosphate (umol/l): 0.099 - 3.118

Silicate (umol/l): 0.000 - 78.143
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

 The spiny dogfish is a benthopelagic species occuring both inshore and offshore of the upper continental shelf. Tolerant of a wide range of salinities.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 1460m.
Recorded at 1460 meters.

Habitat: benthopelagic. Possibly the most abundant living shark. An inshore and offshore dogfish of the continental and insular shelf and upper slopes. Usually near the bottom but also found at the surface. Often found in enclosed bays and estuaries. Reported to enter freshwater (Ref. 11980) but cannot survive there for more than a few hours (Ref. 247). Ovoviviparous with 1-20 in a litter. Size at birth about 22 cm (Ref. 6871). Forms schools segregated by size and sex. Feeds on a wide variety of fishes and invertebrates. The only species of horned sharks that can inflict toxins with its tail. Utilized for human consumption, for liver oil, leather, fertilizer, etc. Eaten fried, broiled, and baked (Ref. 9988).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Benthopelagic; brackish; marine. Depth range: 0-1460 m. An inshore and offshore dogfish of the continental and insular shelf and upper slopes. Usually near the bottom, but also in midwater and at the surface. Often found in enclosed bays and estuaries. Reported to enter freshwater but cannot survive there for more than a few hours. Schools mainly segregated by size and sex; mixed schools also reported.
  • Bigelow, H. B. and Schroeder, W. C., 1953; Compagno, L. J. V., 1984; McAllister, D. E., 1990; Cox, G. and M. Francis, 1997.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Salinity: Marine, Brackish

Inshore/Offshore: Offshore, In & Offshore, Inshore

Water Column Position: Surface, Mid Water, Near Bottom, Bottom, Bottom + water column

Habitat: Soft bottom (mud, sand,gravel, beach, estuary & mangrove), Mud, Sand & gravel, Water column

FishBase Habitat: Bentho-Pelagic
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Found from the surface to a depth of 900 metres, the spiny dogfish is thought to tolerate in temperatures of between 7 and 15 degrees Celsius.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

benthopelagic; oceanodromous (Ref. 51243); brackish; marine; depth range 0 - 1460 m (Ref. 26346), usually ? - 200 m (Ref. 9253)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Spiny dogfish prey on bony fishes, smaller sharks, octopuses, squid, crabs, and eggcases of sharks and chimaeras.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Common in cold waters; usually at temperatures of 6-15°C (Ref. 5951); inhabits rocky regions (Ref. 9137). A carnivore (Ref. 9137) and opportunist feeder (Ref. 43115). Feeds on fishes (mackerel, sand lance, silver hake, white hake, haddock, pollock, Atlantic salmon, menhaden, winter flounder and longhorn sculpin), cephalopods (e.g. squids), amphipods, crabs, shrimps, molluscs, ctenophores, echinoderms (e.g. sea cucumber), polychaete worms, sea anemones, jellyfish, and red, green and brown algae; herring, capelin and cod found to be important foods (Ref. 5951, 28070). Smaller individuals (
  • Wetherbee, B.M., S.H. Gruber and E. Cortes 1990 Diet, feeding habits, digestion, and consumption in sharks, with special reference to the lemon shark, Negaprion brevirostris. p. 29-47. In H.L. Pratt, Jr., S.H. Gruber and T. Taniuchi (eds.) Elasmobranchs as living resources: advances in the biology, ecology, systematics, and the status of the fisheries. NOAA Tech. Rep. NMFS 90. 517 p. (Ref. 568)   http://www.fishbase.org/references/FBRefSummary.php?id=568&speccode=139 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Feeds primarily on bony fishes, also mollusks, crustaceans and other invertebrates.
  • Bigelow, H. B. and Schroeder, W. C., 1953; Compagno, L. J. V., 1984; McAllister, D. E., 1990; Cox, G. and M. Francis, 1997.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Feeding

Feeding Group: Carnivore

Diet: mobile benthic crustacea (shrimps/crabs), mobile benthic gastropods/bivalves, octopus/squid/cuttlefish, Pelagic crustacea, bony fishes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Known predators

Squalus acanthias (Spiny Dogfish) is prey of:
Squalus acanthias
Lophius americanus
Pomatomus saltatrix
Scombridae
Chondrichthyes
Homo sapiens

Based on studies in:
USA, Northeastern US contintental shelf (Coastal)

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Ovoviviparous, with litters of 1 to 21 young (Ref. 247, 88865). Mating probably occurs in winter. Gestation period of 18 to 24 months, longest known of all chondrichthyans (Ref. 26346). Size at birth 18-30 cm (Ref. 26346). In the northeast Atlantic, pups are born in winter, with size at birth about 26-28 cm (Ref. 88864). Sex ratio at birth is 1:1. Gravid females congregate in enclosed shallow bays to give birth (Ref. 247). The mother shark experiences a series of rhythmic contractions, just like in mammals, and the young are delivered head first. Larger older females have bigger litters with larger pups; a female with 100 cm TL carries on average 4 times as many embryos compared to a 70 cm female and the former have higher survival rates than those born to small females (Ref. 4856, 88869, 88883).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: wild:
60.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 75 years (wild) Observations: These animals take about 20 years to reach sexual maturity and are extremely long-lived (Das 1994). Although their exact longevity is unknown, some estimates indicate these animals can live up to 50-75 years (Cailliet et al. 2001).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

This shark is ovoviviparous. Males reach maturity between 80-100cm in length or at around 11 years of age; females mature at100-124 cm or in 18-21 years. Mating takes place during the winter months. As soon as the eggs are fertilized, the female secretes a thin, horny, transparent shell around them. The shells suround several eggs at once and are called candles. Gestation lasts between 22-24 months. Litters range between 2-11 pups and are between 20-30 cm at birth. They live for as long as 25-30 years.

Average age at sexual or reproductive maturity (male)

Sex: male:
3163 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
7668 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

These sharks are long-lived and mature late. Ovoviviparous, with litters of 1 to 20 young. Gestation period of 18 to 24 months, longest known of all chondrichthyans. Size at birth 18-30 cm. Sex ratio at birth is 1:1. Mating may occur in winter.
  • Bigelow, H. B. and Schroeder, W. C., 1953; Compagno, L. J. V., 1984; McAllister, D. E., 1990; Cox, G. and M. Francis, 1997.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Egg Type: Live birth, No pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Chemical protects against viral infections: dogfish shark
 

Chemical compound, squalamine, in dogfish shark protects against viral infections by disrupting the membrane interactions needed for viral replication.

   
  Dogfish sharks have powerful natural immunity to viral infections. "Antiviral compounds that increase the resistance of host tissues represent an attractive class of therapeutic. Here, we show that squalamine, a compound previously isolated from the tissues of the dogfish shark (Squalus acanthias) and the sea lamprey (Petromyzon marinus), exhibits broad-spectrum antiviral activity against human pathogens, which were studied in vitro as well as in vivo. Both RNA- and DNA-enveloped viruses are shown to be susceptible. The proposed mechanism involves the capacity of squalamine, a cationic amphipathic sterol, to neutralize the negative electrostatic surface charge of intracellular membranes in a way that renders the cell less effective in supporting viral replication. Because squalamine can be readily synthesized and has a known safety profile in man, we believe its potential as a broad-spectrum human antiviral agent should be explored." (Zasloff et al. 2011: 15978)
  Learn more about this functional adaptation.
  • Zasloff M; Adams AP; Beckerman B; Ann Campbell A; Han Z; Luijten E; Meza I; Julander J; Mishra A; Qu W; Taylor JM; Weaver SC; Wong GCL. 2011. Squalamine as a broad-spectrum systemic antiviral agent with therapeutic potential. PNAS. 108(38): 15978-15983.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Functional adaptation

Tail creates double jets: shark
 

Tail of a shark creates double jets by actively changing the tail's rigidity in mid swing.

   
  "Understanding how moving organisms generate locomotor forces is fundamental to the analysis of aerodynamic and hydrodynamic flow patterns that are generated during body and appendage oscillation...The hydrodynamic wake consists of one set of dual-linked vortex rings produced per half tail beat. In addition, we use a simple passive shark-tail model under robotic control to show that the three-dimensional wake flows of the robotic tail differ from the active tail motion of a live shark, suggesting that active control of kinematics and tail stiffness plays a substantial role in the production of wake vortical patterns." (Flammang et al. 2011: 3670)

"As the tail crosses the midline, the radialis muscles within the tail are actively stiffening the tail against this increased hydrodynamic loading. And it is precisely at this time of maximum expected stiffness and greatest drag that the first vortex is produced (figure 3), resulting in a jet with strong lift and thrust components (table 2). The remaining vorticity is shed as the tail is cupped slightly and continues laterally until it changes direction at maximum lateral excursion" (Flammang et al. 2011: 3674)

Watch Video


  Learn more about this functional adaptation.
  • Flammang BE; Lauder GV; Troolin DR; Tyson Strand T. 2011. Volumetric imaging of shark tail hydrodynamics reveals a three-dimensional dual-ring vortex wake structure. Proc. R. Soc. B. 278: 3670–3678.
  • Pennisi E. 2011. How sharks go fast. ScienceNOW [Internet],
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Genomic DNA is available from 6 specimens with morphological vouchers housed at Queensland Museum
Public Domain

Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Genomic DNA is available from 1 specimen with morphological vouchers housed at Bermuda Aquarium, Museum and Zoo
Public Domain

Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Squalus acanthias

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 43 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBGC1503-06|NC_002012|Squalus acanthias| AACCGTTGATTCTTTTCTACAAATCACAAAGATATCGGCACCCTTTATTTAATCTTTGGTGCATGAGCAGGAATAGTAGGTACCGCCCTT---AGCTTACTTATTCGCGCAGAATTAAGCCAACCCGGAACACTTCTGGGAGAT---GATCAAATCTATAATGTTATCGTGACTGCTCACGCTTTTGTAATAATCTTTTTTATAGTTATGCCTGTAATAATTGGTGGATTCGGAAACTGATTGGTGCCCTTAATA---ATCGGCGCACCAGATATGGCTTTTCCACGAATAAATAATATAAGCTTTTGACTATTACCCCCCTCCCTCCTATTACTTTTAGCCTCAGCTGGTGTTGAGGCAGGAGCCGGAACCGGCTGAACAGTCTACCCCCCTCTCGCAGGTAACATAGCCCATGCTGGCGCATCTGTAGATCTA---GCCATCTTCTCACTCCATTTAGCTGGTATTTCCTCAATTTTAGCCTCTATTAATTTTATCACAACTATTATTAACATAAAACCACCTGCCATTTCTCAGTATCAAACACCACTCTTTGTTTGATCCATTCTTGTAACCACCATTCTTCTTCTTCTTTCTCTTCCTGTTCTCGCAGCC---GCAATTACGATACTATTAACTGACCGTAATTTAAACACAACATTTTTTGACCCTGCCGGAGGGGGAGACCCAATTCTTTACCAACATTTATTTTGATTCTTCGGCCACCCAGAAGTTTATATTTTAATTTTACCCGGTTTCGGAATAATTTCCCATGTAGTAGCCTATTATTCAGGTAAAAAA---GAACCTTTTGGTTATATGGGTATAGTTTGAGCAATAATAGCAATTGGCCTGCTCGGCTTTATTGTATGGGCTCATCACATATTTACAGTAGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Squalus acanthias

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 43
Species: 245
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A2bd+3bd+4bd

Version
3.1

Year Assessed
2006

Assessor/s
Fordham, S., Fowler, S.L., Coelho, R., Goldman, K.J. & Francis, M.

Reviewer/s
Cavanagh, R.D. & participants of the Shark Specialist Group North-Central America & Mediterranean workshops (Shark Red List Authority)

Justification
The spiny dogfish or spurdog Squalus acanthias is a small demersal shark of temperate continental shelf seas worldwide. Most stocks are highly migratory, but there is no regional fisheries management for the species. Management is in place in only a few range states and in only a limited part of the range of highly migratory stocks. Although naturally abundant, this is one of the more vulnerable species of shark to over-exploitation by fisheries because of its late maturity, low reproductive capacity, longevity, long generation time (25–40 years) and hence a very low intrinsic rate of population increase (2–7% per annum). Population segregation and an aggregating habit make mature (usually pregnant) females highly vulnerable to fisheries even when stocks are seriously depleted. This aggregating habit also means that catch per unit effort (CPUE) is not an adequate indicator of stock status; high CPUE can be maintained even when populations are severely depleted. Some targeted Squalus acanthias fisheries have been documented for over 100 years. Fisheries stock assessments report a decline in total biomass of >95% from baseline in the Northeast Atlantic, where catch effort is effectively unlimited. Mediterranean and Black Sea stocks are also unmanaged, with a >60% decline reported in a Black Sea stock assessment for 1981–1992. There has been a decline in biomass of mature females of 75% in just 10 years in the Northwest Atlantic, where US federal efforts to manage the stock are hampered by high bycatch, continued exploitation in Canadian Atlantic waters, and regular defiance of scientific advice by US Atlantic states. European demand continues to fuel markets around the world. Fisheries and population trend data indicate that the southern part of the Northeast Pacific stock has also declined through overfishing, but stocks appear stable off Alaska. The only data identified from the Northwest Pacific are from Japan, where landings of spurdog declined ~80% in 1952-1965, and inshore spurdog CPUE declined 80–90% from the mid 1970s to late 1990s. Unregulated and expanding target and bycatch fisheries take spiny dogfish in South America (Europe reports imports from this region), where population declines are reported. New Zealand manages the species, which is taken in target and bycatch fisheries, through its Quota Management System. There is only limited fishing pressure in Australia and South Africa, with most catches discarded.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
A2bd+4bd

Version
3.1

Year Assessed
2006

Assessor/s
Fordham, S., Fowler, S.L., Coelho, R., Goldman, K.J., Francis, M.

Reviewer/s
Cavanagh, R.D. & participants of the Shark Specialist Group Mediterranean & North-Central America workshop (Shark Red List Authority)

Justification
The spiny dogfish or spurdog Squalus acanthias is a small demersal shark of temperate continental shelf seas worldwide. Most stocks are highly migratory, but there is no regional fisheries management for the species. Management is in place in only a few range states and in only a limited part of the range of highly migratory stocks. Although naturally abundant, this is one of the more vulnerable species of shark to over-exploitation by fisheries because of its late maturity, low reproductive capacity, longevity, long generation time (25–40 years) and hence a very low intrinsic rate of population increase (2–7% per annum). Population segregation and an aggregating habit make mature (usually pregnant) females highly vulnerable to fisheries even when stocks are seriously depleted. This aggregating habit also means that catch per unit effort (CPUE) is not an adequate indicator of stock status; high CPUE can be maintained even when populations are severely depleted. Some targeted Squalus acanthias fisheries have been documented for over 100 years. Fisheries stock assessments report a decline in total biomass of >95% from baseline in the Northeast Atlantic, where catch effort is effectively unlimited. Mediterranean and Black Sea stocks are also unmanaged, with a >60% decline reported in a Black Sea stock assessment for 1981–1992. There has been a decline in biomass of mature females of 75% in just 10 years in the Northwest Atlantic, where US federal efforts to manage the stock are hampered by high bycatch, continued exploitation in Canadian Atlantic waters, and regular defiance of scientific advice by US Atlantic states. European demand continues to fuel markets around the world. Fisheries and population trend data indicate that the southern part of the Northeast Pacific stock has also declined through overfishing, but stocks appear stable off Alaska. The only data identified from the Northwest Pacific are from Japan, where landings of spurdog declined ~80% in 1952–1965, and inshore spurdog CPUE declined 80–90% from the mid 1970s to late 1990s. Unregulated and expanding target and bycatch fisheries take spiny dogfish in South America (Europe reports imports from this region), where population declines are reported. New Zealand manages the species, which is taken in target and bycatch fisheries, through its Quota Management System. There is only limited fishing pressure in Australia and South Africa, with most catches discarded.

History
  • 2003
    Vulnerable
    (IUCN 2003)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
A2bd+4bd

Version
3.1

Year Assessed
2006

Assessor/s
Fordham, S., Fowler, S.L., Coelho, R., Goldman, K.J. & Francis, M.

Reviewer/s
Cavanagh, R.D. & participants of the Shark Specialist Group North-Central America & Mediterranean workshops (Shark Red List Authority)

Justification
The spiny dogfish or spurdog Squalus acanthias is a small demersal shark of temperate continental shelf seas worldwide. Most stocks are highly migratory, but there is no regional fisheries management for the species. Management is in place in only a few range states and in only a limited part of the range of highly migratory stocks. Although naturally abundant, this is one of the more vulnerable species of shark to over-exploitation by fisheries because of its late maturity, low reproductive capacity, longevity, long generation time (25–40 years) and hence a very low intrinsic rate of population increase (2–7% per annum). Population segregation and an aggregating habit make mature (usually pregnant) females highly vulnerable to fisheries even when stocks are seriously depleted. This aggregating habit also means that catch per unit effort (CPUE) is not an adequate indicator of stock status; high CPUE can be maintained even when populations are severely depleted. Some targeted Squalus acanthias fisheries have been documented for over 100 years. Fisheries stock assessments report a decline in total biomass of >95% from baseline in the Northeast Atlantic, where catch effort is effectively unlimited. Mediterranean and Black Sea stocks are also unmanaged, with a >60% decline reported in a Black Sea stock assessment for 1981–1992. There has been a decline in biomass of mature females of 75% in just 10 years in the Northwest Atlantic, where US federal efforts to manage the stock are hampered by high bycatch, continued exploitation in Canadian Atlantic waters, and regular defiance of scientific advice by US Atlantic states. European demand continues to fuel markets around the world. Fisheries and population trend data indicate that the southern part of the Northeast Pacific stock has also declined through overfishing, but stocks appear stable off Alaska. The only data identified from the Northwest Pacific are from Japan, where landings of spurdog declined ~80% in 1952-1965, and inshore spurdog CPUE declined 80–90% from the mid 1970s to late 1990s. Unregulated and expanding target and bycatch fisheries take spiny dogfish in South America (Europe reports imports from this region), where population declines are reported. New Zealand manages the species, which is taken in target and bycatch fisheries, through its Quota Management System. There is only limited fishing pressure in Australia and South Africa, with most catches discarded.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A2bd

Version
3.1

Year Assessed
2006

Assessor/s
Fordham, S., Fowler, S.L., Coelho, R., Goldman, K.J. & Francis, M.

Reviewer/s
Cavanagh, R.D. & participants of the Shark Specialist Group North-Central America & Mediterranean workshops (Shark Red List Authority)

Justification
The spiny dogfish or spurdog Squalus acanthias is a small demersal shark of temperate continental shelf seas worldwide. Most stocks are highly migratory, but there is no regional fisheries management for the species. Management is in place in only a few range states and in only a limited part of the range of highly migratory stocks. Although naturally abundant, this is one of the more vulnerable species of shark to over-exploitation by fisheries because of its late maturity, low reproductive capacity, longevity, long generation time (25–40 years) and hence a very low intrinsic rate of population increase (2–7% per annum). Population segregation and an aggregating habit make mature (usually pregnant) females highly vulnerable to fisheries even when stocks are seriously depleted. This aggregating habit also means that catch per unit effort (CPUE) is not an adequate indicator of stock status; high CPUE can be maintained even when populations are severely depleted. Some targeted Squalus acanthias fisheries have been documented for over 100 years. Fisheries stock assessments report a decline in total biomass of >95% from baseline in the Northeast Atlantic, where catch effort is effectively unlimited. Mediterranean and Black Sea stocks are also unmanaged, with a >60% decline reported in a Black Sea stock assessment for 1981–1992. There has been a decline in biomass of mature females of 75% in just 10 years in the Northwest Atlantic, where US federal efforts to manage the stock are hampered by high bycatch, continued exploitation in Canadian Atlantic waters, and regular defiance of scientific advice by US Atlantic states. European demand continues to fuel markets around the world. Fisheries and population trend data indicate that the southern part of the Northeast Pacific stock has also declined through overfishing, but stocks appear stable off Alaska. The only data identified from the Northwest Pacific are from Japan, where landings of spurdog declined ~80% in 1952-1965, and inshore spurdog CPUE declined 80–90% from the mid 1970s to late 1990s. Unregulated and expanding target and bycatch fisheries take spiny dogfish in South America (Europe reports imports from this region), where population declines are reported. New Zealand manages the species, which is taken in target and bycatch fisheries, through its Quota Management System. There is only limited fishing pressure in Australia and South Africa, with most catches discarded.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A2bd+3bd+4bd

Version
3.1

Year Assessed
2006

Assessor/s
Fordham, S., Fowler, S.L., Coelho, R., Goldman, K.J. & Francis, M.

Reviewer/s
Cavanagh, R.D. & participants of the Shark Specialist Group Mediterranean & North-Central America Workshops (Shark Red List Authority)

Contributor/s

Justification
The spiny dogfish or spurdog Squalus acanthias is a small demersal shark of temperate continental shelf seas worldwide. Most stocks are highly migratory, but there is no regional fisheries management for the species. Management is in place in only a few range states and in only a limited part of the range of highly migratory stocks. Although naturally abundant, this is one of the more vulnerable species of shark to over-exploitation by fisheries because of its late maturity, low reproductive capacity, longevity, long generation time (25 to 40 years) and hence a very low intrinsic rate of population increase (2 to 7% per annum). Population segregation and an aggregating habit make mature (usually pregnant) females highly vulnerable to fisheries even when stocks are seriously depleted. This aggregating habit also means that catch per unit effort (CPUE) is not an adequate indicator of stock status; high CPUE can be maintained even when populations are severely depleted. Some targeted Squalus acanthias fisheries have been documented for over 100 years. Fisheries stock assessments report a decline in total biomass of >95% from baseline in the Northeast Atlantic, where catch effort is effectively unlimited. Mediterranean and Black Sea stocks are also unmanaged, with a >60% decline reported in a Black Sea stock assessment for 1981 to 1992. There has been a decline in biomass of mature females of 75% in just 10 years in the Northwest Atlantic, where US federal efforts to manage the stock are hampered by high bycatch, continued exploitation in Canadian Atlantic waters, and regular defiance of scientific advice by US Atlantic states. European demand continues to fuel markets around the world. Fisheries and population trend data indicate that the southern part of the Northeast Pacific stock has also declined through overfishing, but stocks appear stable off Alaska. The only data identified from the Northwest Pacific are from Japan, where landings of spurdog declined ~80% between 1952 and 1965, and inshore spurdog CPUE declined 80 to 90% from the mid 1970s to late 1990s. Unregulated and expanding target and bycatch fisheries take spiny dogfish in South America (Europe reports imports from this region), where population declines are reported. New Zealand manages the species, which is taken in target and bycatch fisheries, through its Quota Management System. There is only limited fishing pressure in Australia and South Africa, with most catches discarded.

History
  • 2000
    Lower Risk/near threatened
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2006

Assessor/s
Fordham, S., Fowler, S.L., Coelho, R., Goldman, K.J. & Francis, M.

Reviewer/s
Cavanagh, R.D. & participants of the Shark Specialist Group North-Central America & Mediterranean workshops (Shark Red List Authority)

Justification
The spiny dogfish or spurdog Squalus acanthias is a small demersal shark of temperate continental shelf seas worldwide. Most stocks are highly migratory, but there is no regional fisheries management for the species. Management is in place in only a few range states and in only a limited part of the range of highly migratory stocks. Although naturally abundant, this is one of the more vulnerable species of shark to over-exploitation by fisheries because of its late maturity, low reproductive capacity, longevity, long generation time (25–40 years) and hence a very low intrinsic rate of population increase (2–7% per annum). Population segregation and an aggregating habit make mature (usually pregnant) females highly vulnerable to fisheries even when stocks are seriously depleted. This aggregating habit also means that catch per unit effort (CPUE) is not an adequate indicator of stock status; high CPUE can be maintained even when populations are severely depleted. Some targeted Squalus acanthias fisheries have been documented for over 100 years. Fisheries stock assessments report a decline in total biomass of >95% from baseline in the Northeast Atlantic, where catch effort is effectively unlimited. Mediterranean and Black Sea stocks are also unmanaged, with a >60% decline reported in a Black Sea stock assessment for 1981–1992. There has been a decline in biomass of mature females of 75% in just 10 years in the Northwest Atlantic, where US federal efforts to manage the stock are hampered by high bycatch, continued exploitation in Canadian Atlantic waters, and regular defiance of scientific advice by US Atlantic states. European demand continues to fuel markets around the world. Fisheries and population trend data indicate that the southern part of the Northeast Pacific stock has also declined through overfishing, but stocks appear stable off Alaska. The only data identified from the Northwest Pacific are from Japan, where landings of spurdog declined ~80% in 1952–1965, and inshore spurdog CPUE declined 80–90% from the mid 1970s to late 1990s. Unregulated and expanding target and bycatch fisheries take spiny dogfish in South America (Europe reports imports from this region), where population declines are reported. New Zealand manages the species, which is taken in target and bycatch fisheries, through its Quota Management System. There is only limited fishing pressure in Australia and South Africa, with most catches discarded.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
CR
Critically Endangered

Red List Criteria
A2bd+3bd+4bd

Version
3.1

Year Assessed
2006

Assessor/s
Fordham, S., Fowler, S.L., Coelho, R., Goldman, K.J. & Francis, M.

Reviewer/s
Cavanagh, R.D. & participants of the Shark Specialist Group Mediterranean & North-Central America workshops (Shark Red List Authority)

Justification
The spiny dogfish or spurdog Squalus acanthias is a small demersal shark of temperate continental shelf seas worldwide. Most stocks are highly migratory, but there is no regional fisheries management for the species. Management is in place in only a few range states and in only a limited part of the range of highly migratory stocks. Although naturally abundant, this is one of the more vulnerable species of shark to over-exploitation by fisheries because of its late maturity, low reproductive capacity, longevity, long generation time (25–40 years) and hence a very low intrinsic rate of population increase (2–7% per annum). Population segregation and an aggregating habit make mature (usually pregnant) females highly vulnerable to fisheries even when stocks are seriously depleted. This aggregating habit also means that catch per unit effort (CPUE) is not an adequate indicator of stock status; high CPUE can be maintained even when populations are severely depleted. Some targeted Squalus acanthias fisheries have been documented for over 100 years. Fisheries stock assessments report a decline in total biomass of >95% from baseline in the Northeast Atlantic, where catch effort is effectively unlimited. Mediterranean and Black Sea stocks are also unmanaged, with a >60% decline reported in a Black Sea stock assessment for 1981–1992. There has been a decline in biomass of mature females of 75% in just 10 years in the Northwest Atlantic, where US federal efforts to manage the stock are hampered by high bycatch, continued exploitation in Canadian Atlantic waters, and regular defiance of scientific advice by US Atlantic states. European demand continues to fuel markets around the world. Fisheries and population trend data indicate that the southern part of the Northeast Pacific stock has also declined through overfishing, but stocks appear stable off Alaska. The only data identified from the Northwest Pacific are from Japan, where landings of spurdog declined ~80% in 1952–1965, and inshore spurdog CPUE declined 80-90% from the mid 1970s to late 1990s. Unregulated and expanding target and bycatch fisheries take spiny dogfish in South America (Europe reports imports from this region), where population declines are reported. New Zealand manages the species, which is taken in target and bycatch fisheries, through its Quota Management System. There is only limited fishing pressure in Australia and South Africa, with most catches discarded.

History
  • 2003
    Endangered
    (IUCN 2003)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A2bd+4bd

Version
3.1

Year Assessed
2006

Assessor/s
Fordham, S., Fowler, S.L., Coelho, R., Goldman, K.J. & Francis, M.

Reviewer/s
Cavanagh, R.D. & participants of the Shark Specialist Group North-Central America & Mediterranean workshops (Shark Red List Authority)

Contributor/s

Justification
The spiny dogfish or spurdog Squalus acanthias is a small demersal shark of temperate continental shelf seas worldwide. Most stocks are highly migratory, but there is no regional fisheries management for the species. Management is in place in only a few range states and in only a limited part of the range of highly migratory stocks. Although naturally abundant, this is one of the more vulnerable species of shark to over-exploitation by fisheries because of its late maturity, low reproductive capacity, longevity, long generation time (25–40 years) and hence a very low intrinsic rate of population increase (2–7% per annum). Population segregation and an aggregating habit make mature (usually pregnant) females highly vulnerable to fisheries even when stocks are seriously depleted. This aggregating habit also means that catch per unit effort (CPUE) is not an adequate indicator of stock status; high CPUE can be maintained even when populations are severely depleted. Some targeted Squalus acanthias fisheries have been documented for over 100 years. Fisheries stock assessments report a decline in total biomass of >95% from baseline in the Northeast Atlantic, where catch effort is effectively unlimited. Mediterranean and Black Sea stocks are also unmanaged, with a >60% decline reported in a Black Sea stock assessment for 1981–1992. There has been a decline in biomass of mature females of 75% in just 10 years in the Northwest Atlantic, where US federal efforts to manage the stock are hampered by high bycatch, continued exploitation in Canadian Atlantic waters, and regular defiance of scientific advice by US Atlantic states. European demand continues to fuel markets around the world. Fisheries and population trend data indicate that the southern part of the Northeast Pacific stock has also declined through overfishing, but stocks appear stable off Alaska. The only data identified from the Northwest Pacific are from Japan, where landings of spurdog declined ~80% in 1952-1965, and inshore spurdog CPUE declined 80–90% from the mid 1970s to late 1990s. Unregulated and expanding target and bycatch fisheries take spiny dogfish in South America (Europe reports imports from this region), where population declines are reported. New Zealand manages the species, which is taken in target and bycatch fisheries, through its Quota Management System. There is only limited fishing pressure in Australia and South Africa, with most catches discarded.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2006

Assessor/s
Fordham, S., Fowler, S.L., Coelho, R., Goldman, K.J. & Francis, M.

Reviewer/s
Cavanagh, R.D. & participants of the Shark Specialist Group North-Central America & Mediterranean workshops (Shark Red List Authority)

Justification
The spiny dogfish or spurdog Squalus acanthias is a small demersal shark of temperate continental shelf seas worldwide. Most stocks are highly migratory, but there is no regional fisheries management for the species. Management is in place in only a few range states and in only a limited part of the range of highly migratory stocks. Although naturally abundant, this is one of the more vulnerable species of shark to over-exploitation by fisheries because of its late maturity, low reproductive capacity, longevity, long generation time (25–40 years) and hence a very low intrinsic rate of population increase (2–7% per annum). Population segregation and an aggregating habit make mature (usually pregnant) females highly vulnerable to fisheries even when stocks are seriously depleted. This aggregating habit also means that catch per unit effort (CPUE) is not an adequate indicator of stock status; high CPUE can be maintained even when populations are severely depleted. Some targeted Squalus acanthias fisheries have been documented for over 100 years. Fisheries stock assessments report a decline in total biomass of >95% from baseline in the Northeast Atlantic, where catch effort is effectively unlimited. Mediterranean and Black Sea stocks are also unmanaged, with a >60% decline reported in a Black Sea stock assessment for 1981–1992. There has been a decline in biomass of mature females of 75% in just 10 years in the Northwest Atlantic, where US federal efforts to manage the stock are hampered by high bycatch, continued exploitation in Canadian Atlantic waters, and regular defiance of scientific advice by US Atlantic states. European demand continues to fuel markets around the world. Fisheries and population trend data indicate that the southern part of the Northeast Pacific stock has also declined through overfishing, but stocks appear stable off Alaska. The only data identified from the Northwest Pacific are from Japan, where landings of spurdog declined ~80% in 1952-1965, and inshore spurdog CPUE declined 80–90% from the mid 1970s to late 1990s. Unregulated and expanding target and bycatch fisheries take spiny dogfish in South America (Europe reports imports from this region), where population declines are reported. New Zealand manages the species, which is taken in target and bycatch fisheries, through its Quota Management System. There is only limited fishing pressure in Australia and South Africa, with most catches discarded.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
A2bd+4bd

Version
3.1

Year Assessed
2006

Assessor/s
Fordham, S., Fowler, S.L., Coelho, R., Goldman, K.J. & Francis, M.

Reviewer/s
Cavanagh, R.D. & participants of the Shark Specialist Group North-Central America & Mediterranean workshops (Shark Red List Authority)

Contributor/s

Justification
The spiny dogfish or spurdog Squalus acanthias is a small demersal shark of temperate continental shelf seas worldwide. Most stocks are highly migratory, but there is no regional fisheries management for the species. Management is in place in only a few range states and in only a limited part of the range of highly migratory stocks. Although naturally abundant, this is one of the more vulnerable species of shark to over-exploitation by fisheries because of its late maturity, low reproductive capacity, longevity, long generation time (25–40 years) and hence a very low intrinsic rate of population increase (2–7% per annum). Population segregation and an aggregating habit make mature (usually pregnant) females highly vulnerable to fisheries even when stocks are seriously depleted. This aggregating habit also means that catch per unit effort (CPUE) is not an adequate indicator of stock status; high CPUE can be maintained even when populations are severely depleted. Some targeted Squalus acanthias fisheries have been documented for over 100 years. Fisheries stock assessments report a decline in total biomass of >95% from baseline in the Northeast Atlantic, where catch effort is effectively unlimited. Mediterranean and Black Sea stocks are also unmanaged, with a >60% decline reported in a Black Sea stock assessment for 1981–1992. There has been a decline in biomass of mature females of 75% in just 10 years in the Northwest Atlantic, where US federal efforts to manage the stock are hampered by high bycatch, continued exploitation in Canadian Atlantic waters, and regular defiance of scientific advice by US Atlantic states. European demand continues to fuel markets around the world. Fisheries and population trend data indicate that the southern part of the Northeast Pacific stock has also declined through overfishing, but stocks appear stable off Alaska. The only data identified from the Northwest Pacific are from Japan, where landings of spurdog declined ~80% in 1952-1965, and inshore spurdog CPUE declined 80–90% from the mid 1970s to late 1990s. Unregulated and expanding target and bycatch fisheries take spiny dogfish in South America (Europe reports imports from this region), where population declines are reported. New Zealand manages the species, which is taken in target and bycatch fisheries, through its Quota Management System. There is only limited fishing pressure in Australia and South Africa, with most catches discarded.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

No special status.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation status

IUCN Red List: Listed, Vulnerable

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Vulnerable (VU) on the IUCN Red List.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Little mixing occurs between populations. They are found from the intertidal zone to depths of 900 m, but mostly <200 m (at least in the Mediterranean). Usually coastal and demersal, they migrate north and south as well as near shore and offshore in 7 to 15°C water (Compagno 1984).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
The principal threat to this species worldwide is over-exploitation, by target and bycatch fisheries. This is a valuable commercial species in many parts of the world, caught in bottom trawls, gillnets, line gear, and by rod and reel.

France was the largest importer of dogfish meat within the EU from 1990-1994, importing an annual average of 5,000 tonnes (98% spiny) with the UK as their top European supplier. During 1988?1994, Norway was the largest of nine non-EU suppliers to the EU of fresh or chilled spiny dogfish, followed by the US. As European stocks decline, demand is being met by frozen imports from 25 countries, dominated by the US and Argentina.

According to the Food and Agricultural Organization (FAO), dogfish catches reached a peak in 1972 (73,500 t) then declined and stabilized in a range between 36,000 and 51,000 t in the 1990s. Most of the catch reported to FAO comes from the North Atlantic, with minor amounts reported from the Northeast Pacific (maximum 5,314 t in 1988) and the Mediterranean and Black Seas. There are, however, some data discrepancies: in 1999, the US landed nearly 15,000 t of spiny dogfish and 9,800 t was landed from ICES areas, most of this by the UK fleet (UK fisheries statistics report over 9,000 t landed), yet FAO reports 1999 global catch at 22,756 t with the largest catches coming from Canada (5,536 t) and Norway (1,461 t) (FAO 2000).

Locally high biomass initially supports large catches, but most large-scale spiny dogfish fisheries have depleted populations and collapsed (Ocean Wildlife Campaign 1996). An aggregating habit makes it possible for fishers to continue to target highest value mature females even after stocks have been depleted to a few percent of baseline. The species is also taken as a bycatch in mixed species fisheries, meaning that fishing pressure can continue even after stocks have been so seriously depleted that they can no longer support viable fisheries.

There are potential impacts on spiny dogfish associated with habitat loss and degradation. Coastal development, pollution, dredging and bottom trawling affect coastal or benthic habitat on which spiny dogfish or their prey rely (ASMFC 2002).

Where spiny dogfish are taken as an unwanted bycatch in fisheries and discarded, their high survival rates and competitive release from retained demersal fish species may well lead to increased stocks of dogfish. This may have occurred in the Northwest Atlantic before declining fish stocks and high demand from European markets caused the species to be targeted there.

We must take into account that official fisheries statistics in most regions only consider landed biomass, and not actual captures. If we consider the possibility that a decade ago discards of these non targeted species were higher than discards nowadays (and this fact can easily be explained due to the collapse in most traditional fishing stocks, that lead to an increase in the commercialisation of these by-catch species), then the real decrease in the population biomass can be much higher than many of the estimates presented here.

Northeast Atlantic:
Rey (1928) refers that in the 1920s this was a very abundant species in the Iberia Peninsula (Portugal and Spain) both for the Atlantic and the Mediterranean coasts. He added that this species probably aggregated during some periods because sometimes huge amounts were captured with longlines and nets. Heessen et al. (2003) identified a single Northeast Atlantic stock of spurdog, distributed from the north of the Bay of Biscay to the Norwegian Sea. This has been fished off Europe (mainly in the North and Irish Seas) since the early 1900s, primarily by British and Norwegian fishermen, later by the French and Irish as well (Bonfil 1994). Today, the UK fishery lands around 80% of the European Union catch. Annual catches were well below 10,000 t throughout the ICES area before the 1930s, had more than doubled by 1937, then reached a peak of over 58,000 t in 1963 (Heessen et al. 2003 and see Figure). Holden (1968) considered the female portion of the Scottish-Norwegian stock to be overfished in the late 1960s. In the late 1970s, landings continued to decline and by 1978, the Norwegian fishery north of Scotland had collapsed (Hjertenes 1980). The important North Sea fishery declined steeply from around 37,000 t in the early 1970s, to 3,000?4,000 in recent years, while the more recent Celtic Seas fishery peaked at about 22,000 t in 1987, since declining to under 5,000 t. Total landings from the entire ICES area are now under 10,000 t, around 17% of peak landings.

Portuguese official fisheries statistics for landings of Squalus acanthias for fishes captured in Portuguese waters, have shown a decrease of 51% between 1987 and 2000. Since then, landings increased again until 2002, so the overall decrease from 1987 to 2002 has been 11.3% (DGPA, 1988?2004). When a linear regression was fitted to the log transformed data of these annual landings, projections were made for a three-generation period in the past, with a reduction of landed biomass of 43%. Taking into account that this species continues to be fished nowadays and there are no perspectives of reducing exploitation levels for the future, future projections were also made, and another 43% reduction of landed biomass in the next three generations estimated.

We must take into account that official fisheries statistics only consider landed biomass, and not actual captures. If we consider the possibility that 15 years ago discards of these non targeted species were higher than discards nowadays (and this fact can easily be explained due to the collapse in most traditional fishing stocks, that lead to an increase in the commercialisation of these by-catch species), then the real decrease in the population biomass can be much higher than one estimated here.

The species is still the region?s most commercially important elasmobranch, with most of the catch being incidental although there are still local, directed fisheries in the north (Pawson and Vince 1998). Heessen et al. (2003) describe the stock as severely depleted, with an estimated decline in biomass from 1977 of over 5,000,000 (at which time landings had already fallen to 60% of peak catches) to well under 100,000 in 2001; a decline in biomass of well over 98%. Estimates of total numbers of mature adults in 2000 range from 100,000 to 600,000 individuals. Hammond and Ellis (2004) estimate depletion of this stock to about 5% of virgin biomass. The decline in biomass over the >75 year three generation period for this stock is also greater than 90% and the stock therefore assessed as Critically Endangered. There is currently no indication that effective management will be introduced to regulate the fishery and allow the stock to rebuild; quotas apply to only part of the stock (North Sea) and significantly exceed recent landings for this area, while ICES advice for a zero quota in 2006 was not adopted by the EU.

Mediterranean:
Depth distribution is from 20?30 m down to 800 m, with peaks of abundance in shallow water (to 50 m) and from 200?500 m. The species is most abundant in the Eastern Central area (southern Adriatic, Ionian and Albanian Sea), less so in the Eastern Aegean, and fairly scarce elsewhere. Spiny dogfish occurred in 5% of MEDITS trawls (1994-98). These data were used to calculate a total standing stock biomass in the entire MEDITS area of 6,682 tonnes (Serena in lit.). There are very few trend data. Jukic-Peladic et al. (2001) do not report any significant change in occurrence of S. acanthias. Aldebert (1997) reports a decline in observations of S. acanthias landings beginning in the 1980s. Anecdotal evidence from fishermen interviews in the Balearics indicates a significant decline in abundance in captures with bottom longlines and gillnets over the 17 years from 1985/6 (Gabriel Morey, personal communication). Directed fisheries undertaken for this species during the 1970s ceased as a result of these stock declines. This stock is therefore assessed as Endangered.

Black Sea:
Although trend data are scarce for the Black Seas, some declines have been observed. A stock assessment for the Black Sea stock (Prodanov et al. 1997) identified a decline in abundance of Squalus acanthias of 60% between 1981 and 1992. Overall, the stock seems likely to be in a better state than in the Northeast Atlantic, which has been fished more intensively and for much longer. Fishing pressure is, however, likely to continue to remain high and the declines seem likely to continue and therefore the stock is assessed as Vulnerable.

Northwest Atlantic:
Spiny dogfish were fished intensively for liver oil off the eastern US during World War II until the synthesis of vitamin A (Castro 1983). Landings increased from 500 t in the early 1960s to 9,689 t in 1966 and peaked in 1974 at 25,620 t. Foreign fleets (from the former USSR and East German Republic, Poland, Japan and Canada) accounted for virtually all the reported catch from 1966 to 1977 (NOAA 1995). Annual US commercial dogfish landings from the Atlantic increased from only a few hundred tonnes in the late 1970s to around 4,500 t during 1979?1989. Increasing European demand led to a sevenfold increase in landings, to a peak of 27,200 t in 1996. Estimates of dogfish discards have ranged from 3,700 mt to 47,000mt for the years 1990?2002 (NEFSC 2003). Landings fell to 14,906 t in 1999, prior to the introduction of management (Rago and Sosebee 2002), but federal mortality targets have yet to be achieved. US recreational catches increased from about 350 t annually in 1979?1980 to about 1,700 t in 1989, averaged about 1,300 t from 1990-1994, then declined in 1996 to 386 t (NOAA 1998). Recreational landings remained stable through 2000 and then rose to roughly 2,000 mt in 2001 and 2002, a level that for the first time is considered significant (NEFSC 2003). Stock assessments indicate that total biomass was stable at a high level into the late 1990s, but, based on declines in targeted mature females, the stock was declared overfished in 1997. In the first stages of management, actual fishing mortality (F=0.27) greatly exceeded the target level (F=0.03) (MAFMC 2001). By 2002, fishing mortality had dropped to F=0.09, but still exceeded the rebuilding target by a factor of 3. Reproductive biomass peaked in 1989 and then declined by more than 75% by 2002 (NEFSC 2003). Average weight of landed females declined from 4 kg in 1987 to 2 kg in 2000 (Rago and Sosebee 2002). Recruitment estimates from 1997?2003 are the seven lowest in the 35-year time series. Average size of pups taken in surveys has also declined, consistent with new data regarding reduced average size of pups produced by smaller females. Reproductive potential is expected to continue to decline as these weak year classes mature. (NEFSC 2003). Overall, US federal efforts to manage the Northwest Atlantic stock for recovery have been hampered by delays, non-compliance and continued exploitation in state waters to supply European market demand. Whereas significant rebuilding (90% of SSB target) was anticipated by 2003, the population in 2005 had yet to show signs of recovery in mature females or significant improvement in recruitment. (ASMFC and MAFMC 2005). The U.S. Atlantic federal plan?s fishing mortality target was scheduled to increase from 0.03 to 0.08 in 2004 based on this stock rebuilding that was anticipated but not realized (MAFMC 2001). Increases in fishing mortality are now possible under the FMP, but scientists recommended maintaining a target fishing mortality rate of 0.03 because of lack of rebuilding. Under the most optimistic scenario, rebuilding will take at least 15 years. Recovery under the target fishing mortality rate (yet to be realized) could take three decades. Long term projections, which account for lower survivorship of pups, predict stock collapse under current fishing mortality (NEFSC 2003).

US commercial landings of spiny dogfish amounted to 1,170 mt (approximately 2.5 million lbs) in 2003 and 980 mt (roughly 2 million lbs) in 2004; total landings are approximately 99% was female (ASMFC and MAFMC 2005). NMFS reported Massachusetts landings for the fishing year spanning May 1, 2004 to April 30, 2005 at less than 1 million pounds; however, Massachusetts officials claim two processors in New Bedford processed about 2 million pounds, collectively during that time period (Pierce 2006). The average size of females landed is increasing over time, primarily due to a shift in fisheries (more landings from gill net and hook fishing, fewer from trawls). The ratio of total landings to numbers removed reveal that the number of females landed increased roughly 16-fold, indicating that the average size has greatly decreased. Dead discards from US commercial fisheries were estimated to be between 6,400 to 13,285 mt (14.1 and 29.3 million pounds) depending on the assumed discard mortality by gear type. Recreational landings of spiny dogfish increased from a very low number in 2000 to a high value of 81,972 animals in 2002. In 2005, the relevant scientific committee recommended the continuation of very low possession limits and a quota (?bycatch cap?) reduction of 50% (down to 2 million lbs annually). In recent years, the fraction of the dogfish population found in nearshore waters has increased markedly for unknown reasons (ASMFC and MAFMC 2005).

Resulting increased interactions with fishermen have sparked widespread demands for loosening dogfish restrictions.

The Dogfish Technical Committee in 2005 expressed concern about constraining effects that dogfish discards in commercial fisheries and the directed Canadian dogfish fishery are having on progress toward spiny dogfish population recovery. They recommended a 50% reduction in the quota (?bycatch cap?), continuation of low trip limits and measures to reduce discarding (ASMFC and MAFMC 2005). A full ?benchmark? population assessment for this stock is scheduled for July 2006.

In the Canadian Atlantic, dogfish are targeted in the Bay of Fundy, Scotian Shelf and Gulf of St. Lawrence. Foreign landings on the Scotian Shelf peaked at 24,000 t in 1972?1975, but were then replaced by national fisheries (ICES 1997). Atlantic Canadian landings prior to 1979 were insignificant (OWC 1996). A directed fishery then developed off the Maritimes and took off as the US fishery came under regulation. Canadian Atlantic landings increased from an average of 500 t from 1979-1988 to 1,800 t in 1994. After a subsequent decline to roughly 400 t in 1996 and 1997, catches (primarily from Nova Scotia) rose nearly six times from 1997 to 2001 (as U.S. regulations went into effect) and soon represented the largest proportion of the landings from the stock (NEFSC 2003). Canadian landings dropped slightly in 2002 and 2003, but were back up again in 2004 at 2336 mt (approximately 5 million lbs) allocated for the fishery as well as a 700-ton research fishery (ASMFC and MAMFC 2005). The driving force behind these fisheries continues to be international trade to satisfy the European market demand.

In 2003, Canada announced its intention to develop their own dogfish population assessment after a five year data collection program and their anticipation to maintain Canadian fishing effort, deemed unsustainable in U.S. assessments, in the meantime (Bundy 2003). Canadian Maritime officials note increased interest in the species from U.S. buyers and their industry?s reports of good markets for dogfish. According to Department of Fisheries and Oceans statistics, in just two years (1999 to 2001), the volume of dogfish exports doubled while its value nearly tripled.

At its annual meeting in 2005, Parties to the Northwest Atlantic Fisheries Organization (NAFO), in accordance with the recommendations from the 2002 NAFO Symposium on Elasmobranch Fisheries that ?the NAFO Scientific Council [be directed] to investigate the status and management needs of elasmobranchs in NAFO waters,? requested the NAFO Scientific Council (SC) to review all available information from both research vessel surveys and commercial catches on the stock structure, relative biomass, geographic distribution, life history, and size/age/sex composition of spiny dogfish (Squalus acanthias) occurring within the NAFO Regulatory Area. The SC was also requested to provide historical and recent information on catches and by-catches, and to identify those fisheries in which spiny dogfish is taken as bycatch.

This stock is currently assessed as Endangered (A2+4bd) on the basis of past and continuing declines, persistent market demand and targeted fishing, increasing discarding, and growing pressure to reopen fisheries. The population would be assessed as Vulnerable (A1) if science-based management measures were introduced and adhered to over the long term across the whole stock.

Eastern North Pacific:
Spiny dogfish have been fished in British Columbia (Canada) for over 4,000 years. More intense exploitation (for liver oil and meat) began in the late 1800s (Ketchen 1986) and evolved into the region?s most important shark fishery. By 1870, dogfish were surpassing whales in economic importance, producing 50,000 gallons of oil, mostly for export to Great Britain. In 1876, oil exports constituted at least 24% of the total value of all fish. Production peaked in 1883 at more than one million litres, equivalent to 9,000?14,000 t of round weight exports (Bonfil 1999). Ketchen (1986) speculates that a combination of factors (including the advent of petroleum lubricants, lighting fuels and electric lamps) led to fishery collapse around 1910. From 1917 to 1939, dogfish was used for fishmeal and meat exported to the US. Increased value of liver oil resulted in an expansion of the fishery and, by 1944, spiny dogfish supported the most valuable Canadian west coast fishery (Ketchen 1986). Landings reached 31,000 t then fell to <3,000 t in 1949. Fishable biomass had been reduced 75% (reviewed in Anderson 1990) by 1950, when the synthetic production of vitamin A led to the collapse of the oil market. Dogfish fisheries within this region were re-instituted in the mid 1970s as European and Asian markets for dogfish meat developed. Quotas of 3,000t within the Straight of Georgia and 12,000t for outside waters have been in place since the 1980s but as these are well over twice as high as any landings made since the 1940s collapse. Recent catch data for the northeast Pacific indicate a steep upward trend in landings since the early 1990s.

Washington state?s directed dogfish fishery was re-established by the early 1980s. Most of the state?s landings came from Puget Sound, yet both this and the coastal fishery have declined dramatically. Annual landings averaged 1,500 t between 1982 and 1998. Catches from Washington waters declined from a peak of 8.6 million pounds in 1979 to a less than 140,000 pounds in 2000. Puget Sound population estimates fell from 25?42 million pounds from 1987 to 1991 to less than 7 million pounds for comparable areas in recent years. Dogfish in Puget Sound are now taken primarily by recreational fishermen and as bycatch (Palsson 2005).

Spiny dogfish are also the predominant shark species taken off Alaska, which banned directed shark fishing in 1998, but where dogfish bycatch (90% discarded) comprises the bulk of shark landings (Camhi 1999). In 1997, over 1,000 t of total shark catches were reported from the region?s groundfish fisheries. Spiny dogfish in the Gulf of Alaska are now included in a category known as ?other species? for which limits are set at a percentage of the total allowable catch for target species. The North Pacific Fishery Management Council is in the process of changing the limit from 5% to
Based on a generation time of 42 years, the current three-generation period therefore commences in the 1870s, when liver oil production first peaked. This has been followed by several periods of boom followed by collapse. Recent analyses suggest that abundance of spiny dogfish in the Strait of Georgia, British Columbia has declined very slightly in recent years; landings of 1,200 mt annually on average over the last five years appear to be sustainable and catch per unit effort has remained constant (King and McFarlane 2005). However, the aggregating habit of spiny dogfish means that catch per unit effort (CPUE) is not an adequate indicator of stock status; high CPUE can be maintained even when populations are severely depleted. Scientists describe the overall Northeast Pacific dogfish population as stable, with a possible shift northward in distribution (McFarlane et al. 2005). This stock is likely still to be reduced to around 50% of baseline, although could be recovering under current low exploitation pressures. Recognizing much variation among regions with the Northeast Pacific, this population is considered to be Vulnerable.

Western North Pacific:
Japanese coastal and offshore fisheries (longline, trawl and gillnet) have historically taken large amounts of spiny dogfish and have shown similar patterns of decline to those in the North Atlantic (reviewed by Anon 2004). Catches dropped from more than 50,000 t in 1952 to only 10,000 t in 1965 (Taniuchi 1990) The following trends are reported by the Government of Japan Fisheries Agency (2003): offshore trawl catches of spiny dogfish were over 700 t in 1974?1979; since then, catches have decreased to 1?200 t in the late 1990s and up to 2001; catch rates for Danish seines and bull trawls fell from 100?200 kg per haul in the mid 1970s to 10?20 kg per haul in the late 1990s; this 90% reduction in CPUE (catch per unit effort) may indicate that stocks have declined to a similar extent during this period. According to the same source, in the Sea of Japan, spiny dogfish have been fully exploited with longlines and trawl-nets since before 1897. Harvests in this region from 1927 to 1929 were 7,500 to 11,250 t, accounting for 17?25% of Japan?s overall catch. Available statistics since 1970 show a decrease in CPUE from 8?28 units in the 1970s, to only 1?5 between 1995 and 2001, an overall decrease of around 80?90%. Spiny dogfish make up 16.8% of the shark bycatch associated with salmon gillnet fisheries (Nakano 1999). CPUE and stock assessment data are lacking, but the decline seems to be to less than 50% of baseline, fishing pressure continues, and no management is in place to enable the stock to rebuild. This stock is at least Endangered, but may prove to be Critically Endangered once a full regional review can be undertaken.

Australasia:
Considered coarse, dogfish meat is of little value to Australians (Last and Stevens 1994). Tasmanian recreational gillnet fisheries do, however, take substantial amounts (Simpfendorfer, pers. comm. in Fordham 2005).

Reported New Zealand landings increased from 3,000?4,000 t during the 1980s to 7,000?11,000 t from the mid 1990s to the mid 2000s (Manning et al. 2004, Sullivan et al. 2005). However some, if not most, of the apparent increase was probably a result of better reporting. It is not known if this level of fishing is sustainable, but catch rate analyses and trawl survey biomass indices show no sign of significant declines; indeed one of the main stocks on the Chatham Rise has shown a 5-fold biomass increase since 1991 (Manning et al. 2004, Sullivan et al. 2005). Population assessments for spiny dogfish off New Zealand are not yet available. Spiny dogfish were introduced to the New Zealand Quota Management System in October 2004 with a TAC of 12,660 t (M. Francis, pers. comm.). As such, this stock can be assessed as Least Concern.

South America:
Squalus acanthias is, together with the similar shortspine spurdog S. mitsukurii and shortnose spurdog S. megalops, one of the more important coastal commercial species in Brazil, where landings of the genus have declined considerably. It is also taken as bycatch in mixed demersal fisheries and the target fishery for Lophius gastrophysus. Unregulated and expanding target and bycatch fisheries take spiny dogfish in Uruguay and Argentina, where declines of ~50% have been reported (Massa et al. 2002). Patagonian trawlers fishing for hake and shrimp take a bycatch of spiny dogfish. Rising effort in these fisheries and a lack of bycatch control is considered to be a threat to this and other elasmobranch populations in the region (Van Der Molen et al. 1998). As in so many other regions, pregnant females are commonly targeted. The South American stocks are assessed as Vulnerable, but may prove to be Endangered when a more detailed regional review can be undertaken.

Southern Africa:
Spiny dogfish are considered a nuisance off South Africa and are not currently targeted. Demersal trawl dogfish catch for the South Coast was recently estimated at 4.7 t, 99% of which is discarded. Off the West coast, an estimated 3.4 t is taken annually (100% discarded). The lack of data on historical dogfish catch will make it difficult to monitor future trends.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

The spiny dogfish is considered to be the most abundant living shark, yet two particular subpopulations in the northwest and northeast Atlantic Ocean are considered to be at risk due to massive fishing pressure. This shark is caught for food, liver oil, and used to make sand paper, vitamins, leather, fertiliser, pet food and fish meal (1) (4). At a time of peak abundance between 1900 and 1910, it is estimated that up to 27 million spiny dogfish were caught off the Massachusetts coast every year (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Vulnerable (VU) (A2bd+3bd+4bd)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Despite several decades of warnings of unsustainable fishing pressure and reported steep stock declines, very few conservation or management measures are in place for spiny dogfish; measures in place have not been effective in terms of rebuilding populations. A notable exception may be New Zealand, where quotas have been introduced to limit catches to sustainable levels in response to the first signs of fishery development to meet European demand for meat. Spiny dogfish were brought under the New Zealand Quota Management System in October 2004 (M. Francis, pers. comm).

Holden (1968) first warned that part of the Northeast Atlantic stock was over-exploited, but there is still no effective management in this region despite wide-spread recognition that fishing levels are unsustainable and several parts of the stock have collapsed. A minimum landing size established in Norway in order to protect mature females is of limited value for a migratory species that is intensively fished in other parts of its range. Total Allowable Catches in EU waters, first established in 1998, have consistently exceeded recent landings and do not appear, therefore, to have had any constraint upon current unsustainable levels of fishing pressure. This fishery needs to be closed if the stock is to recover, ICES recommended a zero quota in 2006, but this advice was not heeded by the EU.

In the Northwest Atlantic, the 1999/2000 US federal dogfish rebuilding plan has yet to reverse population decline and fishing mortality targets continue to be grossly exceeded.

Federal Fishery Management Councils in the eastern US developed a spiny dogfish rebuilding plan in the late 1990s coincident with the stock being officially declared overfished. Low priority and controversy over cuts led to serious delays. Implemented in mid 2000, the plan aimed to rebuild the population through a low fishing mortality target (F=0.03) and corresponding quota (four million lbs) and trip limits (300 to 600 lbs for two periods) that would discourage targeted fishing and yet allow some landing of incidental catch. Once that the ten-year legal limit to recover the population became impossible, federal law allowed the rebuilding period to be extended, opening the plan up for relaxation of measures.

As Federal measures developed, the dogfish fishery shifted into state waters (within three miles from shore). Continued state fisheries have undermined the federal plan ever since. Most notably, Massachusetts, the Atlantic state with the largest directed dogfish fishery, adopted a 2000 state quota at nearly twice the Federal allotment for the entire Atlantic and excessive possession limits that allowed for continued directed dogfish fishing. Under the federal plan, overages are not deducted from the subsequent year?s quota.

n late 2002, the Atlantic States Marine Fisheries Commission (ASMFC) adopted a federally compatible dogfish rebuilding plan for state waters. In early 2003, however, the ASMFC rejected scientific advice and accepted a Massachusetts proposal to more than double the quota (to 8.8 million lbs) and increase trip limits by an order of magnitude (to 7,000 lbs) to allow directed dogfish fishing. The ASMFC did impose scientifically defensible limits for the 2004 fishing year (beginning in May), but rejected the 2005 advice for a 50% quota cut for 2006 in favour of the status quo (4 million lbs). This advice, from a joint state and federal technical committee, was also rejected by the New England Fishery Management Council, but adopted by the Mid-Atlantic Fishery Management Council (MAFMC). The decision on catch limits for the 2006 fishing season now lies with the NMFS, but pressure to relax recovery efforts is increasing due to the movement of a larger percentage of the population to nearshore waters and therefore fishing gear. The ability to set catch limits for a multi-year period (3 to 5 years) is currently being considered by both state and federal authorities and may be realized as soon as this year.

Canada began restricting Atlantic dogfish catch in May of 2002, following a significant increase in landings in years just prior. The government capped 2002 commercial landings at 2,500 metric tons for the fixed gear groundfish sector off Nova Scotia and in the Bay of Fundy, based on landings history at the time. In addition, bycatch caps for other fisheries consistent with historical landings and an additional 700 mt for a cooperative industry sampling program were granted. The Canadian government has stated that the caps are aimed to limit harvest while future sustainable catch levels are investigated. The Canadian government intends to maintain dogfish catches at roughly 3,200 mt for directed fishing and research while they collect data and develop their own population assessment, expected by 2007 (Campana 2002, pers comm).

In the Northeast Pacific, British Columbia spiny dogfish have been broadly and minimally managed through groundfish regulations since 1978. A quota of 3,000 tonnes has been in place for the Straight of Georgia (British Columbia) and 12,000 t for the rest of the Northeast Pacific for decades; landings in recent years average 1,200 tonnes under constant catch per unit effort and appear sustainable (King and McFarlane 2005). In 1998, Alaska prohibited commercial shark fishing, although experimental dogfish fisheries in the region are being authorized.

Washington includes dogfish in bottomfish management plans, but there are few species-specific measures. Concern over large catches from pupping grounds prompted closure of East Sound. In 2005, NMFS addressed concern over a growing directed Pacific spiny dogfish by imposing a control date of April 2005 as a first step to limiting entry into the dogfish fishery and announced trip limits of 100 to 200,000 lbs per two months for the last nine months of 2006. Trip limits were deemed necessary as a precautionary measure until the stock is assessed and subject to species-specific quotas. Other new measures include gear-specific and depth-based closed areas designed primarily to reduce mortality on overfished rockfish stocks, but expected to reduce fishing pressure on spiny dogfish. Although the U.S and Canada conduct cooperative surveys for Northeast Pacific spiny dogfish, there is no coordinated, international management for the stock (Camhi 1999).

There are no management programs for spiny dogfish in Australia (Simpfendorfer, pers. comm.), nor in Japan.

In southern Africa, South African fisheries for teleosts (mainly hake), which take dogfish as bycatch, appear to be managed sustainably although efforts to improve observer data for these fisheries have not yet been implemented.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

These sharks are especially vulnerable to over-fishing as they are slow to mature, have a very long gestation period, and produce very few young. Demand for these fish is highest in Europe, but they were commonly caught in American waters for export to Europe. The American National Marine Fisheries Services closed American waters to dogfish fishing in July 2003 on evidence that the population was on the edge of collapse (2). WWF have created a suggested recovery plan that aims to reduce exploitation to very low rates to allow recovery, and to reduce by-catch by avoiding areas with spiny dogfish. Monitoring and research on the spatial and seasonal patterns of distribution are also planned (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

This fish causes tremendous damage when packs of them become entangled in commercial fishing nets.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

This species is used for its oil and as fish meal. It is also a popular labratory animal. In some areas (Europe more than the U.S.), it is a popular food fish.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Importance

fisheries: commercial; gamefish: yes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Spiny dogfish

The spiny dogfish, spurdog, mud shark, or piked dogfish, Squalus acanthias, is one of the best known of the dogfish which are members of the family Squalidae in the order Squaliformes. While these common names may apply to several species, Squalus acanthias is distinguished by having two spines (one anterior to each dorsal fin) and lacks an anal fin. It is found mostly in shallow waters and further offshore in most parts of the world, especially in temperate waters.

Contents

Morphology and behavior

The spiny dogfish has dorsal spines, no anal fin, and white spots along its back. The caudal fin has asymmetrical lobes, forming a heterocercal tail. The species name acanthias refers to the shark's two spines. These are used defensively. If captured, the shark can arch its back to pierce its captor. Glands at the base of the spines secrete a mild poison.

Males mature at around 11 years of age, growing to 80–100 cm (2.6–3.3 ft) in length; females mature in 18–21 years and are slightly larger than males, reaching 98.5–159 cm (3.23–5.2 ft).[1] Both sexes are greyish brown in color and are countershaded. Males are identified by a pair of pelvic fins modified as sperm-transfer organs, or "claspers". The male inserts one clasper into the female cloaca during copulation.

Reproduction is aplacental viviparous, which was before called ovoviviparity. Fertilization is internal. The male inserts one clasper into the female oviduct orifice and injects sperm along a groove on the clasper's dorsal section. Immediately following fertilization, the eggs are surrounded by thin shells called "candles" with one candle usually surrounding several eggs. Mating takes place in the winter months with gestation lasting 22–24 months. Litters range between 2 and 11 but average 6 or 7.

Commercial use

Spiny dogfish are fished for food in Europe, the United States, Canada, New Zealand and Chile. The meat is primarily consumed in England, France, the Benelux countries and Germany. The fins and tails are processed into fin needles and are used in less expensive versions of shark fin soup in Chinese cuisine. In England this and other dogfish are sold in fish and chip shops as "rock salmon" or "huss", in France it is sold as "small salmon" (saumonette) and in Belgium and Germany it is sold as "sea eel" (zeepaling and Seeaal, respectively). It is also used as fertilizer, liver oil, and pet food, and, because of its availability, cartilaginous skull, and manageable size, as a popular vertebrate dissection specimen, in both high schools and universities.

Conservation status and management

A mountain of spiny dogfish.

Once the most abundant shark species in the world, populations of Squalus acanthias have declined significantly. They are classified in the IUCN Red List of threatened species as Vulnerable globally and Critically Endangered in the Northeast Atlantic, meaning stocks around Europe have decreased by at least 95%. This is a direct result of overfishing to supply northern Europe's taste for Rock Salmon, Saumonette or Zeepaling. Despite these alarming figures, very few management or conservation measures are in place for Squalus acanthias. In EU waters, a Total Allowable Catch (TAC) has been in place since 1999, but until 2007 it only applied to ICES Areas IIa and IV. It was also set well above the actual weight of fish being caught until 2005, rendering it meaningless. Currently (2009), the TAC stands at 316t for ICES Areas IIa & IV, 104t for ICES Area IIIa and 1,002t for ICES Areas I, V - VIII, XII & XIV. In addition, a maximum landing size of 100 cm has been imposed in order to protect the most valuable mature females. The European Commission has stated that the TAC for 2010 will be set at 0t, ending targeted fishing for the species in EU waters. It remains to be seen if populations will be able to recover.[2]

In the recent past the European market for spiny dogfish has increased dramatically, which led to the overfishing and decline of the species. This drastic increase led to the creation and implementation of many fishery management policies placing restrictions on the fishing of spiny dogfish. However, since the species is a late maturing fish, it takes a while to rebuild the population.

In 2010, Greenpeace International added the spiny dogfish to its seafood red list. "The Greenpeace International seafood red list is a list of fish that are commonly sold in supermarkets around the world, and which have a very high risk of being sourced from unsustainable fisheries."[3]. In the same year, the Convention on Migratory Species (CMS; also known as the Bonn Convention) listed the species (Northern Hemisphere populations) under Annex I of its Migratory Shark Memorandum of Understanding[4].

In recent years however, the US has implemented fishing controls and opened up the fishery. The current proposed quota for 2011 is 35.5m lbs. with a trip limit of 4000 lbs. This is a gain over past years in which the quota has ranged from 5-20m lbs. with trip limits from 2000- 3000 lbs.[5]. In 2010, NOAA announced the Eastern US Atlantic Spiny Dogfish stocks to be rebuilt [6] and in 2011 concerns about dogfish posing a serious predatory threat to other stocks resulted in an emergency amendment of the quota with nearly 15 million pounds being added [7] .

See also

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!