Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Comprehensive Description

Description

Common names: mackerel (English), caballa (Espanol), macarela (Espanol)
 
Scomber japonicus Houttuyn, 1782


Pacific chub mackerel,     Chub mackerel


Body elongate, rounded; fatty eyelid covering nearly all of eye; teeth at front and sides of roof of mouth; 2 well separated dorsal fins; first dorsal with IX-X spines, distance between the 2 dorsals less than length of base of first dorsal fin; 5 finlets after second dorsal and anal fins; pectoral fins high; tail deeply forked; two small keels on each side of the slender tail base; lateral line simple; entire body covered with small scales.



Silver; back with blackish, oblique wavy lines; no spotted lines on belly.


Size: attains 64 cm.

Habitat: epipelagic, coastal; occurs in schools and undergoes extensive summer migrations into temperate regions.

Depth: 0- 300 m.

Indo-Pacific; mainly in subtropical and temperate seas; in the eastern Pacific it ranges from Alaska to Chile and most of the offshore islands

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

A coastal pelagic species, to a lesser extent epipelagic to mesopelagic over the continental slope (Ref. 168). Schooling by size is well developed and initiates at approximately 3 cm (Ref. 168); may also form schools with Sarda chiliensis, Trachurus symmetricus and Sardinops sagax (Ref. 9340). Adults stay near the bottom during the day; go up to the open water at night, (Ref. 5377) where they feed on copepods and other crustaceans, fishes and squids (Ref. 168). They spawn in batches (Ref. 51846). Eggs and larvae are pelagic (Ref. 6769). In Asian waters, they move to deeper water and remain inactive during the winter season (Ref. 4576). Commercially cultured in Japan. Marketed fresh, frozen, smoked, salted and occasionally canned (Ref. 9684). Eaten fried, broiled and baked (Ref. 9988). Used in Chinese medicine (Ref. 12166).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species is widespread in the Pacific Ocean. In the Eastern Pacific, it ranges from Alaska to the Gulf of California and central Mexico, including the Revillagigedo Islands. It also occurs from Panama to southern Chile (45°,41'S), including the Cocos, Malpelo and the Galápagos Archipelago.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Azores, Black Sea, British Columbia, Canadian Exclusive Economic Zone [Pacific part], Coastal Waters of Southeast Alaska and British Columbia, Djibouti, Eritrea, European waters (ERMS scope), FAO fishing area 67, Greek Exclusive Economic Zone, Israeli Exclusive Economic Zone [Mediterranean part], Mozambique, North East Pacific, North Pacific, Portugese Exclusive Economic Zone, Red Sea, Somalia, South Africa (country), Spanish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth

Depth Range (m): 0 (S) - 300 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific


 
Global Endemism: All species, TEP non-endemic, Indo-Pacific only (Indian + Pacific Oceans), "Transpacific" (East + Central &/or West Pacific), West + East Pacific (but not Central)

Regional Endemism: All species, Eastern Pacific non-endemic, Tropical Eastern Pacific (TEP) non-endemic, Temperate Eastern Pacific, primarily, California + Peruvian provinces, primarily, Continent + Island (s), Continent, Island (s)

Residency: Resident

Climate Zone: North Temperate (Californian Province &/or Northern Gulf of California), Northern Subtropical (Cortez Province + Sinaloan Gap), Northern Tropical (Mexican Province to Nicaragua + Revillagigedos), Equatorial (Costa Rica to Ecuador + Galapagos, Clipperton, Cocos, Malpelo), South Temperate (Peruvian Province )

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-Pacific: anti-tropical, absent from the Indian Ocean except for South Africa, KZN to Western Cape (58304). Replaced by Scomber colias Gmelin 1789 in the Atlantic. Scomber australasicus is found in the Red Sea and the nothern Indian Ocean, its distribution overlaps with that of Scomber japonicus (Ref. 9684).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 9 - 11; Dorsal soft rays (total): 112; Analspines: 1; Analsoft rays: 12 - 14; Vertebrae: 31
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length max (cm): 64.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 640 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

64.0 cm TL (male/unsexed; (Ref. 9015)); max. published weight: 2,900 g (Ref. 26550); max. reported age: 18 years (Ref. 35185)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Description

Schooling by size is well developed and initiates at approximately 3 cm. May also form schools with @Sarda chiliensis@, @Trachurus symmetricus@ and @Sardinops sagax@ (Ref. 9340). Found near the surface of inshore and offshore waters (Ref. 11035). Feeds on copepods and other crustaceans, small pelagic fishes and squids. Eggs and larvae are pelagic. May migrate north during the summer and south during winter (to spawn) (Ref. 9340). Is preyed upon by tuna, marlins, other big fishes, sharks and pelicans (Ref. 9340). In St. Helena, generally captured at night when it moves near the surface to feed but occasionally caught during daytime in deep water. Also taken with encircling nets, set nets, beach seines and troll lines (Ref. 9340). Commercially cultured in Japan. Marketed fresh, frozen, smoked, salted and occasionally canned (Ref. 9684). Eaten fried, broiled and baked (Ref. 9988).
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Interpelvic process small and single. No well developed corselet. Swim bladder present. First haemal spine posterior to first interneural process; 12 to 15 interneural bones under first dorsal fin. Anal fin spine conspicuous, clearly separated from anal rays but joined to them by a membrane. Back with narrow stripes which zigzag and undulate. Belly unmarked (Pacific population) or with wavy lines (Atlantic pop.) (Ref. 168). Caudal peduncle with 5 finlets on the upper and lower edge. Distance between dorsal fins shorter than or equal to the first dorsal fin base (Ref. 35388).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This is a coastal pelagic species, that is to a lesser extent epipelagic to mesopelagic, over the continental slope. It is found to depths of 300 m. Schooling by size is well developed and initiates at approximately 3 cm (Collette and Nauen 1983). It may also form schools with Sarda chiliensis, Trachurus symmetricus and Sardinops sagax (Collette 1995). This species stays near the bottom during the day and goes up to the open water at night (Maigret and Ly 1986) where it feeds on copepods and other crustaceans, fishes and squid (Collette and Nauen 1983).

Spawning most often occurs at water temperatures of 15–20°C. This species spawns in several batches, with 250–300 eggs per gram of fish, with the total number of eggs per female ranging from 100,000–400,000.

This species has an average longevity of approximately seven years (Caramantin-Soriano et al. 2008), although longevity can be as high as 14 years based on size-frequency growth studies in the USA and Mexico (Dorval et al. 2007). Age of first maturity is approximately 2–4 years (Watanabe and Yatzu 2006, Gluyas-Millán and Quiñonez-Velázquez 1996). Generation length is therefore is estimated to be 4–6 years.

Maximum Size is 64 cm total length (TL). The all-tackle angling record is of a 2.17 kg fish caught off Guadalupe Island, Mexico in 1986 (IGFA 2011).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Known from seamounts and knolls
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 1286 specimens in 1 taxon.
Water temperature and chemistry ranges based on 680 samples.

Environmental ranges
  Depth range (m): -9 - 50000
  Temperature range (°C): 7.084 - 25.374
  Nitrate (umol/L): 0.069 - 33.602
  Salinity (PPS): 33.112 - 38.642
  Oxygen (ml/l): 0.299 - 6.218
  Phosphate (umol/l): 0.062 - 2.291
  Silicate (umol/l): 0.750 - 30.305

Graphical representation

Depth range (m): -9 - 50000

Temperature range (°C): 7.084 - 25.374

Nitrate (umol/L): 0.069 - 33.602

Salinity (PPS): 33.112 - 38.642

Oxygen (ml/l): 0.299 - 6.218

Phosphate (umol/l): 0.062 - 2.291

Silicate (umol/l): 0.750 - 30.305
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

pelagic-neritic; oceanodromous (Ref. 51243); marine; depth range 0 - 300 m (Ref. 168), usually 50 - 200 m (Ref. 35185)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 300m.
Recorded at 300 meters.

Habitat: pelagic. Found near the surface of inshore and offshore waters (Ref. 11035). Also demersal (Ref. 5313). Schooling by size is well developed and initiates at approximately 3 cm. May also form schools with @Sarda chiliensis@, @Trachurus symmetricus@ and @Sardinops sagax@ (Ref. 9340). Feeds on copepods and other crustaceans, small pelagic fishes and squids. In Asian waters, it is said to move to deeper water and remain inactive during the winter season (Ref. 4576). Preyed upon by tuna, marlins, other big fishes, sharks and pelicans (Ref. 9340). A female may produce over 1,000,000 eggs (Ref. 6885). Eggs and larvae are pelagic. Reported to live up to 9-10 years (Ref. 6885). Commercially cultured in Japan. Marketed fresh, frozen, smoked, salted and occasionally canned (Ref. 9684). Eaten fried, broiled and baked (Ref. 9988). Used in Chinese medicine (Ref. 12166).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Salinity: Marine, Marine Only

Inshore/Offshore: Offshore, In & Offshore, Inshore

Water Column Position: Surface, Near Surface, Mid Water, Water column only

Habitat: Water column

FishBase Habitat: Pelagic
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Seasonal migrations may be very extended, the fish in the northern hemisphere moving further northward with increased summer temperatures, and southwards for overwintering and spawning. The reverse pattern generally applies to populations in the southern hemisphere. Feeds on zooplankton such as copepod, krill and small fish (Ref. 39882, 54164) also on feeds on fish, plants and invertebrates (Ref. 9142).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Feeding

Feeding Group: Carnivore, Planktivore

Diet: octopus/squid/cuttlefish, Pelagic crustacea, zooplankton, pelagic fish eggs, pelagic fish larvae, bony fishes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Known predators

Scomber japonicus (chub mackerel) is prey of:
Homo sapiens
Merluccius
Scombridae
Argyrosomus hololepoditus
Seriola
Aves
Phocidae
Chondrichthyes

Based on studies in:
Japan (Brackish water, epipelagic zone)
South Africa, Southwest coast (Marine)

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Scomber japonicus (chub mackerel) preys on:
Sergia lucens
Parathemisto gracilis
Engraulis japonicus
benthic carnivores
mesozooplankton
macrozooplankton
Engraulidae
Etrumeus teres
Diaphus splendidus

Based on studies in:
Japan (Brackish water, epipelagic zone)
South Africa, Southwest coast (Marine)

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Spawning most often occurs at water temperatures of 15° to 20°C. Spawn in several batches with 250 to 300 eggs per g of fish with the total number of eggs per female ranging from 100,000 to 400,000.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Egg Type: Pelagic, Pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Scomber japonicus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 23 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBGCA626-10|NC_013723|Scomber japonicus| ACCCGCTGATTTTTCTCAACAAACCATAAAGACATCGGCACCCTCTACCTAGTATTTGGTGCATGAGCTGGAATAGTTGGCACGGCCTTA---AGCTTGCTTATCCGAGCTGAACTAAGTCAACCAGGGTCCCTTCTCGGCGAC---GACCAAATCTACAACGTAATTGTTACGGCCCACGCCTTCGTTATAATCTTCTTTTTAGTAATGCCAGTTATGATTGGAGGGTTCGGAAACTGACTGATCCCCCTAATG---ATCGGAGCCCCCGACATGGCATTTCCCCGAATAAATAACATAAGCTTCTGACTTCTGCCCCCCTCTCTCCTGCTGCTCCTGTCTTCTTCGGCAGTTGAAGCCGGTGCCGGAACTGGCTGAACAGTTTATCCTCCCCTCGCTGGGAACCTAGCACACGCCGGGGCATCAGTTGATTTG---ACCATCTTCTCACTCCACCTAGCAGGTGTTTCCTCAATCCTTGGGGCCATTAACTTCATCACAACAATCATTAACATAAAACCTGCAGGTGTATCCCAATACCAAACCCCTCTGTTCGTCTGAGCAGTCCTAATTACAGCTGTCCTTCTCCTTCTATCCCTACCAGTTCTTGCTGCC---GGCATTACAATGCTCCTAACAGACCGAAATCTAAATACTACCTTCTTCGACCCTGGAGGAGGGGGAGACCCCATTCTTTACCAACACCTCTTCTGATTCTTCGGCCACCCCGAAGTCTACATTCTTATTCTTCCAGGATTCGGAATAATCTCCCATATCGTTGCCTACTACGCCGGTAAAAAA---GAACCCTTCGGCTACATGGGCATGGTATGAGCCATGATGGCCATCGGCCTACTAGGCTTTATTGTATGAGCCCACCACATGTTTACAGTCGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Scomber japonicus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 23
Species: 47
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2011

Assessor/s
Collette, B., Acero, A., Canales Ramirez, C., Cardenas, G., Carpenter, K.E., Chang, S.-K., Di Natale, A., Fox, W., Guzman-Mora, A., Juan Jorda, M., Miyabe, N., Montano Cruz, R., Nelson, R., Salas, E., Schaefer, K., Serra, R., Sun, C., Uozumi, Y., Wang, S., Wu, J. & Yeh, S.

Reviewer/s
Russell, B. & Polidoro, B.

Contributor/s

Justification
This species is found in the northwestern Pacific, and in the southeastern and northeastern Pacific. Current assessment in the northwest Pacific indicate one stock is slightly increasing from record lows, and the other stock is also showing recent increases in spawning stock biomass. In the eastern Pacific, landings are also shown to be increasing, although historically there have been large fluctuations in the landing of this species. It is listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation status

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The total world catch of Scomber colias and Scomber japonicus went from 52,996 mt in 1960 to a maximum of 3,412,594 mt in 1978 and then dropping back off from 962,978 to 1,546,906 mt between 1990 and 1995 (Hernandez and Ortega 2000).

Eastern Pacific
In the Eastern Pacific, FAO reported landings from 1973–2005 fluctuate from 150,000 to 950,000 mt per year (FAO 2009). Although these landing data have fluctuated widely from 1995–2005, they have shown an apparent increase (Canales 2006). In Chile, Peru and Ecuador landing statistics over the past 10 years are highly fluctuating between 400,000 and 835,000 mt, with an increasing trend in reported catch landings (FAO 2009).

This species is not very heavily targeted in Chile (with average annual catches of 200,000 mt), but it is caught as bycatch. In general there is no well-developed fishery for mackerel in Chile. This species is targeted in Peru, but catch landings have fluctuated. Between 1985–2007, the highest landings of 390,000 mt were in 2002. However based on acoustic sampling, biomass since 1999 has been reduced likely due to a shift in abundance and changes water temperature (Cardenas pers comm 2008).

Northeast Pacific
An assessment of the northeastern Pacific stock that extends north of Ounta Abreojos, Baja California north to southeastern Alaska shows spawning stock biomass (SSB) in a period of low abundance from 1940–1977, and then increasing in the late 1970s reaching a peak of 662,372 mt in 1982. Since 1982 spawning stock biomass (SSB) has declined, reaching an estimate of 86,777 mt in 2007. The recommended harvest quota in the U.S. for the 2007–2008 fishing season is 361% higher than the 2006–2007 quota, and higher than the maximum yield since 1992–2003 (Dorval et al. 2007).

Northwest Pacific
Based on stock assessments of populations of this species in the Japan and the Tsushima Current between 1995–2005 (Watanabe 2009), SSB peaked in 1979 at 1,400,000 mt, and then declined to less than 38,000 mt in 2002, where it remained low but stable until 2004 when it increased to 300,000 mt in 2006 and then has slightly declined. In the Tsushima Current, SSB since 1973 averaged 350,000 mt, with a peak of 550,000 mt in 1989 and a low of 100,000 mt in 2004, and then has increased again to about 200,000 mt in 2006. Both stocks have increased in the past 10–12 years, likely due to better recruitment associated environmental changes and reduction in number of vessels and seasonal closures.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
This species is caught with purse seines, often together with sardines, sometimes using light. It is also caught with trolling lines, gill nets, traps, beach seines, and midwater trawls. It is taken in sports fishing in California, and in small purse seines. In Mexico, it is caught in small purse seines, drift nets and recreational fisheries.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Some countries have management schemes and local regulations to protect the stocks of this species (Collette and Nauen 1983). For example, the USA has catch quotas in place based on estimated population biomass. In the northeastern Pacific, current catch efforts are relatively low and in recent years, current catch is well below this recommended quota or harvest guideline.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: highly commercial; aquaculture: commercial; gamefish: yes; bait: usually
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Chub mackerel

The chub mackerel, Scomber japonicus, also known as the Pacific chub mackerel, closely resembles the Atlantic chub mackerel.

Contents

Identification

Chub mackerel

Most important of the differences, anatomically, is the fact that the hardhead has a well-developed swim bladder attached with the esophagus, which the "true mackerels" in the Scomber genus lack. But it is not necessary to open the fish to identify it for there is a characteristic color difference between them, the Atlantic being silvery-sided below the mid line, whereas the lower part of the sides of the hardhead (otherwise colored somewhat like the Atlantic) are mottled with small dusky blotches, and the chub has a larger eye than the Atlantic. Less obvious differences are that the dorsal fins are closer together in the chub and that there are only 9 or 10 spines in its first dorsal fin instead of 11 or more, which is the usual count in the Atlantic mackerel. In most species the mackerel is known to travel in large schools.

Habits

Chub mackerel school like Atlantic mackerel, and their feeding habits are much the same, eating the same species of pelagic crustaceans and Sagittae that the mackerel had taken at the same time and place, while specimens taken at Woods Hole had dieted chiefly on copepods, to a less extent on amphipods, salps, appendicularians, and young herring. They follow thrown bait as readily and bite quite as greedily as Atlantic mackerel do. Their breeding habits have not been studied.

Distribution

It is widespred in the Indo-Pacific. Absent from the Indian Ocean except for South Africa from KwaZulu-Natal to Western Cape. Replaced by the closly related Atlantic chub mackerel in the Atlantic.

Size

This is a smaller fish than its better known relative, growing to a length of about 8 to 14 inches.

Fisheries

Capture of chub mackerel in tonnes from 1950 to 2009

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Scomber colias formerly was considered to be conspecific with S. japonicus. Nelson et al. (2004) listed the two as distinct species.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!