Overview

Comprehensive Description

P. lethostigma is one member of a large family of distinctive benthic flatfishes that inhabit continental shore waters in the tropical and temperate zones of the Atlantic, Pacific and Indian oceans. Flatfishes such as the flounders are unlike most other fishes in that they begin life as bilateral animals, having equal right and left sides, and swim as do other fishes. However, toward the end of the larval period, flatfishes settle to the benthos and take up a cryptic, somewhat sedentary lifestyle, lying on one side of the body, and swimming laterally to the substratum. Metamorphosis to the juvenile stage involves complex modification of the skeletal structure of the head, and rearrangement of the nervous system and muscle tissues. Additionally, the eye on the side which faces the substratum (termed the blind-side eye) begins to migrate to the upper side of the body. P. lethostigma is a left-eye flounder, thus it lies on its right side, and at metamorphosis, the right eye migrates to the left side of the head. Lefteye flounders sometimes exhibit sexual dimorphism, with females having eyes that are closer together than in males, and males having somewhat longer pectoral fins (Rogers and Van Den Avyle 1983). Body color is light to dark brown with diffuse non-ocellated dark spots and blotches. The blindside is white or dusky. P. lethostigma are characterized by the following meristic (number of structures per body part) counts:
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Biology

Found mostly over mud bottoms in estuaries and coastal waters to about 40 m depth. A cryptic species; tolerates low salinities; occurs frequently in brackish bays and estuaries, even on occasion in fresh water (Ref. 9988). Taken by anglers inshore from bridges, jetties and small boats; this species moves to deeper water in winter, but is still easily accessible (Ref. 9988). Feeds chiefly on fishes, also on crabs and shrimps. Juveniles take mainly small bottom-living invertebrates. Marketed fresh and frozen; eaten steamed, fried, boiled, microwaved and baked (Ref. 9988).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Western Atlantic: North Carolina to Texas in USA, but absent from southern Florida.
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Paralichthys lethostigma is distributed from North Carolina to Jupiter Inlet, Florida, and from Caloosahatchee estuary, Florida, to Texas or northern Mexico (Munroe 2002).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic: North Carolina to Texas in USA, but absent from southern Florida.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: North Carolina to Jupiter Inlet, Florida, and from Caloosahatchee estuary, Florida, to Texas or northern Mexico; absent from southern Florida. Apparently most abundant in western Gulf of Mexico. Stocked in freshwater lakes near Austin, Texas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The southern flounder, Paralichthys lethostigma, occurs from North Carolina south through Florida and the Gulf of Mexico to Texas. The southern flounder occurs throughout the Indian River Lagoon.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Maximum size: 760 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

83.0 cm TL (male/unsexed; (Ref. 40637)); max. published weight: 9,330 g (Ref. 4699); max. reported age: 8 years (Ref. 46275)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Length: 66 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Southern flounder attain a size of up to 3 feet (91 cm) in length, and can weigh as much as 9 kg (24.1 lbs.) (Smith et al. 1999). The von Bertalanffy growth model predicts a maximum age for summer flounder of approximately of 20 years (Reagan and Wingo 1985).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Look Alikes

Paralichthys lethostigma is sometimes confused with P. albigutta, the gulf flounder. The two are easily distinguished based on the much smaller size of the gulf flounder, which grows only to 15 inches (38 cm). Additionally, the gulf flounder has 3 ocellated spots: 2 vertically placed posterior to the pectoral fins, and 1 placed inside the base of the tail.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

benthic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
P. lethostigma is an estuarine-dependent species which inhabits riverine, coastal and estuarine waters, and prefers muddy or silty substrates (Reagan and Wingo 1985). Individuals can tolerate wide temperature (~ 5-35°C) and salinity ranges (~ 0.0-60.0‰), and often enter freshwater. Tagging studies showed that tagged southern flounder are recaptured close to the tagging site within a year after they are released (Wenner et al. 1990, Monaghan 1992, Scharf et al. 2008). The distribution of P. lethostigma in Florida appears to be substrate related - it is typically associated with mud or silt substrates, while P. albigutta is found over sandy substrates (FWRI 2010).

Reproduction
Juveniles remain in the estuaries before becoming sexually mature and joining adults stocks after approximately two years . P. lethostigma spawns offshore between November and March in the U.S. South Atlantic (Safrit and Schwartz 1998). The oceanic larval stage is pelagic and lasts 30 - 60 days. Metamorphosing individuals enter estuaries and migrate towards low-salinity headwaters to settle (Burke et al. 1991, Walsh et al. 1999). Southern flounder is fast growing, with early maturity and a moderately short lifespan. Many females (94%) reach maturity by the end of their second year, and the oldest individual recorded was 9 years old (Takade-Heumaker and Batsavage 2009) at sizes ranging from It is important to note that recent research has shown that Southern Flounder may mature at larger sizes and older ages than previously thought (Midway and Scharf 2011). This species is sexually dimorphic, with females reaching approximately 80 cm TL and males only reaching about 40 cm TL.

In the Gulf of Mexico, adults move out of the estuaries to spawn in the Gulf of Mexico from October to February (Reagan and Wingo 1985).

Generation Length Calculation
94% of females reach maturity at the end of 2nd year longevity is maximum 9 years.

Members of the Paralichthyidae family are bottom-dwelling predators, usually burrowing partially or almost entirely in sand or soft mud. They are capable of a rapid change in coloration which allows them to match their background almost perfectly. Most appear to feed on or near the bottom, but some of the larger species will rise off the bottom to capture prey. Most occur in shallow water, although some species also occur at slope depths (greater than 200 m) (Munroe 2002).


Systems
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

demersal; brackish; marine
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 456 specimens in 1 taxon.
Water temperature and chemistry ranges based on 100 samples.

Environmental ranges
  Depth range (m): 0 - 223
  Temperature range (°C): 16.407 - 25.874
  Nitrate (umol/L): 0.286 - 10.594
  Salinity (PPS): 33.723 - 36.472
  Oxygen (ml/l): 3.530 - 5.755
  Phosphate (umol/l): 0.093 - 0.783
  Silicate (umol/l): 0.756 - 5.295

Graphical representation

Depth range (m): 0 - 223

Temperature range (°C): 16.407 - 25.874

Nitrate (umol/L): 0.286 - 10.594

Salinity (PPS): 33.723 - 36.472

Oxygen (ml/l): 3.530 - 5.755

Phosphate (umol/l): 0.093 - 0.783

Silicate (umol/l): 0.756 - 5.295
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Freshwater

Comments: Coastal and estuarine waters; seems to prefer muddy substrates. Often enters fresh waters. Spawns offshore; adults move out of estuaries and bays; postlarvae and juveniles move into estuaries from January to early summer (Manooch 1984).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Migrates between spawning and nonspawning habitats (Manooch 1984).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Found mostly over mud bottoms in estuaries and coastal waters to about 40 m depth. A cryptic species; tolerates low salinities; occurs frequently in brackish bays and estuaries, even on occasion in fresh water. Feeds chiefly on fishes, also on crabs and shrimps. Juveniles take mainly small bottom-living invertebrates.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Small individuals eat mysid and penaeid shrimps and other small crustaceans; large individuals eat blue crabs, penaeid shrimps, and fishes; feeds by partly burying in sand and ambushing prey (Manooch 1984).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Southern flounder are carnivorous fishes that are generally considered to be top or near-top predators. Larvae reared under laboratory conditions begin feeding on rotifers 4 - 6 days posthatch. By 8 - 13 days posthatch, larvae begin to feed on newly hatched Artemia nauplii (Denson and Smith 1997).Small southern flounders consume a wide variety of invertebrate prey, but upon reaching approximately 20 mm total length (TL), they become primarily piscivorous (Reagan and Wingo 1985). Based on differences in morphology and behavior between summer flounder and southern flounder in North Carolina, Burke (1995) compared prey distribution and feeding ecology between the 2 species following metamorphosis to the juvenile stage. Southern flounder juveniles have generally larger mouths, larger, inwardly curved teeth, and fewer, heavier gill rakers than do summer flounder. They also tend to remain still on the bottom, waiting for prey to come within striking distance (Minello et al. 1987; Burke 1995). Small southern flounder primarily consumed amphipods and mysid shrimp, followed by copepods, insects, fish and invertebrate parts. In this study, summer flounder 20 - 60 mm SL consumed spionid polychaete worms, followed by clam siphons, mysid shrimp, calanoid copepods, the blue crab, Callinectes sapidus, and small fishes. From this data, Burke (1995) concluded that post-settlement differences in feeding habits developed between the 2 species, with southern flounder shifting to more mobile prey which could be attacked from below, and summer flounder continuing to feed upon benthic prey organisms.The adult diet of P. lethostigma consists primarily of fish, but is augmented by crustaceans depending upon regional location. In Louisiana, adult southern flounders eat shrimp and fish; though, Fox and White (1969) reported that the primary prey species for southern flounder was striped mullet (Mugil cephalus). Also included in the diet are fat sleepers (Dormitator maculatus) and anchovies (Anchoa spp.). Larger flounders (150 mm long) ate primarily anchovies, menhaden (Brevoortia spp.), sciaenids, and mullet (Reagan and Wingo 1985).Habitats: Adult P. lethostigma spend the warmer months in coastal embayments and riverine habitats in the upper reaches of estuaries (Rogers and Van Den Avyle 1983). Many adults migrate to offshore spawning grounds during late fall and winter, though some do remain in estuaries year-round. Larvae spawned offshore make their return to estuarine habitats by passive transport on nearshore and tidal currents. In a study conducted in North Carolina, Burke et al. (1991) reported that peak recruitment into estuaries by late stage (stage 4b and 5), premetamorphic larvae occurred in February, though larvae were collected from late November through mid-April. These larvae settled into tidal mudflats near the head of the estuary, however, in spring, southern flounder apparently migrated upstream into riverine habitats. Spring through summer, southern flounder prefer the silt and mud substrata of coastal bays and river systems, and become most common in the upper reaches of estuaries, sometimes entering freshwater (Burke et al. 1991; Smith et al. 1999).In a comparative study, Burke et al. (1991) reported that larvae of both southern and summer flounder recruit into estuaries during the same period, and for a time, show considerable overlap in distribution within an estuary. However, segregation occurs quickly (Burke et al. 1991; Burke 1995). Premetamorphic larvae of southern flounder tend to concentrate on tidal flats in the upper reaches of estuaries where salinity ranges from 9 - 25 ?, and the substratum consists of 4 - 45 % sand. Conversely, premetamorphic larvae from summer flounder generally move into silt and mudflat areas in the lower and middle reaches of estuaries where salinity ranges from 24 - 35 ? and the substratum consists of 50 - 95 % sand (Burke et al. 1991). Capture data following segregation of the 2 species within the Newport River Estuary, North Carolina, showed that summer flounder were most common on sand flats than on mudflats in the lower estuary, while there was little difference in capture rates among southern flounder in sandy vs. muddy substrates in the upper reaches of the estuary. Burke et al. (1991) concluded that settlement in P. dentatus is most likely influenced by substratum type, while that of P. lethostigma is influenced by salinity.Activity Time:A tank study showed that southern flounder tend to be more active at night than during the day (Reagan and Wingo 1985).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

P. lethostigma is one of the largest and most commercially valuable flounders in the western North Atlantic (Burke et al. 1991).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

Spawns in fall and winter; eggs hatch in about 3 days at 63 F; sexually mature in 2 years (Manooch 1984).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Adults migrate to offshore spawning grounds during late fall and winter, though some remain in estuaries year-round. Spawning migrations are usually preceded by a drop in water temperature of 4 - 5 ° C. Males move seaward earlier than females, with few remaining in estuaries after November (Reagan and Wingo 1985). In North Carolina, southern flounders begin migration in the fall; in Texas, they migrate from October through December (Reagan and Wingo 1985).Laboratory experiments from Texas indicate that approximately 3 weeks before spawning takes place, male southern flounder begin following gravid females. In tank experiments, the first spawning was in December and occurred at midday. Females swam to the surface and released eggs that were immediately fertilized by attending males. Fertilization was 30% to 50% successful, and 6% to 35% of the eggs hatched within 61 - 76 hr (Reagan and Wingo 1985).Females become sexually mature at 2 years of age in Texas, while the youngest mature female southern flounder in northern Florida was 4 years old (Reagan and Wingo 1985).Thirteen southern flounders examined in the laboratory, produced a total of 120,000 eggs (approximately 9,230 eggs per female) (Reagan and Wingo 1985).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Growth

Eggs of P. lethostigma range from 0.85 - 0.95 mm in diameter (Powell and Henley 1995), with a single oil globule. Laboratory rearing of southern flounder shows that eggs hatch after 3 days at 18° C and 30? salinity (Denson and Smith 1997). Larvae begin to feed when 4 -6 days old, and show signs of becoming premetamorphic by day 14. By day 16, larvae begin to settle out of the water column and congregate on the bottom. By day 21, larvae show signs of adult pigmentation, and begin to rest on their left sides, though their eyes remain in position. By day 23, metamorphosis is initiated and the left eye begins to migrate to the right side. Most animals had completed metamorphosis by day 36 (Denson and Smith 1997). In culture experiments, yolk-sac larvae began metamorphosing to postlarvae at 40 - 46 days, when they were approximately 8 - 11 mm in length. Metamorphosis to the juvenile stage was complete by 50 - 51 days (Reagan and Wingo 1985). Data from Powell and Henley (1995) show that larvae complete metamorphosis when they reach approximately 8.7 - 9.0 mm SL. By this time, the migrating eye has reached the dorsal midline, and the larval stage is complete.Powell and Henley (1995) examined egg and larval development in both P. lethostigma and P. albigutta. Results from their study show that fins begin to develop when larvae reach approximately 5.4 mm notochord length (NL). The dorsal fin is generally the first to begin development, followed by the caudal, anal, pelvic, and pectoral fins (Powell and Henley 1995). Development of the caudal fin in P. lethostigma can begin when larvae are approximately 5.5 mm NL, but fin rays are not observed until larvae attain 8.2 mm SL. Dorsal fins begin to develop when larvae are in the preflexion stage, at approximately 6.5 mm NL. The dorsal fin is first observed in the head region, with development proceeding posteriorly. By the time larvae reach 8.4 mm standard length (SL) the dorsal fin is fully developed. Following postflexion, when larvae reach approximately 7.3 mm standard length (SL), anal fin rays begin to develop, with the full adult complement of fin rays reached at a body size of 8.4 mm SL. Pelvic fins are first observed on larvae at approximately 8.2 mm SL, and are fully developed by the time larvae attain 9.7 mm SL. Pectoral fins first begin formation when larvae are approximately 8.4 mm SL, and are fully formed when larvae exceed 11.0 mm SL.Pigmentation is first observed in middle-stage eggs, following blastopore closure. In larvae, pigmentation is more pronounced in the caudal area, being less developed overall in P. lethostigma than in its close relative P. albigutta, the gulf flounder (Powell and Henley 1995).Larvae spawned offshore in the Atlantic Ocean make their return to estuarine habitats by passive transport on nearshore and tidal currents from November through April, with a peak in recruitment occurring in February (Burke et al. 1991). In the gulf of Mexico, Southern flounder postlarvae are caught along the Gulf of Mexico coast during winter and early spring. At Galveston Island, Texas, southern flounder postlarvae 18 - 34 mm in total length (TL) were captured during February, March, and May. Fish 25 - 51 mm TL were caught in the Mississippi River during the spring. In Aransas Bay, Texas, the peak movement of postlarvae flounders into estuaries is in February, when water temperature is 16.0 - 16.2 °C (Stokes 1977).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Paralichthys lethostigma

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 14
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Paralichthys lethostigma

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATCTCGTATTTGGTGCCTGAGCCGGAATAGTGGGGACAGCCCTAAGTCTACTCATTCGAGCAGAACTAAGCCAACCTGGCGCCCTCCTGGGCGATGACCAGATCTATAACGTAATCGTTACTGCACACGCCTTTGTAATAATCTTTTTTATGGTAATACCAATTATGATCGGAGGATTTGGCAACTGACTTATTCCTCTAATAATTGGTGCCCCGGATATAGCATTTCCTCGAATAAACAATATAAGCTTTTGACTCCTACCCCCTTCATTTCTTCTCCTTTTAGCCTCCTCAGGTGTTGAAGCTGGAGCTGGCACCGGATGAACTGTCTATCCCCCTCTAGCCAGCAACCTTGCTCATGCCGGGGCCTCTGTAGACCTAACTATTTTTTCACTCCACCTTGCAGGAATCTCCTCAATTCTAGGAGCTATCAACTTCATTACAACCATTATTAATATGAAACCTACAACCATAACCATGTATCAAATACCCCTATTTATTTGAGCTGTACTCATTACAGCCGTCCTATTACTCCTATCTCTTCCAGTCCTAGCCGCCGGCATTACTATACTACTAACGGACCGTAACCTAAATACAACTTTCTTCGACCCTGCAGGAGGGGGAGACCCAATTCTCTACCAACACCTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
NatureServe

Reviewer/s
Smith, K. & Darwall, W.R.T.

Contributor/s

Justification
Paralichthys lethostigma is distributed from North Carolina to Jupiter Inlet, Florida, and from Caloosahatchee estuary, Florida, to Texas or northern Mexico. The Atlantic and Gulf of Mexico populations of this species are genetically divergent separate evolutionary units, and some authors have noted that the degree of genetic differentiation is sufficient enough to warrant a sub-species designation. P. lethostigma is an estuarine-dependent species which inhabits riverine, coastal and estuarine waters, and prefers muddy or silty substrates. Individuals can tolerate wide temperature and salinity ranges, and often enter freshwater. Tagged southern Flounder were typically recaptured close to the tagging site within one year of release. P. lethostigma spawns offshore. the majority (94%) of females reach maturity at the end of 2nd year/beginning of the 3rd year. After spawning, juveniles recruit to estuaries where they remain for two years before becoming sexually mature and joining adults stocks. P. lethostigma spawns offshore between November and March in the U.S. South Atlantic. In the Gulf of Mexico, adults move out of the estuaries to spawn in the Gulf of Mexico from October to February (Reagan and Wingo 1985)

This is a major commercial and recreational flatfish species throughout its range, though it is a component of much larger commercial fisheries in the Atlantic, off the coast of North Carolina. Management of this species is the responsibility of the respective states in the Gulf and on the Atlantic. Cooperation is achieved amongst states through entities such as the Mid-Atlantic Fishery Management Council and the Gulf of Mexico Fishery Management Council. As of 2004, the majority of annual commercial landings were from the Atlantic population, in North Carolina (3.5 million pounds), while in the Gulf region approximately 300,000 pounds were landed commercially. In the Atlantic, it is harvested primarily from North Carolina which performs thorough stock assessments. In the Gulf of Mexico, this species is managed at the state rather than the regional level, though there is interest in performing a Gulf-wide assessment of this species.

In the Atlantic, Southern Flounder is considered a Depleted Stock by the State of North Carolina, the only state which generates stock assessments for this species. It has been considered overfished since 1991, and there is no clear trend in abundance despite reduced fishing pressure and increases in estimates of Standing Stock Biomass (SSB). This may be a result of the systematic over-estimation of age-0 and age-1 fishes due to the inability of stock assessments to account for all sources of removal of young fishes from the population, notably by the shrimp trawl fishery. Declines in the Atlantic population have been attributed to the use of estuarine gill-nets, which selectively remove sexually-immature individuals of age classes 1 and 2. Declines in the commercial and recreational sectors have also been recorded for the Atlantic coast of the state of Florida, which landed about 300,000 lbs in 2009.

In the eastern and central Gulf of Mexico, stock assessments are performed by the states of Florida and Louisiana. In both states, these assessments are performed for all flounder species, and trends appear to be stable. However the status of P. lethostigma in particular is unknown. It does not appear to be the dominant component of flounder catches east of the Mississippi river delta, where it is replaced by P. albigutta.

In the western Gulf of Mexico, where P. lethostigma comprises the large majority (95%) of all flounder species, assessments are performed in the state of Texas. Analysis of long-term population trends in Texas found that that both juveniles and adults have been continuously declining, with rates of decline in abundance of juveniles estimated at 1.3% per year, while those for adults are nearly double, estimated at 2.5% per year. These declines have been attributed to commercial and recreational over harvesting as well as by-catch mortality from the shrimp trawl fishery.

In addition to being commercially important, P. lethostigma is heavily impacted by by-catch mortality, primarily from shrimp trawling. This threat is not clearly understood, however declines in abundance in both the Western Gulf of Mexico and off the coast of North Carolina have been attributed to shrimp trawling. In Texas, shrimp trawling is considered to be a major contributor to declines in abundance.

Several factors are of great concern with regards to the status P. lethostigma: It is known to have been overfished in parts of its range and is dependent on management efforts in order to sustain its population. In the absence of a Gulf-wide assessment of this species, and given that it has been systematically overfished throughout its range, particularly in the Atlantic, and given that the impact of by-catch mortality is substantial but unquantifiable at this time, P. lethostigma is listed as .



[[[Previously Assessed by FW Unit; text previously in this rationale: Listed as Least Concern in view of the large extent of occurrence, large number of subpopulations, large population size, and lack of major threats. Trend over the past 10 years or three generations is uncertain but likely relatively stable, or the species may be declining but not fast enough to qualify for any of the threatened categories under Criterion A (reduction in population size).]]]]
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Distribution of abundance
Paralichthys lethostigma is absent everywhere on the lower east coast of Florida, from the Loxahatchee River, and the southwest coast of Florida south of Tampa, except in the Caloosahatchee River estuary. In the Gulf of Mexico, P. lethostigma are most abundant in the northwestern Gulf (Nall 1979). It is the most common Paralichthys in Mississippi and Alabama (Christmas and Waller 1973, Swingle 1971).

Population Genetics and stock management
Studies using microsatellite DNA markers have found the Gulf of Mexico and Atlantic populations of Southern Flounder are genetically distinct and should be managed separately. Some authors have suggested that genetic divergence is significant enough to warrant sub-species designation (Anderson et al. 2012). Additionally, there is evidence for some isolation by distance between eastern and western populations in the Gulf of Mexico (Blandon et al. 2001), and it has been suggested that for the purposes of stock enhancement, any strategy in the Gulf should necessarily include eastern and western stocking areas, with the boundary between Matagorda Bay and Galveston Bay, Texas (Anderson et al. 2012). The Food and Agriculture Organization (FAO) does not collect catch statistics for this species.

As of 2004, the majority of landings were from the Atlantic population, in North Carolina (3.5 million pounds), while in the Gulf region approximately 300,000 pounds were landed.

Atlantic Population

The largest fishery for P. lethostigma on the Atlantic Coast is in North Carolina. This state appears be the only state on the Atlantic Coast of the USA which collects species-specific fisheries data and performs stock assessments on P. lethostigma. Stock assessments are performed under the management of the Atlantic States Marine Fisheries Commission (ASMFC). For the purposes of stock assessment, and due to several studies which have shown that tagged Southern Flounder in North Carolina are typically recaptured near the tagging site within one year of tagging (Wenner et al. 1990, Monaghan 1992, Scharf et al. 2008), Southern Flounder in North Carolina are considered a unit stock (Takade-Heumacher and Batsavage 2009). Based on the North Carolina assessments from 2009, the Southern Flounder Stock on the Atlantic Coast is Depleted (definition of Depleted: Depleted stocks are those stocks where the spawning stock abundance is below a predetermined threshold or where low stock abundance precludes an active fishery) due to recorded over harvesting which has occurred since 1991 (Takade-Heumacher and Batsavage 2009; NCDMF 2012). Several trends are worth noting:

1) Fishing Mortality: The overall trend of fishing mortality (F) is a recent decline from the earlier part of the time series. Fishing mortality peaked twice, once in 1994 at 1.5693 and again in 2002 at 1.6511 (Figure 17 and Table 25). After 2004, there is a sharp drop in F to the lowest F in the time series in 2005 at 0.6813. Since 2005, F has increased to 0.7534 in 2007.

2) Estimates of Spawning Stock Biomass: Estimates of spawning stock biomass have increased in recent years from an earlier plateau. In 1991, the estimated SSB was 4,080,760 lb, with the highest SSB occurring 2005 at 4,381,680 lb (Figure 19 and Table 29). The lowest SSB occurred in 2000 at 2,202,480 lb. From 2003 to 2005, there was a notable increase in SSB from 2,218,950 lb to 4,381,680 lb. Since 2005 there has been a slight increase in SSB to the terminal year value of 4,358,990 lb.

3) Abundance: There is no clear trend in abundance despite reduced fishing pressure, which may be a result of the systematic over-estimation of age-0 and age-1 fishes due to the inability of this assessment to account for all sources of removal of young fishes from the population, notably by the shrimp trawl fishery. Only one year prior to 1997 had a total abundance less than 17 million fish, while eight years had a total abundance less than 17 million fish since 1998. The age-1 abundance showed a slight declining trend and age-2 fish varied in abundance with a slight decline through much of the time series (Figures 22 and 23). The highest abundance for ages 3 through 6+ fish have occurred most recently from 2005 through 2007 (Figures 24-27). Over half of the stock was estimated to be age-0, with the only notable shift in age structure a small increase in older fish (ages 3 through 6+) in the last two years of the assessment.

Total commercial harvest in 1991: 4,437,048 pounds
Total commercial harvest in 2007: 2,810,416 pounds

Atlantic population: Trends in Florida (from FWRI 2010)
In Florida, commercial catch statistics for P. lethostigma are lumped with those for P. albigutta and P. dentatus. Atlantic coast recreational landings are almost exclusively P. lethostigma. The species composition in commercial landings appears to be similar to that in recreational landings (Murphy 1994).

Recreational: In Florida, the majority of landings are on the Atlantic side (304867 lbs in 2009), and are from the recreational sector (68% in 2009). The recreational catch rates (numbers of fish/trip) decline steadily from 1991 - 2009, with the sharpest decreases occurring from 1997 to 2000, and remaining below 1 fish per trip. Annual standardized catch per unit effort (CPUE) estimates for Atlantic recreational fishers in Florida were relatively stable until 1994, increased through 1997, and have shown a decline to 2001 (Florida Marine Research Institute (FMRI) 2003).

Commercial:
Commercial catch rates fluctuate around 20lbs/trip from 1992 - 2008, however there is a marked increase from 2003 - 2004, followed by a sharp decline from 2004 - 2008 (FMRI 2010).


Gulf of Mexico Population
Stock Assessments in the Gulf of Mexico
As of 2000, a paucity of data prevented a complete Gulf-wide stock assessment for the flounder fishery, which primarily includes Southern Flounder (P. lethostigma). Southern Flounder represents 95% of harvested flounder in the Gulf (Froeschke et al. 2011; VanderKooy 2000). Southern Flounder in the Gulf display a skewed sex ratio which may limit reproduction (). The management of Southern Flounder is the responsibility of the respective states, which achieve cooperation un

Florida - status unknown
In Florida, commercial catch statistics for P. lethostigma are lumped with those for P. albigutta and P. dentatus. Atlantic coast recreational landings are almost exclusively P. lethostigma, while Gulf coast landings are mostly P. albigutta. The species composition in commercial landings appears to be similar to that in recreational landings (Murphy 1994). Therefor the following is more pertinent to P. albigutta:

Total landings of all flounder species on both the Atlantic and Gulf coasts of Florida have fluctuated with a slightly decreasing trend from 1982 to 2000 (FMRI 2003). From 1991 to 2009, recreational landings appear relatively stable, fluctuating around 0.5 fish/trip.

Louisiana
The southern flounder stock off the coast of Louisiana is assessed every five years by researchers at the Louisiana Department of Wildlife and Fisheries. The assessors use yield-per-recruit (YPR), spawning potential ratio (SPR), and catch curve analyses (disappearance rates) to estimate the impact of fishing pressure on the stock. Researchers estimated a standardized CPUE from various fishery-independent surveys and found a flat, slightly variable trend between 1981-2002. In the past, Louisiana has declared emergency closures of the commercial Southern Flounder fishery (1996), finding that "an imminent peril to the public welfare exists..." due to the spawning potential ratio of this species being found to be less than 30 percent. There has been a decrease in landings in both the commercial and recreational sectors, however this decline has been attributed to greater management efforts. Louisiana stocks are considered to be in good condition (SeaFood Watch 2004).

Texas
Note that Texas represents the boundary between the eastern and western Gulf of Mexico populations (Blandon et al. 2001) and the Texas Stock is considered to be in poor condition due to the impact of by-catch from shrimp trawlers and the effects of a skewed sex ratio which may limit reproduction (SeaFood Watch 2004). Southern flounder is harvested in both the commercial and recreational sectors in Texas. Although separate catch statistics are not available, Southern Flounder dominates the overall flounder catch (approximately 95% of flounder caught are P. lethostigma and most are females (due to the 14” size restriction). Large amounts of the smaller A skewed sex ratio has emerged; out of ~ 900 individuals that could be sexed, 17% were male, indicating a female: male ratio of 6:1 which may be limiting reproduction (GSMFC 2000).

Declines in commercial and recreational landings of Southern Flounder in Texas prompted an examination of long-term population trends. A fisheries independent data set (1975–2008) was used to assess population trends of juvenile and adult Southern Flounder along the Texas coast in the northern Gulf of Mexico, USA. The dataset contained a total of 46,784 sites that were sampled with bag seines to monitor small nekton abundance and 22,870 sites that were sampled with gill nets to assess adult fisheries trends. Researchers found that that both juveniles and adults in the Southern Flounder population have been continuously declining, with rates of decline in abundance of juveniles estimated at 1.3% per year, while those for adults are nearly double, estimated at 2.5% per year (Froeschke et al. 2011). Additionally, a reduced proportion of P. lethostigma on the Texas coast is reaching the age at maturity.

The following decreases in harvest were recorded in Texas waters and prompted the above examination:

Inshore commercial harvest: Declined from 500,000 fish per year between 1985 and 1987 to <100,000 fish in 2007 (Riechers 2008).
Recreational catches: Declined from 200,000 fish in 1987 to <50,000 fish in 2007 (Riechers 2008)
Offshore commercial catch rates: Declined from 325,000 fish in 1987 to <50,000 in 2007 (Riechers 2008).

% Decline for the Western Gulf of Mexico population:

Based on the currently available data, and assuming a generation length of 5 years, and a % decline in the adult population of 2.5% per year in the Western Gulf of Mexico population, the % decline over 3 generations (i.e. 15 years) is 37.5%, meeting the Thresholds for Threatened Category Vulnerable under criteria A2.

references needed: Ordered on December 5 2012
The Flounder Fishery of the Gulf of Mexico, United States: A Regional Management Plan

[[[[the following statements were already in this account, but totally lacking citations: "This species is represented by a large number of subpopulations and locations. Total adult population size is unknown but relatively large. trend over the past 10 years or three generations is uncertain but likely relatively stable or slowly declining." "P. lethostigma is apparently most abundant in western Gulf of Mexico. It is also artificially stocked in freshwater lakes near Austin, Texas."]]]]

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
As of 2004, annual commercial landings from the Atlantic were nearly 12 times those of the Gulf were from the Atlantic population, in North Carolina (3.5 million pounds), while in the Gulf region approximately 300,000 pounds were landed.

Atlantic Population

As of 2004, the largest fishery for P. lethostigma was in North Carolina, where it has been a major component of the commercial fishing industry of estuarine waters for nearly three decades. It has experienced increasingly heavy exploitation over the last two decades (circa 1990 - 2010) largely due to the increased contribution of gillnet-harvested fish (Takade-Heumaker and Batsavage 2009). In a recent tagging study, 93.4% of recovered individuals were captured in the commercial gillnet fishery, and the large majority (87.7%) of the individuals captured in this fishery were estimated to be non-reproductive individuals in age-class 1 (Smith and Scharf 2010). Estuarine gillnet fisheries operating in North Carolina selectively remove sexually immature individuals (age 0 and age 1), causing demographic shifts and creating the potential for long-term population-level effects. Despite increasing management efforts, numerous stock assessments conclude that the stock is still being over harvested in North Carolina (Smith and Scharf 2010; Takade-Heumaker and Batsavage 2009; NCDMF 2005). Improvements have occurred in the stock since the terminal year (2002) of the 2005 stock assessment (NCDMF 2005), due largely to one year of high recruitment. However, it is worth noting that the Atlantic population may be particularly vulnerable to consecutive years of low recruitment.

There is concern regarding the nature of the Atlantic fishery for P. lethostigma and uncertainty of the data upon which stock assessments have been constructed. P. lethostigma is taken as by-catch in shrimp trawls, crab pots, and crab trawls (Smith and Scharf 2010). It is taken as by-catch in trawl fisheries operating in estuarine and oceanic waters off the coast of North Carolina (Brown 2009). Research recommendations for the Atlantic Stock include better understanding of impact of commercial shrimp trawls, recreational gigs, crab pots and pound nets, which were not included in the 2009 stock assessment from North Carolina (Takade-Heumaker and Batsavage 2009). Given that the commercial and recreational fisheries rely heavily on age 1 and age 2 fishes, the sustainability of the stock is dependent on understanding recruitment in this species.

A 2004 Seafood Watch recommended the avoidance of Atlantic-caught Southern Flounder. The report cited several items of concern, notably the targeting of larger females which has led to a skewed sex ratio.

Gulf Population

High recruitment levels are observed in P. lethostigma, however the adult population is in decline. The continuous decline in abundance in the Gulf of Mexico population has been attributed primarily to commercial and recreational over harvesting and by-catch mortality from shrimp trawls, not to recruitment limitation. In particular, the decline in adult southern flounder abundance may be attributed to lower survivorship of adults and late juveniles nearing maturity (sub-adult stage) due to increased fishing and/or natural mortality (Froeschke et al. 2011). Commercial by-catch contributes most to the fishing mortality rate of southern flounder in Texas (Froeschke et al. 2011).

Shrimp trawl fisheries operating in the Gulf oif Mexico. Recent trends show a decrease in by-catch reduction in the Gulf of Mexico due to modification of bycatch reduction devices (BRDs) by fishermen in order to minimize the loss of commercially valuable shrimp (). Both recreational and commercial fishing rates have ranged from 50,000 fish/year to 500,000 fish/year and by-catch rates have been estimated by TPWD at 925,000 fish/year to 9.7 million fish/year, demonstrating that commercial by-catch contributes most to the fishing mortality rate of southern flounder (Froeschke et al. 2011)
Authors have suggested that the ubiquitous nature of the decline across the entire range of the species suggests a broad-scale oceanographic mechanism (e.g., climate or oceanographic change) may be further contributing to population declines in P. lethostigma (Anderson et al. 2012).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Localized threats may exist, but on a range-wide scale no major threats are known.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Atlantic
In North Carolina, this species is managed and stock assessments are performed. A number of regulations have been implemented in North Carolina to regulate the exploitation of this species, including gear specifications for pound nets, trawls, and gillnets, and minimum size regulations. Additionally, by-catch regulations effecting shrimp and crab trawl fisheries that capture juveniles (Mumford 1999). Additionally, gill net regulations and closures have been implemented in order to reduce sea turtle by-catch, which likely benefit this species.

Commercial regulations as of 2010 include: 14–inches total length (TL) minimum size limit in internal and ocean waters, closed season in internal waters from December 1–31; no trip limits in internal waters and a 100-lbs. trip limit in ocean waters unless the individual has a License to Land Flounder from the Atlantic Ocean. There were various gear regulations to minimize undersized southern flounder by-catch implemented in the fall of 2005. Further regulations to the large mesh gill net fishery to minimize sea turtle interactions in 2010 also impacted the commercial southern flounder fishery (NCDMF 2010).

Recreational regulations as of 2010 include: 15–inches TL minimum size limit/6 fish creel limit for all joint and coastal waters (NCDMF 2010).

Harvest Season — Commercial: January through November (closed season in December) with peak catches from September to November. Recreational: Year–round with peak catches from July through October.

There is substantial interest in rebuilding this fishery in the state of North Carolina, which has set a goal of rebuilding the spawning stock of Southern Flounder by 2015, Management options which are being considered in the forthcoming amendment to the Fishery Management Plan for this species include size limit increases, season closures, and creel limit decreases. Other management issues include gear requirements for the flounder gill net and pound net fisheries, user conflicts, protected species interactions, southern flounder by-catch in the crab pot fishery, minimum distance between pound nets and gill nets in Currituck Sound, recreational discards, ocean harvest of southern flounder, and differential size limits for the recreational fishery (NCDMF 2010).

Gulf of Mexico

As of 2000, a paucity of data prevented a complete Gulf-wide stock assessment for the flounder fishery, which primarily includes Southern Flounder (P. lethostigma). Southern Flounder represents 95% of harvested flounder in the Gulf (Froeschke et al. 2011; VanderKooy 2000). The management of Southern Flounder is the responsibility of the respective states.

By-catch Regulations:
Estimates of by-catch rates in Texas are highly variable from 925,000 to 9.7 million individual southern flounder per year (VanderKooy 2000). To reduce by-catch mortality from shrimp trawl by-catch, a limited entry coupled with buy-back program of shrimp vessels was established in 2002 resulting in retirement of 57% of estuary/bait licenses, subsequently reducing flounder catches by at least 40% (Riechers 2008).

Harvest Regulations
A Fisheries Management Plan (FMP) for the Gulf of Mexico flounder fishery was developed by the Gulf States Marine Fisheries Commission in 2000, which set harvest limits on both recreational and commercial fishing. Most recently, in March 2009, Texas adjusted the bag-limit from a 10 fish to a 5 fish possession law for every month but November - in November (offshore migration period), anglers are limited to a 2 fish possession law (Riechers 2008)

Effectiveness of Regulations:
Despite harvest limits on both recreational and commercial fishing and measures to reduce by-catch mortality, the southern flounder fishery remains in decline in Texas. The southern flounder management program in Texas up to 2008 was not sufficient to maintain southern flounder populations along the Texas coast. Recommendations have on increasing survivorship of one and two year old fish, so that more post-juveniles reach sexual maturity (Stunz et al. 2000; Froeschke et al. 2011).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; gamefish: yes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Fisheries.Fisheries Importance: The southern flounder is a valuable sport and commercial fish along the Gulf coast of the United States. Most of the commercial catch in the Gulf of Mexico is incidental to the catch by shrimp trawlers. There has been significant interest in utilizing southern flounder as an aquaculture species. Studies in the southeastern U.S. and in the Gulf of Mexico are currently underway to improve spawning techniques and develop larval rearing methods for southern flounder in order to improve its attractiveness as an aquaculture product (Jenkins and Smith 1999; Smith et al. 1999).Flounders of all species are harvested annually from waters in and around the Indian River Lagoon, and are especially prized by recreational anglers. However, the commercial fishery is not of particularly high value. For the years 1987 - 2001, 1.7 million pounds of flounders were harvested, with a dollar value of over $3.1 million reported in the 5 county area encompassing the IRL (Volusia, Brevard, Indian River, St. Lucie and Martin Counties).This ranks flounders nineteenth in commercial value within the IRL, and twenty-ninth in pounds harvested.Figure 1 below shows the dollar value of the flounder fishery to IRL counties by year. Note that all species of flounders were combined in the data presented. As shown, commercial catch ranged from a low of $77,149 in 1987 to a high of over $350,927 in 1999. Volusia County annually accounts for the largest percentage of the flounder catch with 83% in total (Figure 2), followed distantly by Brevard County, which accounts for 8% of the total. Indian River, St. Lucie and Martin Counties account for 3%, 4% and 2% of the total respectively. Note that the fishery's value brings in $125,000 - $300,000 annually to Volusia County businesses, while in all other IRL counties, the dollar value is typically less than $25,000. RECREATIONAL FISHERY: The recreational flounder fishery in Florida accounts for 65 - 70% of the annual state-wide harvest (Florida Fish and Wildlife Conservation Commission 2004). Landings on the Gulf coast of Florida are somewhat lower than those on the East coast, averaging approximately 198,015 pounds per year. On the Atlantic coast, landings have averaged less than 300,000 pounds per year since 2001. However, catch rates on both coasts are apparently stable, and have remained so since the early 1990s.Southern flounder are recreationally important in the Indian River Lagoon on a seasonal basis, specifically during the late fall and winter when large specimens may be landed as they migrate out of the lagoon for spawning. This species was first regulated by the State of Florida in 1996, when a 10-fish bag limit and 12-inch minimum size limit was implemented. Since 1997, the recreational harvest in the 5-county area encompassing the Indian River Lagoon has remained fairly consistent, with 1.3 million fishes harvested, an average of 166,500 per year taken by recreational anglers between 1997 - 2001. The lowest harvest was recorded in 2004, when 133,643 southern flounder were captured. The highest harvest occurred in 1999 when 201,195 southern flounder were taken.Approximately 45.8% of the catch was taken in inland waters other than the Indian River Lagoon. Within the IRL, anglers caught 379,472 southern flounder, 28.5% of the total. Coastal waters from the shoreline to 3 miles offshore accounted for 23.2%, while offshore waters to 200 miles accounted for only 2.4%.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Paralichthys lethostigma

The southern flounder, Paralichthys lethostigma, is a species of large-tooth flounders native to the eastern and gulf coasts of the United States. It is a popular sports fish and is the largest and most commercially valuable flounder in the western North Atlantic Ocean and Gulf of Mexico.[1] Its range is North Carolina to the Yucatan Peninsula.[2] It is a "left-eyed flounder", meaning the left side is pigmented and is the "up side".[3] The body color is brown with diffuse, unocellated spots and blotches.[1]

See also[edit]

References[edit]

  1. ^ a b Paralichthys lethostigma Smithsonian Marine Station at Fort Pierce. Species reports
  2. ^ Southern flounder South Carolina Department of Natural Resources species descriptions
  3. ^ Flounder Texas Parks and Wildlife Department species descriptions
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!