Overview

Comprehensive Description

P. lethostigma is one member of a large family of distinctive benthic flatfishes that inhabit continental shore waters in the tropical and temperate zones of the Atlantic, Pacific and Indian oceans. Flatfishes such as the flounders are unlike most other fishes in that they begin life as bilateral animals, having equal right and left sides, and swim as do other fishes. However, toward the end of the larval period, flatfishes settle to the benthos and take up a cryptic, somewhat sedentary lifestyle, lying on one side of the body, and swimming laterally to the substratum. Metamorphosis to the juvenile stage involves complex modification of the skeletal structure of the head, and rearrangement of the nervous system and muscle tissues. Additionally, the eye on the side which faces the substratum (termed the blind-side eye) begins to migrate to the upper side of the body. P. lethostigma is a left-eye flounder, thus it lies on its right side, and at metamorphosis, the right eye migrates to the left side of the head. Lefteye flounders sometimes exhibit sexual dimorphism, with females having eyes that are closer together than in males, and males having somewhat longer pectoral fins (Rogers and Van Den Avyle 1983). Body color is light to dark brown with diffuse non-ocellated dark spots and blotches. The blindside is white or dusky. P. lethostigma are characterized by the following meristic (number of structures per body part) counts:
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Biology

A cryptic species that tolerates low salinities; occurs frequently in brackish bays and estuaries, even on occasion in fresh water (Ref. 9988). Adults are found mostly over mud bottoms in estuaries and coastal waters to about 40 m depth. Taken by anglers inshore from bridges, jetties and small boats. They move to deeper water in winter, but are still easily accessible (Ref. 9988). Adults feed chiefly on fishes, also on crabs and shrimps. Juveniles take mainly small bottom-living invertebrates. Marketed fresh and frozen; eaten steamed, fried, boiled, microwaved and baked (Ref. 9988).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Paralichthys lethostigma is distributed in the western north Atlantic Ocean, from the Chesapeake Bay south along the U.S. to the Loxahatchee River, Florida; absent along the southern Florida peninsula; and in the Gulf of Mexico, from the west coast of Florida at the Caloosahatchee River estuary, and west from Tampa Bay along the entire U.S. Gulf coast, and south to Tuxpan, Mexico (Gilbert 1986, Munroe 2002, R. Robertson pers. comm. 2014).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic: North Carolina to Texas in USA, but absent from southern Florida.
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: North Carolina to Jupiter Inlet, Florida, and from Caloosahatchee estuary, Florida, to Texas or northern Mexico; absent from southern Florida. Apparently most abundant in western Gulf of Mexico. Stocked in freshwater lakes near Austin, Texas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic: North Carolina to Texas in USA, but absent from southern Florida.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The southern flounder, Paralichthys lethostigma, occurs from North Carolina south through Florida and the Gulf of Mexico to Texas. The southern flounder occurs throughout the Indian River Lagoon.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Length: 66 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum size: 760 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

83.0 cm TL (male/unsexed; (Ref. 40637)); max. published weight: 9,330 g (Ref. 4699); max. reported age: 8 years (Ref. 46275)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Southern flounder attain a size of up to 3 feet (91 cm) in length, and can weigh as much as 9 kg (24.1 lbs.) (Smith et al. 1999). The von Bertalanffy growth model predicts a maximum age for summer flounder of approximately of 20 years (Reagan and Wingo 1985).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Look Alikes

Paralichthys lethostigma is sometimes confused with P. albigutta, the gulf flounder. The two are easily distinguished based on the much smaller size of the gulf flounder, which grows only to 15 inches (38 cm). Additionally, the gulf flounder has 3 ocellated spots: 2 vertically placed posterior to the pectoral fins, and 1 placed inside the base of the tail.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This is an estuarine-dependent species that inhabits riverine, estuarine and coastal waters, and prefers muddy or silty substrates (Reagan and Wingo 1985). Individuals can tolerate wide temperature (~5-35C) and salinity ranges (~0.0-60.0), and often enter freshwater. Tagging studies have shown that this species does not typically migrate far distances (Wenner et al. 1990, Monaghan 1992, Scharf et al. 2008).

Life History
This species is sexually dimorphic, with females reaching approximately 80 cm total length (TL) and males reaching about 40 cm TL. Previously, most females (94%) were thought to reach maturity by the end of their second year. In the Atlantic stock, the oldest individual was nine years old (Takade-Heumacher and Batsavage 2009). In the Gulf of Mexico stock off Louisiana, the oldest recorded female was eight years old and the oldest male was four years old (Fischer and Thompson 2004). Recent histological analysis of ovaries has shown it matures at larger sizes and older ages (Midway and Scharf 2012). In North Carolina, 3%, 44% and 76% of age-0, age-1, and age-2 individuals, respectively, were mature (Midway and Scharf 2012). Southern Flounder spawn in offshore waters off the southeast U.S. between November and March (Safrit and Schwartz 1998) and in the Gulf of Mexico from October to February (Reagan and Wingo 1985). The oceanic larval stage is pelagic and lasts 3060 days. Metamorphosing individuals enter estuaries and migrate towards low-salinity headwaters, where settlement occurs (Burke et al. 1991, Walsh et al. 1999). Juveniles remain in estuaries until the onset of sexual maturation (approximately two years), at which time they migrate out of estuaries to join adults on the inner continental shelf.

Generation Length Calculation
Longevity for fish in Louisiana waters is at least eight years for females and four years for males (Fischer and Thompson 2004) and age at 50% maturity is likely around two years old. Thus, generation length is estimated at 3.55 years; five years was used for the purposes of this assessment.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 456 specimens in 1 taxon.
Water temperature and chemistry ranges based on 100 samples.

Environmental ranges
  Depth range (m): 0 - 223
  Temperature range (°C): 16.407 - 25.874
  Nitrate (umol/L): 0.286 - 10.594
  Salinity (PPS): 33.723 - 36.472
  Oxygen (ml/l): 3.530 - 5.755
  Phosphate (umol/l): 0.093 - 0.783
  Silicate (umol/l): 0.756 - 5.295

Graphical representation

Depth range (m): 0 - 223

Temperature range (°C): 16.407 - 25.874

Nitrate (umol/L): 0.286 - 10.594

Salinity (PPS): 33.723 - 36.472

Oxygen (ml/l): 3.530 - 5.755

Phosphate (umol/l): 0.093 - 0.783

Silicate (umol/l): 0.756 - 5.295
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

benthic
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat Type: Freshwater

Comments: Coastal and estuarine waters; seems to prefer muddy substrates. Often enters fresh waters. Spawns offshore; adults move out of estuaries and bays; postlarvae and juveniles move into estuaries from January to early summer (Manooch 1984).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; brackish; marine
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 456 specimens in 1 taxon.
Water temperature and chemistry ranges based on 100 samples.

Environmental ranges
  Depth range (m): 0 - 223
  Temperature range (°C): 16.407 - 25.874
  Nitrate (umol/L): 0.286 - 10.594
  Salinity (PPS): 33.723 - 36.472
  Oxygen (ml/l): 3.530 - 5.755
  Phosphate (umol/l): 0.093 - 0.783
  Silicate (umol/l): 0.756 - 5.295

Graphical representation

Depth range (m): 0 - 223

Temperature range (°C): 16.407 - 25.874

Nitrate (umol/L): 0.286 - 10.594

Salinity (PPS): 33.723 - 36.472

Oxygen (ml/l): 3.530 - 5.755

Phosphate (umol/l): 0.093 - 0.783

Silicate (umol/l): 0.756 - 5.295
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Migrates between spawning and nonspawning habitats (Manooch 1984).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Found mostly over mud bottoms in estuaries and coastal waters to about 40 m depth. A cryptic species; tolerates low salinities; occurs frequently in brackish bays and estuaries, even on occasion in fresh water. Feeds chiefly on fishes, also on crabs and shrimps. Juveniles take mainly small bottom-living invertebrates.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Small individuals eat mysid and penaeid shrimps and other small crustaceans; large individuals eat blue crabs, penaeid shrimps, and fishes; feeds by partly burying in sand and ambushing prey (Manooch 1984).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Southern flounder are carnivorous fishes that are generally considered to be top or near-top predators. Larvae reared under laboratory conditions begin feeding on rotifers 4 - 6 days posthatch. By 8 - 13 days posthatch, larvae begin to feed on newly hatched Artemia nauplii (Denson and Smith 1997).Small southern flounders consume a wide variety of invertebrate prey, but upon reaching approximately 20 mm total length (TL), they become primarily piscivorous (Reagan and Wingo 1985). Based on differences in morphology and behavior between summer flounder and southern flounder in North Carolina, Burke (1995) compared prey distribution and feeding ecology between the 2 species following metamorphosis to the juvenile stage. Southern flounder juveniles have generally larger mouths, larger, inwardly curved teeth, and fewer, heavier gill rakers than do summer flounder. They also tend to remain still on the bottom, waiting for prey to come within striking distance (Minello et al. 1987; Burke 1995). Small southern flounder primarily consumed amphipods and mysid shrimp, followed by copepods, insects, fish and invertebrate parts. In this study, summer flounder 20 - 60 mm SL consumed spionid polychaete worms, followed by clam siphons, mysid shrimp, calanoid copepods, the blue crab, Callinectes sapidus, and small fishes. From this data, Burke (1995) concluded that post-settlement differences in feeding habits developed between the 2 species, with southern flounder shifting to more mobile prey which could be attacked from below, and summer flounder continuing to feed upon benthic prey organisms.The adult diet of P. lethostigma consists primarily of fish, but is augmented by crustaceans depending upon regional location. In Louisiana, adult southern flounders eat shrimp and fish; though, Fox and White (1969) reported that the primary prey species for southern flounder was striped mullet (Mugil cephalus). Also included in the diet are fat sleepers (Dormitator maculatus) and anchovies (Anchoa spp.). Larger flounders (150 mm long) ate primarily anchovies, menhaden (Brevoortia spp.), sciaenids, and mullet (Reagan and Wingo 1985).Habitats: Adult P. lethostigma spend the warmer months in coastal embayments and riverine habitats in the upper reaches of estuaries (Rogers and Van Den Avyle 1983). Many adults migrate to offshore spawning grounds during late fall and winter, though some do remain in estuaries year-round. Larvae spawned offshore make their return to estuarine habitats by passive transport on nearshore and tidal currents. In a study conducted in North Carolina, Burke et al. (1991) reported that peak recruitment into estuaries by late stage (stage 4b and 5), premetamorphic larvae occurred in February, though larvae were collected from late November through mid-April. These larvae settled into tidal mudflats near the head of the estuary, however, in spring, southern flounder apparently migrated upstream into riverine habitats. Spring through summer, southern flounder prefer the silt and mud substrata of coastal bays and river systems, and become most common in the upper reaches of estuaries, sometimes entering freshwater (Burke et al. 1991; Smith et al. 1999).In a comparative study, Burke et al. (1991) reported that larvae of both southern and summer flounder recruit into estuaries during the same period, and for a time, show considerable overlap in distribution within an estuary. However, segregation occurs quickly (Burke et al. 1991; Burke 1995). Premetamorphic larvae of southern flounder tend to concentrate on tidal flats in the upper reaches of estuaries where salinity ranges from 9 - 25 ?, and the substratum consists of 4 - 45 % sand. Conversely, premetamorphic larvae from summer flounder generally move into silt and mudflat areas in the lower and middle reaches of estuaries where salinity ranges from 24 - 35 ? and the substratum consists of 50 - 95 % sand (Burke et al. 1991). Capture data following segregation of the 2 species within the Newport River Estuary, North Carolina, showed that summer flounder were most common on sand flats than on mudflats in the lower estuary, while there was little difference in capture rates among southern flounder in sandy vs. muddy substrates in the upper reaches of the estuary. Burke et al. (1991) concluded that settlement in P. dentatus is most likely influenced by substratum type, while that of P. lethostigma is influenced by salinity.Activity Time:A tank study showed that southern flounder tend to be more active at night than during the day (Reagan and Wingo 1985).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

P. lethostigma is one of the largest and most commercially valuable flounders in the western North Atlantic (Burke et al. 1991).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Distinct pairing (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Spawns in fall and winter; eggs hatch in about 3 days at 63 F; sexually mature in 2 years (Manooch 1984).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Adults migrate to offshore spawning grounds during late fall and winter, though some remain in estuaries year-round. Spawning migrations are usually preceded by a drop in water temperature of 4 - 5 ° C. Males move seaward earlier than females, with few remaining in estuaries after November (Reagan and Wingo 1985). In North Carolina, southern flounders begin migration in the fall; in Texas, they migrate from October through December (Reagan and Wingo 1985).Laboratory experiments from Texas indicate that approximately 3 weeks before spawning takes place, male southern flounder begin following gravid females. In tank experiments, the first spawning was in December and occurred at midday. Females swam to the surface and released eggs that were immediately fertilized by attending males. Fertilization was 30% to 50% successful, and 6% to 35% of the eggs hatched within 61 - 76 hr (Reagan and Wingo 1985).Females become sexually mature at 2 years of age in Texas, while the youngest mature female southern flounder in northern Florida was 4 years old (Reagan and Wingo 1985).Thirteen southern flounders examined in the laboratory, produced a total of 120,000 eggs (approximately 9,230 eggs per female) (Reagan and Wingo 1985).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Growth

Eggs of P. lethostigma range from 0.85 - 0.95 mm in diameter (Powell and Henley 1995), with a single oil globule. Laboratory rearing of southern flounder shows that eggs hatch after 3 days at 18° C and 30? salinity (Denson and Smith 1997). Larvae begin to feed when 4 -6 days old, and show signs of becoming premetamorphic by day 14. By day 16, larvae begin to settle out of the water column and congregate on the bottom. By day 21, larvae show signs of adult pigmentation, and begin to rest on their left sides, though their eyes remain in position. By day 23, metamorphosis is initiated and the left eye begins to migrate to the right side. Most animals had completed metamorphosis by day 36 (Denson and Smith 1997). In culture experiments, yolk-sac larvae began metamorphosing to postlarvae at 40 - 46 days, when they were approximately 8 - 11 mm in length. Metamorphosis to the juvenile stage was complete by 50 - 51 days (Reagan and Wingo 1985). Data from Powell and Henley (1995) show that larvae complete metamorphosis when they reach approximately 8.7 - 9.0 mm SL. By this time, the migrating eye has reached the dorsal midline, and the larval stage is complete.Powell and Henley (1995) examined egg and larval development in both P. lethostigma and P. albigutta. Results from their study show that fins begin to develop when larvae reach approximately 5.4 mm notochord length (NL). The dorsal fin is generally the first to begin development, followed by the caudal, anal, pelvic, and pectoral fins (Powell and Henley 1995). Development of the caudal fin in P. lethostigma can begin when larvae are approximately 5.5 mm NL, but fin rays are not observed until larvae attain 8.2 mm SL. Dorsal fins begin to develop when larvae are in the preflexion stage, at approximately 6.5 mm NL. The dorsal fin is first observed in the head region, with development proceeding posteriorly. By the time larvae reach 8.4 mm standard length (SL) the dorsal fin is fully developed. Following postflexion, when larvae reach approximately 7.3 mm standard length (SL), anal fin rays begin to develop, with the full adult complement of fin rays reached at a body size of 8.4 mm SL. Pelvic fins are first observed on larvae at approximately 8.2 mm SL, and are fully developed by the time larvae attain 9.7 mm SL. Pectoral fins first begin formation when larvae are approximately 8.4 mm SL, and are fully formed when larvae exceed 11.0 mm SL.Pigmentation is first observed in middle-stage eggs, following blastopore closure. In larvae, pigmentation is more pronounced in the caudal area, being less developed overall in P. lethostigma than in its close relative P. albigutta, the gulf flounder (Powell and Henley 1995).Larvae spawned offshore in the Atlantic Ocean make their return to estuarine habitats by passive transport on nearshore and tidal currents from November through April, with a peak in recruitment occurring in February (Burke et al. 1991). In the gulf of Mexico, Southern flounder postlarvae are caught along the Gulf of Mexico coast during winter and early spring. At Galveston Island, Texas, southern flounder postlarvae 18 - 34 mm in total length (TL) were captured during February, March, and May. Fish 25 - 51 mm TL were caught in the Mississippi River during the spring. In Aransas Bay, Texas, the peak movement of postlarvae flounders into estuaries is in February, when water temperature is 16.0 - 16.2 °C (Stokes 1977).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Paralichthys lethostigma

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATCTCGTATTTGGTGCCTGAGCCGGAATAGTGGGGACAGCCCTAAGTCTACTCATTCGAGCAGAACTAAGCCAACCTGGCGCCCTCCTGGGCGATGACCAGATCTATAACGTAATCGTTACTGCACACGCCTTTGTAATAATCTTTTTTATGGTAATACCAATTATGATCGGAGGATTTGGCAACTGACTTATTCCTCTAATAATTGGTGCCCCGGATATAGCATTTCCTCGAATAAACAATATAAGCTTTTGACTCCTACCCCCTTCATTTCTTCTCCTTTTAGCCTCCTCAGGTGTTGAAGCTGGAGCTGGCACCGGATGAACTGTCTATCCCCCTCTAGCCAGCAACCTTGCTCATGCCGGGGCCTCTGTAGACCTAACTATTTTTTCACTCCACCTTGCAGGAATCTCCTCAATTCTAGGAGCTATCAACTTCATTACAACCATTATTAATATGAAACCTACAACCATAACCATGTATCAAATACCCCTATTTATTTGAGCTGTACTCATTACAGCCGTCCTATTACTCCTATCTCTTCCAGTCCTAGCCGCCGGCATTACTATACTACTAACGGACCGTAACCTAAATACAACTTTCTTCGACCCTGCAGGAGGGGGAGACCCAATTCTCTACCAACACCTATTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Paralichthys lethostigma

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 14
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2015

Assessor/s
Munroe, T.

Reviewer/s
Linardich, C.

Contributor/s

Justification
Paralichthys lethostigma is widely distributed andinhabits riverine, coastal and estuarine waters on muddy or silty substrates. It has an estimated generation length of 5 years.

This species supports major commercial and recreational fisheries in U.S. waters and is managed at the state level in six main areas, but the global population is concentrated in the northern Gulf of Mexico and off North Carolina on the Atlantic coast. There is concern regarding theuncertainty of the data upon which stock assessments have been constructed in flounder fisheries.Out of the six U.S. states that monitor the Southern Flounder population in their waters, the most data-intensive population estimates have been conducted by Texasand North Carolina, which show 30% and 25% declines respectively over the past three generations (15 years).These declines have been attributed to overexploitation by both the commercial and recreational fishing sectors, as well as bycatch mortality in the shrimp trawl fishery. Three of the states (Mississippi, Alabama, and Louisiana) report stable populations, while the status off Florida is unknown. On average over the past 23 years, Louisiana reported the highest average landings in both the recreational and commercial sectors for the Gulf of Mexico; however, it is not known if one or more states contain a greater proportion of the Gulf population because the last Gulf-wide assessment was inconclusive.Fisheries are heavily reliant on age-0 and age-1 individuals, a large percentage of which are immature.In addition, this species exhibits significant sexual dimorphism, with females attaining much larger sizes than males, and females consequently compose the majority of large fishes harvested. In some areas, selective harvesting of females may contribute to skewed sex ratios in the population; the effects of this on the reproductive success are unknown.

This is an estuarine dependent species, and these habitats have been seriously impacted by anthropogenic activities. There are many indications that this species is declining throughout its range, with some signs that stringent management measures implemented in recent years may be allowing populations to recover.

As this species is heavily exploited throughout its range, both directly and incidentally, it is suspected that other populations are likely declining at the same rate. This species nearly meets the thresholds for Vulnerable under criterion A2bd; therefore it is assessed as Near Threatened. The development of a comprehensive Gulf-wide stock assessment may provide a clearer quantitative picture for this species.

History
  • 2013
    Least Concern (LC)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Atlantic Population
North Carolina: As of 2004, the largest fishery for P. lethostigma was in North Carolina, where it has been a major component of the commercial fishing industry in estuarine waters for nearly three decades. It is considered a unit stock (Takade-Heumacher and Batsavage 2009). Stock assessments are performed under the management of the Atlantic States Marine Fisheries Commission (ASMFC). Commercial landings accounted for about 89% of the total annual harvest from 1991 to 2007, but declined to 72%-76% from 2004 to 2007. Recreational harvest accounted for an average of 11% of the total annual harvest from 1991 to 2007, but increased to 24%-28% from 2004 to 2007. Recreationally, it is mostly harvested via hook and line and gigging, with the majority of harvest occurring in the summer and fall (Takade-Heumacher and Batsavage 2009). It has experienced increasingly heavy exploitation over the last two decades (ca. 19902010) largely due to the increased gillnet-harvested fish (Takade-Heumacher and Batsavage 2009). In a recent tagging study, 93.4% of recovered individuals were captured in the commercial gillnet fishery, and the large majority (87.7%) of these individuals were estimated to be non-reproductive individuals in age-class one (Smith and Scharf 2010). This selective removal of sexually immature individuals (age 0 and age 1) causes demographic shifts and creating the potential for long-term population-level effects.

Despite increasing management efforts, numerous stock assessments conclude that the stock is still being over harvested in North Carolina (NCDMF 2005, Takade-Heumacher and Batsavage 2009, Smith and Scharf 2010). Improvements have occurred in the stock since the terminal year (2002) of the 2005 stock assessment (NCDMF 2005), due largely to one year of high recruitment. However, it is worth noting that the Atlantic population may be particularly vulnerable to consecutive years of low recruitment. The most recent stock assessment (2009) concluded that the stock is 'depleted', which means the spawning stock abundance is below a predetermined threshold. This is due to over-harvesting, which has occurred since 1991 (Takade-Heumacher and Batsavage 2009, NCDMF 2012). Estimated spawning stock biomass declined by 50% between 1991-2003, but increased to levels equal to that in 1991 in recent years (2005-2007) (Takade-Heumacher and Batsavage 2009). Estimated total female abundance declined by 25% over the past 17 years (1991-2007) (Takade-Heumacher and Batsavage 2009). This was calculated using endpoints of the data. This decline occurred despite reduced fishing pressure, which may be a result of the systematic over-estimation of age-0 and age-1 fish and that this assessment is unable to account for all sources of removal of young fishes from the population, notably by the shrimp trawl fishery. Over half of the stock was estimated to be age-0, with the only notable shift in age structure being a small increase in older fish (ages 3 through 6+) in the last two years of the assessment (2005-2007).

Florida Atlantic: In Florida, commercial catch statistics for P. lethostigma are lumped with those for P. albigutta and P. dentatus. Gulf Flounder (P. albigutta) is the most abundant, large flounder in shallow waters of east-central Florida. Southern Flounder is less abundant in this area and apparently occurs in deeper waters than the Gulf Flounder (Murphy et al. in situ VanderKooy 2000). The majority of Florida's flounder landings occur on the Atlantic coast (304,867 lbs in 2009), with the majority landed by the recreational sector (68% in 2009). Annual standardized catch per unit effort (CPUE) estimates for Atlantic recreational fishers in Florida were relatively stable until 1994, increased through 1997, and have declined to 2001 (less than one fish per trip) (FMRI 2003). Commercial catch rates fluctuate around 20 lbs/trip between 1992-2008, but sharply declined between 2004-2008 (FMRI 2010).

Gulf of Mexico Population
Each individual Gulf state assesses and manages their flounder fisheries independently. As of 2000, a lack of data prevented a complete Gulf-wide stock assessment for the flounder fishery. Southern Flounder represents 95% of the harvested flounders throughout the entire Gulf (VanderKooy 2000, Froeschke et al. 2011). There is evidence that this species has a skewed sex ratio, which may limit reproduction. The continuous decline in abundance in the Gulf of Mexico population has been attributed primarily to commercial and recreational over-harvesting and bycatch mortality from shrimp trawls, not to recruitment limitation. In particular, the decline in adult abundance may be attributed to lower survivorship of adults and late juveniles nearing maturity (sub-adult stage) due to increased fishing and/or natural mortality. Recent trends show a decrease in effectiveness of by-catch reduction devices in the Gulf of Mexico due to modifications made by fishermen in order to minimize the loss of commercially valuable shrimp. Both recreational and commercial fishing rates have ranged from 50,000 fish/year to 500,000 fish/year and by-catch rates have been estimated by the Texas Parks and Wildlife Department at 925,000 fish/year to 9.7 million fish/year, demonstrating that by-catch contributes most to fishing mortality (Froeschke et al. 2011).

Florida: In Florida, commercial catch statistics for P. lethostigma are lumped with those for P. albigutta and P. dentatus. Southern Flounder is landed west of Apalachee Bay, but with less frequency than that of Gulf Flounder (Murphy et al. in situ VanderKooy 2000). Therefore, it is suspected that the Southern Flounder population is naturally low along much of the Florida Gulf coast except the panhandle. Due to the lack of species-specific statistics, the status of the Southern Flounder population is unknown off Florida (Murphy et al. in situ VanderKooy 2000).

Alabama: Southern Flounder are commercially and recreationally targeted off Alabama, with most harvested as bycatch in the commercial shrimp fisheries. A stock assessment is currently underway, but early estimates appear to indicate that the population is stable (Gulf FINFO 2015).

Mississippi: Southern Flounder are commercially and recreationally targeted off Mississippi, with recreational landings being the larger of the two sectors. The Mississippi Department of Marine Resources has not completed a formal stock assessment, but trends in harvest and population data indicate that the stock is stable and fishing effort level as appropriate (low and mostly taken as bycatch in other fisheries) (Gulf FINFO 2015).

Louisiana: Southern Flounder comprises the majority of the flounder fishery off Louisiana. Most commercial harvests (about 85%) are caught as bycatch in the shrimp fishery. Landings have averaged around 0.6 million pounds/year from 2003 to 2013. Commercial gear restrictions enacted in 1995 led to a substantial (84%) decline in landings. In the most recent years, recreational landings have trended upwards, with the highest occurring in 2013. Catch-per-unit-effort in the recreational fishery and in a fishery-independent trawl survey do not have significant trends over the past three generation lengths (since 1995) (Blanchet 2010). The stock is assessed every five years by the Louisiana Department of Wildlife and Fisheries. In the past, Louisiana has declared emergency closures of the commercial Southern Flounder fishery (1996). A statistical catch at age model was used to describe dynamics of P. lethostigma from 1981-2013. The conservation threshold for this species as established by the Louisiana legislature is a 30% spawning potential ratio. Results from the most recent published assessment (2010) were uncertain, mostly due to the lack of information on natural mortality (Blanchet 2010). Based on results of the 2015 assessment, the Louisiana stock is neither overfished nor experiencing overfishing and the current spawning potential ratio is estimated at 50% (LDWF in prep. 2015, referenced in meeting LDWF minutes, Baton Rouge LA, February 5, 2015). The most recent stock assessment (2015) was not available at the time of this assessment, but the stock appears to be recovering due to conservation measures.

Texas: The Texas stock occurs on the boundary between the eastern and western Gulf of Mexico populations and is harvested by both the commercial and recreational sectors (Blandon et al. 2001). Commercial by-catch contributes most to the fishing mortality rate of Southern Flounder in Texas (Froeschke et al. 2011). It is considered to be in uncertain to poor condition due to the impact of bycatch from shrimp trawling and overexploitation. Although separate catch statistics are not available, P. lethostigma dominates the overall flounder catch (approximately 95%). Most fish landed are females (due to the 14 inch size restriction) and a skewed sex ratio has emerged; out of ~ 900 individuals that could be sexed, 17% were male, indicating a female: male ratio of 6:1. This may be limiting reproductive potential (GSMFC 2000). Declines in commercial and recreational landings prompted an examination of long-term population trends. Estimated female abundance declined by 44% over 14 years (1984-1997) (Fisher in situ VanderKooy 2000). A fisheries-independent study conducted between 1975-2008 was used to assess population trends of juvenile and adult Southern Flounder. Over this 33 year time series, both juveniles and adults continuously declined; juveniles declined at an estimated rate of 1.3% per year, while adults declined at a higher rate of 2.5% per year (Froeschke et al. 2011). Based on these data, and assuming a generation length of 5 years, the population declined by 30% over three generation lengths (15 years). Additionally, a reduced proportion of P. lethostigma are reaching maturity. Inshore commercial harvest declined from 500,000 fish per year between 1985 and 1987 to <100,000 fish in 2007 and offshore commercial harvest declined from 325,000 fish in 1987 to <50,000 in 2007. Recreational catch declined from 200,000 fish in 1987 to <50,000 fish in 2007 (Riechers 2008). The most recent stock assessment (in preparation) indicates that spawning stock biomass has increased and fishing mortality decreased due to regulations implemented after 2009. Managers consider the fishery to be in recovery.

Global
North Carolina reported an average commercial catch one order of magnitude greater than any other state (Atlantic or Gulf) (Takade-Heumacher and Batsavage 2009). Tagging studies have shown that this species does not typically migrate far distances (Wenner et al. 1990, Monaghan 1992, Scharf et al. 2008). These two centres of abundance (North Carolina and the northern Gulf of Mexico) may be due to the temperature and muddy-bottom habitat preference of this species (VanderKooy 2000).

There is concern regarding the uncertainty of the data upon which stock assessments have been constructed in flounder fisheries. Out of the six U.S. states that monitor the Southern Flounder population in their waters, the most accurate population estimates have been conducted by Texas (Froeschke et al. 2011) and North Carolina (Takade-Heumacher and Batsavage 2009), which show 30% and 25% declines respectively over the past three generations (15 years). Three of the states (Mississippi, Alabama, and Louisiana) report stable populations, while the status off Florida is unknown (VanderKooy 2000, Gulf FINFO 2015). On average over the past 23 years, Louisiana reported the highest average landings in both the recreational and commercial sectors for the Gulf of Mexico (NOAA Fisheries Annual Commercial Landings Statistics). However, it is not known if one or more states contain a greater proportion of the Gulf population because the last Gulf-wide assessment was inconclusive (VanderKooy 2000). Population connectivity Studies using microsatellite DNA markers concluded that the Gulf of Mexico and Atlantic populations of Southern Flounder are strongly genetically distinct and should be managed separately (Anderson and Karel 2012). Additionally, based on allozymes, there is evidence for some isolation by distance between eastern and western populations in the Gulf of Mexico (Blandon et al. 2001), and it has been suggested that for the purposes of stock enhancement, any strategy in the Gulf should necessarily include eastern and western stocking areas (Blandon et al. 2001). Despite otolith morphometric variation evidence pointing towards extensive mixing within basins (i.e., the Gulf of Mexico or the Atlantic), this species is managed at the state level (Midway et al. 2014). The simultaneous declines across the entire range of the species suggests that broad-scale oceanographic mechanisms (e.g., climate or oceanographic change, habitat loss) may be contributing to population declines (Anderson et al. 2012).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Fishing pressure, including incidental catch, is a factor in population reductions of this species, but simultaneous declines across its entire range suggests thatbroad-scale oceanographic mechanisms may also be contributing (Anderson et al. 2012). This species is estuarine-dependent, and may be susceptible to anthropogenic activities occurring in these areas.Itis taken as bycatch in shrimp trawls in the same areas it is also directly targeted by fishermen. It also occurs as bycatch in crab pots and crab trawls in North Carolina (Brown 2009,Smith and Scharf 2010).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Localized threats may exist, but on a range-wide scale no major threats are known.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Management of the U.S. Southern Flounder fishery is the responsibility of the respective states.A Fisheries Management Plan (FMP) for the Gulf of Mexico flounder fishery was developed by the Gulf States Marine Fisheries Commission in 2000, which set harvest limits on both recreational and commercial fishing.Florida has implemented limits on recreational daily bags and minimum size.In North Carolina, this species is managed and stock assessments are performed. A number of regulations have been implemented, including seasonal closures, gear specifications for net fisheries, minimum size, and the use of by-catch reduction devices in shrimp and crab trawl fisheries (Mumford 1999, NCDMF 2010). Additionally, gill netting restrictions and closures were implemented in 2010 to reduce sea turtle by-catch, which may benefit this species.Recreational regulations as of 2010 include: 15 inches total length minimum size limit and a six fish creel limit for all joint and coastal waters (NCDMF 2010).The state of North Carolina has set a goal of rebuilding the spawning stock of Southern Flounder by 2015. The forthcoming amendment to the Fishery Management Plan for this species include size limit increases, season closures, and creel limit decreases (NCDMF 2010).Future research for the North Carolina population is recommended to focus on the impact of its occurrence as shrimp trawl bycatch, in recreational gigging, crab pots and pound nets, which were not included in the 2009 stock assessment (Takade-Heumacher and Batsavage 2009). In addition, the sustainability of the stock is dependent on gaining a better understanding of maturity schedules as well as allowing smaller individuals time to mature and spawn (Midway and Scharf 2012).

Texas also enforces a bag limit (Riechers 2008). To reduce bycatch mortality from shrimp trawls, a limited entry coupled with buy-back program of shrimp vessels was established in 2002 in Texas. This resulted in retirement of 57% of estuary/bait licenses, subsequently reducing flounder catches by at least 40% (Riechers 2008). Until 2008, the Southern Flounder management program in Texas was not sufficient to maintain a sustainable population. Recommendations to increase survivorship of one- and two-year-old fish, so that more post-juveniles reach sexual maturity, have been suggested (Stunz et al. 2000, Froeschke et al. 2011).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; gamefish: yes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Fisheries.Fisheries Importance: The southern flounder is a valuable sport and commercial fish along the Gulf coast of the United States. Most of the commercial catch in the Gulf of Mexico is incidental to the catch by shrimp trawlers. There has been significant interest in utilizing southern flounder as an aquaculture species. Studies in the southeastern U.S. and in the Gulf of Mexico are currently underway to improve spawning techniques and develop larval rearing methods for southern flounder in order to improve its attractiveness as an aquaculture product (Jenkins and Smith 1999; Smith et al. 1999).Flounders of all species are harvested annually from waters in and around the Indian River Lagoon, and are especially prized by recreational anglers. However, the commercial fishery is not of particularly high value. For the years 1987 - 2001, 1.7 million pounds of flounders were harvested, with a dollar value of over $3.1 million reported in the 5 county area encompassing the IRL (Volusia, Brevard, Indian River, St. Lucie and Martin Counties).This ranks flounders nineteenth in commercial value within the IRL, and twenty-ninth in pounds harvested.Figure 1 below shows the dollar value of the flounder fishery to IRL counties by year. Note that all species of flounders were combined in the data presented. As shown, commercial catch ranged from a low of $77,149 in 1987 to a high of over $350,927 in 1999. Volusia County annually accounts for the largest percentage of the flounder catch with 83% in total (Figure 2), followed distantly by Brevard County, which accounts for 8% of the total. Indian River, St. Lucie and Martin Counties account for 3%, 4% and 2% of the total respectively. Note that the fishery's value brings in $125,000 - $300,000 annually to Volusia County businesses, while in all other IRL counties, the dollar value is typically less than $25,000. RECREATIONAL FISHERY: The recreational flounder fishery in Florida accounts for 65 - 70% of the annual state-wide harvest (Florida Fish and Wildlife Conservation Commission 2004). Landings on the Gulf coast of Florida are somewhat lower than those on the East coast, averaging approximately 198,015 pounds per year. On the Atlantic coast, landings have averaged less than 300,000 pounds per year since 2001. However, catch rates on both coasts are apparently stable, and have remained so since the early 1990s.Southern flounder are recreationally important in the Indian River Lagoon on a seasonal basis, specifically during the late fall and winter when large specimens may be landed as they migrate out of the lagoon for spawning. This species was first regulated by the State of Florida in 1996, when a 10-fish bag limit and 12-inch minimum size limit was implemented. Since 1997, the recreational harvest in the 5-county area encompassing the Indian River Lagoon has remained fairly consistent, with 1.3 million fishes harvested, an average of 166,500 per year taken by recreational anglers between 1997 - 2001. The lowest harvest was recorded in 2004, when 133,643 southern flounder were captured. The highest harvest occurred in 1999 when 201,195 southern flounder were taken.Approximately 45.8% of the catch was taken in inland waters other than the Indian River Lagoon. Within the IRL, anglers caught 379,472 southern flounder, 28.5% of the total. Coastal waters from the shoreline to 3 miles offshore accounted for 23.2%, while offshore waters to 200 miles accounted for only 2.4%.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Paralichthys lethostigma

The southern flounder, Paralichthys lethostigma, is a species of large-tooth flounders native to the eastern and gulf coasts of the United States. It is a popular sports fish and is the largest and most commercially valuable flounder in the western North Atlantic Ocean and Gulf of Mexico.[1] Its range is North Carolina to the Yucatan Peninsula.[2] It is a "left-eyed flounder", meaning the left side is pigmented and is the "up side".[3] The body color is brown with diffuse, unocellated spots and blotches.[1]

See also[edit]

References[edit]

  1. ^ a b Paralichthys lethostigma Smithsonian Marine Station at Fort Pierce. Species reports
  2. ^ Southern flounder South Carolina Department of Natural Resources species descriptions
  3. ^ Flounder Texas Parks and Wildlife Department species descriptions
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!