Overview

Brief Summary

Biology

Adult Atlantic mackerels form schools close to the surface; they have to swim constantly as they 'breathe' by a method known as ram ventilation, which requires a constant flow of water across the gill surfaces (5). They are active mainly in the day (2), and feed on small fishes such as sand eels (Ammodytes spp.), as well as small crustaceans, which are filtered from the water (4). They spend the winter in deep water, and stop feeding at this time (4); they migrate closer to shore during spring (2). During spawning, eggs and sperm are released into the sea. Both the eggs and larvae are pelagic; the eggs have a globule of oil, which keeps them afloat in the surface waters (4). Larvae begin to feed on copepods (tiny crustaceans) when they reach sizes of around 3mm. They will have grown to lengths of 25 cm after just one year. This is a long-lived species; the maximum recorded lifespan in the North Sea is 25 years (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Comprehensive Description

Description

 Atlantic mackerel are most readily identified by the strong dark markings on their back, which are oblique to near-vertical with relatively little undulation. The belly is unmarked and a mixture of silver and metallic blue in colour. Scomber scombrus is a streamlined fish with a total of 8-14 dorsal spines, 11-13 dorsal soft rays and 12-13 anal soft rays. They also show a conspicuous anal fin spine, joined to the fin by a thin membrane. They do not possess a swim bladder.

Shoals up to 9 km long, 4 km wide and extending 40 m deep have been reported. This species is a highly commercial species for trawlers but is also targeted by anglers and sport fishers (Lockwood, 1988).

A similar species, the Scomber japonicus, is also found in the English Channel during the summer. The species are distinguished by five small finlets between the second dorsal and tail fin, and between the anal fin and the tail of Scomber japonicus (Knijn et al., 1993).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Description

The Atlantic mackerel is a beautifully streamlined, fast-swimming fish. It has silver underparts and metallic green and blue upperparts with irregular bands along the back (3). It belongs to the same family as tuna (4), and is a highly commercial species (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

Abundant in cold and temperate shelf areas, forms large schools near the surface. They overwinter in deeper waters but move closer to shore in spring when water temperatures range between 11° and 14°C. Mainly diurnal, it feeds on zooplankton and small fish. Eggs and larvae are pelagic (Ref. 6769). Batch spawner (Ref. 51846). The species is traded fresh, frozen, smoked and canned. Eaten fried, broiled and baked (Ref. 9988). Two stocks in north-east Atlantic: North Sea (east) and British Isles (west). North Sea stock decreased dramatically in the 1960's because of direct overfishing. Recruitment has been poor and unstable. After spawning, the adult feed very actively moving around in small shoals (Ref. 35388). The South-West Mackerel Handline (http://www.msc.org/html/content_488.htm) and Hastings Fleet Pelagic Fishery Mackerel, (http://www.msc.org/html/content_1215.htm) fisheries of this species have been certified by the Marine Stewardship Council (http://www.msc.org/) as well-managed and sustainable.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

In the western Atlantic this species is present from Labrador to Cape Lookout, U.S. and in the eastern Atlantic from Iceland to Mauritania, including the southwestern Baltic Sea, the Mediterranean and Black seas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Labrador to Cape Lookout, N.C.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Belgian Exclusive Economic Zone, Birkenfels (shipwreck), Black Sea, British Isles, Canadian Exclusive Economic Zone [Arctic part], European waters (ERMS scope), Greek Exclusive Economic Zone, Gulf of Maine, Gulf of St. Lawrence, Irish Exclusive economic Zone, North West Atlantic, Polish Exclusive Economic Zone, Portugese Exclusive Economic Zone, Schelde estuary, Spanish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone, Wimereux
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Inhabits the north Atlantic Ocean, as well as the Baltic, Mediterranean and Black Seas. Along the coast of North America it is found from Labrador to Cape Lookout. There are two main stocks in the north-east Atlantic, the North Sea (east) and British Isles (west) (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North Atlantic.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 8 - 14; Dorsal soft rays (total): 113; Analspines: 1; Analsoft rays: 12 - 13; Vertebrae: 31
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 500 mm FL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

to 60 cm FL (male/unsexed); max. weight: 3,400 g.
  • Bigelow, H. B. and Schroeder, W. C., 1953; Collette, B. B. and C. E. Nauen, 1983; Frimodt, C., 1995; Whiteheat, P. J. P., Bauchot, M.-L., Hureau, J.-C., Nielsen, J., Tortonese, E., 1984.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

60.0 cm FL (male/unsexed; (Ref. 35388)); max. published weight: 3,400 g (Ref. 9988); max. reported age: 17 years (Ref. 207)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

This species has the following characters: no well developed corselet; interpelvic process small and single; anal fin spine conspicuous, joined to the fin by a membrane but clearly independent of it; anal fin origin opposite that of second dorsal fin; no swim bladder; first haemal spine anterior to first interneural process; 21-28 interneural bones under first dorsal fin; markings on back oblique to near vertical, with relatively little undulating; belly unmarked (Ref. 168).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This is a pelagic, oceanodromous species. It is abundant in cold and temperate shelf areas, and forms large schools near the surface. They overwinter in deeper waters but move closer to shore in spring when water temperatures range between 11° and 14°C. Mainly diurnal, it feeds on zooplankton and small fish. Eggs and larvae are pelagic.

Maximum size for this species is 66 cm, although fish greater than 50 cm are uncommon. This species matures at approximately age two (O'Brien et al. 1993), with 100% maturity at age seven in some populations of the eastern stock (Skagen 1989). For the Western stock longevity is estimated to be about 12 years (Gregoire 1993), and for the Eastern stock longevity is estimated to be 18 years (Villamor et al. 2001). Generation length is therefore conservatively estimated to be about 3.5 years in the Western stock and 6.5 years in the Eastern stock (Collette et al. 2011). Disparities in longevity between stocks may valid, or may be due to differences in methods of age determination, environmental factors, and/or response to fishing pressure over time.

Maximum Size is 66 cm fork length (FL). The all-tackle game fish record is of a 1.2 kg fish caught in the Kraakvaag Fjord, Norway in 1992 (IGFA 2011).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Known from seamounts and knolls
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

nektonic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Pelagic species found to depths of 200 m, overwinter near bottoms, move upward in spring.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 67873 specimens in 1 taxon.
Water temperature and chemistry ranges based on 52579 samples.

Environmental ranges
  Depth range (m): -9 - 1806.5
  Temperature range (°C): -1.960 - 23.535
  Nitrate (umol/L): 0.432 - 28.893
  Salinity (PPS): 7.677 - 38.781
  Oxygen (ml/l): 1.695 - 8.164
  Phosphate (umol/l): 0.094 - 2.034
  Silicate (umol/l): 0.987 - 46.672

Graphical representation

Depth range (m): -9 - 1806.5

Temperature range (°C): -1.960 - 23.535

Nitrate (umol/L): 0.432 - 28.893

Salinity (PPS): 7.677 - 38.781

Oxygen (ml/l): 1.695 - 8.164

Phosphate (umol/l): 0.094 - 2.034

Silicate (umol/l): 0.987 - 46.672
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

 Atlantic mackerel is a pelagic species that makes extensive migrations, and there are a variety of hydrographical features such as temperatures as well as the abundance and composition of zooplankton and other prey is likely to affect its distribution. Scomber scombrus can be extremely common and found in huge shoals feeding on small fish and prawns.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pelagic; brackish; marine; depth to 200 m. Cold and temperate shelf waters, schooling near the surface. Overwinter in deep waters, move closer to shore when water temperatures warm to 11° to 14°C.
  • Bigelow, H. B. and Schroeder, W. C., 1953; Collette, B. B. and C. E. Nauen, 1983; Frimodt, C., 1995; Whiteheat, P. J. P., Bauchot, M.-L., Hureau, J.-C., Nielsen, J., Tortonese, E., 1984.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

This pelagic fish lives in the open ocean (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

pelagic-neritic; oceanodromous (Ref. 51243); brackish; marine; depth range 0 - 1000 m (Ref. 54254), usually 0 - 200 m (Ref. 54254)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Mesodemersal. Abundant in cold and temperate shelf areas, forms large schools near the surface. They overwinter in deeper waters but move closer to shore in spring when water temperatures range between 11° and 14°C. Mainly diurnal, it feeds on zooplankton and small fish. In spring, the diet of the juveniles consisted of euphausiids, crustacean larvae and other zooplankton, whereas euphausiids formed 90% of the diet in adults (Ref. 55912). In autumn, juveniles ate hyperiids and gelatinous zooplankton, adults feed on blue whiting (Ref. 55912). Preyed upon by porbeagles, dogfish, Atlantic cod, bluefin tuna, swordfish, porpoises and harbour seals. Parasites of the species include monogenean, Kuhnia scombri on gills; trematodes, Podocotyle atomon and P. simplex; and nematodes, Anisakis simplex and Haematractidium scombri (Ref. 5951).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Zooplankton and small fish. Range: North Atlantic, including the southwestern Baltic Sea; eastern Atlantic including the Mediterranean and the Black seas; and western Atlantic from Labrador to Cape Lookout.
  • Bigelow, H. B. and Schroeder, W. C., 1953; Collette, B. B. and C. E. Nauen, 1983; Frimodt, C., 1995; Whiteheat, P. J. P., Bauchot, M.-L., Hureau, J.-C., Nielsen, J., Tortonese, E., 1984.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diseases and Parasites

Opechona Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Mazocraes Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lecithocladium Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Kuhnia Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ichthyophonus Disease. Fungal diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Haemormidium Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Grillotia angeli Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Thynnascaris Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Podocotyle simplex Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Mycobacteriosis. Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Coccidiosis. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Anisakis Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

Spawn in shallow water over the continental shelf in spring and early summer. Eggs and larvae planktonic.
  • Bigelow, H. B. and Schroeder, W. C., 1953; Collette, B. B. and C. E. Nauen, 1983; Frimodt, C., 1995; Whiteheat, P. J. P., Bauchot, M.-L., Hureau, J.-C., Nielsen, J., Tortonese, E., 1984.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Scomber scombrus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 20 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBGC0067-06|AB120717|Scomber scombrus| ACCCGCTGATTTTTCTCAACAAACCATAAAGACATCGGCACCCTCTACCTAGTATTTGGTGCATGATCTGGAATAGTTGGCACGGCCTTA---AGCTTGCTTATCCGAGCCGAACTAAGCCAACCAGGGTCCCTTCTCGGCGAC---GACCAAGTTTATAACGTAATTGTTACGGCCCATGCCTTCATTATAATCTTCTTTTTAGTAATACCAGTCATGATTGGAGGGTTCGGAAACTGACTTATCCCCCTAATG---ATCGGAGCCCCCGATATAGCGTTCCCCCGAATGAATAACATAAGCTTCTGACTTCTTCCCCCTTCTCTCCTACTACTCCTGTCTTCTTCGGCAGTTGAAGCTGGAGCCGGAACTGGCTGAACAGTCTACCCCCCACTAGCTGGTAACCTAGCGCATGCCGGGGCATCAGTTGACCTA---ACCATCTTCTCCCTTCACCTAGCAGGTGTTTCCTCAATTCTTGGGGCCATTAACTTCATCACAACAATTATTAATATGAAACCTGCAGGTATCTCTCAATACCAAACCCCTCTGTTCGTCTGAGCAGTCCTAATTACAGCTGTTCTTCTACTCCTATCTCTGCCAGTCCTTGCTGCC---GGCATTACAATGCTTCTAACTGATCGAAATCTTAATACCACTTTCTTTGACCCCGGAGGAGGAGGAGATCCTATTCTTTACCAACATCTATTCTGATTCTTCGGACACCCAGAAGTCTACATTCTTATCCTCCCAGGATTCGGAATGATTTCCCACATCGTTGCCTACTACGCCGGTAAAAAA---GAACCCTTCGGCTACATGGGCATGGTATGAGCCATGATGGCCATCGGCCTACTAGGCTTTATTGTCTGAGCCCACCACATGTTTACAGTTGGAATGG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Scomber scombrus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 20
Species: 77
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2011

Assessor/s
Collette, B., Boustany, A., Carpenter, K.E., Di Natale, A., Fox, W., Graves, J., Juan Jorda, M., Kada, O., Nelson, R. & Oxenford, H.

Reviewer/s
Russell, B. & Polidoro, B.

Contributor/s

Justification
This is a common and locally abundant species with fluctuating fishery landings. Based on a generation length range of 11–20 years, there has been a global SSB decline of between 3 and 14% over the past 11–20 years across the western and eastern stock. No information is available for the Mediterranean. It is listed as Least Concern. It is important to note however, that the greatest declines in SSB for this species occurred in the 1970s, before the time period comprising three generation lengths. Given that fishing mortality for the eastern stock is just above Fpa, careful fisheries management is needed. In addition, monitoring is needed as climate change may be causing shifts in this species distribution. The implications of these shifts and impacts on fishing effort and accessibility to the stock are unknown.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Widespread and common, but facing severe fishing pressure (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
There are two separate populations, eastern and western, with little or no interchange. Separate stock assessments are conducted for each (ICES and DFO+NOAA).

Eastern Atlantic
The east Atlantic Mackerel stock is currently considered to comprise three main unit stocks (southern, western and North Sea), with variable proportions of these three mixing in the northerly feeding grounds. The southern component spawns in Spanish and Portuguese waters, and the western component spawns in the Bay of Biscay and northwards around Ireland and west/northwest of the U.K. The eastern Mediterranean populations (Greece, Italy) are separated genetically from the western Mediterranean stock (Barcelona) which forms a panmictic unit with eastern Atlantic populations (Zardoya et al. 2004). The third component spawns in the North Sea and Sakgerrak. Although the North Sea spawners form to some extent a discrete unit from the other ones, commercial catches cannot be allocated to individual stocks, and therefore assessments are undertaken for the combined stock (ICES 2006).

For the Western Component, estimates of the spawning stock biomass (SSB), derived from egg surveys, indicate a decrease of 14% between 1998 and 2001 and a 6% decrease from 2001 to the 2004 survey. The results from 2007 indicate a 5 % increase from 2004 to 2007 (STECF 2009). For the North Sea Component, the 2002 and 2005 triennial egg surveys in the North Sea both indicate similar egg production, but in 2008 it has decreased by about 40% (STECF 2009). For the Southern Component, catches increased from about 20 000 t in the early 1990s to 44 000 t in 1998, and were close to 50 000 t in 2002. Estimates of SSB, derived from egg surveys, are highly variable, and give average estimates of around 16% of the combined North Eastern Atlantic mackerel stock (1995–2007) (STECF 2009). The main catches are taken in the North Sea (ca. 50%), the Norwegian Sea (10%), west of UK and Ireland (15–20%), south of Ireland and in the Channel (ca. 15%) and the rest in the southern area.

Based on the most recent ICES estimate of SSB in 2009, the eastern stock is classified as having full reproductive capacity. Fishing mortality in 2008 is estimated to be just above Fpa (precautionary fishing mortality). SSB has increased by 47% since 2002 and is currently estimated to be above Bpa (precautionary biomass). The 2002 year class is the highest on record. Subsequent year classes are estimated to be about average (STECF 2009). The SSB is expected to remain stable in 2011 for a catch in the range of 527,000–572,000 tons (STECF 2009).

Western Atlantic
The northwest Atlantic Mackerel stock has been evaluated jointly by NOAA in the US and DFO in Canada (TRAC 2010). There is a high degree of uncertainty in this assessment, and available data do not allow for estimation of biological reference points. The current recommendation is that catch not exceed the average total landings of 2006–2008 (80,000 mt) until more information is available (TRAC 2010).

Based on a generation length of between 3.5 and 6.5 years (Western and Eastern Stocks respectively), decline can be measured over a period of 11–20 years. The TRAC 2010 report shows a SSB decline in the Western Stock of approximately 53% over 20 years (1987–2008) and a 33% over 11 years (1997–2008). Based on the ICES 2009 assessment (ICES 2009), the eastern stock SSB has declined 10% over the past 20 years (1987–2008), with no decline over the past 11 years (1997–2008). Declines were calculated based on linear regression of SSB biomass over time. The most recent stock assessment (ICES 2009), the SSB in the eastern Atlantic was estimated to be 1,670,000 tonnes. The SSB for the western Atlantic stock is estimated at 144,000 mt tonnes (roughly ten times smaller) (TRAC 2010). Based on these proportions, there has been a total SSB decline of between 3 and 14% over the past 11–20 years across the global range of this species.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
This is a species with high commercial importance. It is caught with trawls, purse seines, gill and trammel nets. It is an important recreational species, fished with hook and line. Climate change may affect the distribution of this species, with possible movement towards the north, making it available for exploitation by additional nations. It is unknown whether this represents an expansion of habitat or if contraction will occur in the southern part of its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

The North Sea and British Isles stocks of Atlantic mackerel declined drastically during the 1960's as a result of overfishing (2). Indeed, like many commercial marine fishes, the Atlantic mackerel faces severe pressure from fishing throughout its wide range (6). The overfishing of stocks of commercial fish is a severe and complex problem around the world, with many well-known species including cod and plaice in serious decline and at risk of complete collapse (7). As the technology involved in fishing has improved and the number of faster, more efficient boats has increased, populations of fish have decreased further and have been unable to reproduce fast enough to compensate for the massive losses (7). The problem can be summed up as: 'too many boats chasing too few fish' (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Several eastern Atlantic countries have minimum landing sizes for this species: EU (18 cm), Ukraine (15 cm), Turkey (20 cm), Bulgaria (22 cm), Romania (23 cm).

ICES advises that any agreed total allowable catch (TAC) should cover all areas where Northeast Atlantic Mackerel are fished. The agreed management plan (F between 0.2 and 0.22) would imply catches between 527 000 t and 572 000 t in 2010. The SSB is expected to remain stable in 2011 for a catch in this range. ICES further advises that the existing measures to protect the North Sea spawning component remain in place. These include: areas restricted to fishing, seasonal closures, and minimum landing size (30 cm in North Sea and 20 cm in Skagerrak). In June 2009, an agreement was concluded between contracting parties to the Coastal States on mackerel banning high grading, discarding, and slipping from pelagic fisheries targeting mackerel, horse mackerel, and herring beginning in January 2010 (STECF 2009).

For the western Atlantic stock, there are no management measures in place. However, the most recent stock assessment recommends that annual total catches do not exceed the average total landings (80,000 mt tonnes) over the last three years (TRAC 2010).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

In Europe, the European Union is responsible for conserving and managing marine fish and their fisheries, with fisheries controlled by the Common Fisheries Policy (CFP) (6). However, in the past the CFP has not effectively controlled the fishing fleets of the EU; furthermore there are complex socio-economic issues involved in this controversial issue, with entire communities wholly dependent on the fishing industry (6). The International Council for the Exploration of the Seas (ICES) advises governments on the status of fish stocks, yet often their warnings have gone unheeded (7). The British Government has limited powers to initiate marine fisheries management measures. However, a grouped Action Plan for commercial marine fish has been produced under the UK Biodiversity Action Plan. This aims to minimise the collapse of local stocks of a number of commercially exploited marine fish (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: highly commercial; gamefish: yes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Atlantic mackerel

The Atlantic mackerel (Scomber scombrus), is a pelagic schooling species of mackerel found on both sides of the North Atlantic Ocean. The species is also called Boston mackerel, or just mackerel.

The Atlantic Mackerel is by far the most common of the ten species of the family that are caught in British waters. It is extremely common in huge shoals migrating towards the coast to feed on small fish and prawns during the summer.

Abundant in cold and temperate shelf areas, it forms large schools near the surface. They overwinter in deeper waters but move closer to shore in spring when water temperatures range between 11° and 14°C.

In north-east Atlantic: North Sea (east) and British Isles (west). The North Sea stock decreased dramatically in the 1960s because of direct overfishing.

Male and female Atlantic mackerel grow at about the same rate, reaching a maximum age of about 20 years and a maximum fork length of about 47 centimetres (19 in). Most Atlantic mackerel are sexually mature by the age of three years.

Contents

Fisheries

Capture of Atlantic mackerel in tonnes from 1950 to 2009

As food

A smoked Atlantic mackerel
Mackerel fillet in tomato sauce, a popular food in Scandinavia and the UK.

Atlantic mackerel are sought after for food either cooked or as sashimi. It consists mostly of red meat and has a strong taste desirable to some consumers. Atlantic mackerel is extremely high in vitamin B12. Atlantic mackerel is also very high in omega 3 (a class of fatty acids), containing nearly twice as much per unit weight as does salmon. Unlike King mackerel and Spanish mackerel, Northern Atlantic mackerel are very low in mercury, and can be eaten at least twice a week according to EPA guidelines[1][2].

Mainly in Scandinavia and the United Kingdom, canned mackerel in tomato sauce, brine, or vegetable oil, is sometimes eaten with salad or in sandwiches.

Mackerel is an excellent source of Phosphatidylserine as it contains approximately 480 mg / 100grams by weight. Phosphatidylserine is an important brain food that can have positive effects on ADHD and Alzheimer patients.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!