Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

A common species that inhabits shallow coral reefs (Ref. 58534) and lagoon and seaward reefs to depths of 30 m or more. Benthopelagic (Ref. 58302). Occurs under ledges or in crevices during the day and feeds on isopods; at night it roams over open sand and low-profile reef areas to feed on polychaetes and small crabs. Stomach contents listed gastropods (e.g. Atys sp.), polychaetes, small clams, solenogastrid, isopods, brachyuran crabs, and other crustaceans (Ref. 27370). Tends to occur in aggregations (Ref. 30573). Venomous spine on its preopercle. Size rarely exceeds 13 cm. Minimum depth reported taken from Ref. 30874.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Indo-Pacific: Red Sea and East Africa to the Hawaiian and Pitcairn islands, north to the Ryukyu and Ogasawara islands, south to northern Australia and Lord Howe Island. Throughout Micronesia (Ref. 1602).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red Sea, Indo-West Pacific: East Africa, South Africa, Madagascar and Mascarenes east to Hawaiian Islands and Pitcairn Group, north to Ryukyu Islands and Ogasawara islands, south to Western Australiaat 17°30'S, Elizabeth and Middleton Reefs, New Caledonia
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 11; Dorsal soft rays (total): 12 - 14; Analspines: 4; Analsoft rays: 8 - 9
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 170 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

17.0 cm TL (male/unsexed; (Ref. 30874))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Inhabits subtidal reef flats and lagoon and seaward reefs to depths of 30 m or more. Occurs under ledges or in crevices during the day and feeds on isopods; at night it roams over open sand and low-profile reef areas to feed on polychaetes and small crabs. Venomous spine on its preopercle. Size rarely exceeds 13 cm.
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Body with alternating broad red and narrower silvery white stripes (Ref. 4201); red head with 2 vertical white streaks on the opercle, one on its edge and an oblique one below the eye; distinctive reddish-black to black dorsal fin with two white streaks. Five or 6 oblique rows of scales on cheek. Maxilla nearly reaching or extending slightly beyond a vertical at anterior edge of the pupil; upper jaw length 2.75-2.95 in head length. Body depth 2.75-3.25 in SL; head length 2.7-3.15 in SL; snout length 4.0-4.4 in head length; interorbital width 4.4-4.9 in head length; premaxillary groove extending slightly posterior to a vertical at anterior edge of orbit; anterior end of nasal bone rounded; medial margin of nasal bone without spinule; nasal fossa without spinules on its edge; upper edge of suborbital bones below anterior half of eye spineless; small preopercular spine, its length 2-3 times in orbit diameter, 2.85-3.5 in head length; longest 4th dorsal spines, 1.7-2.25 in head length; third anal spine 1.2-1.35 in head length (Ref. 27370).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 1 - 60 m (Ref. 27370), usually 2 - 30 m (Ref. 30573)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 217 specimens in 1 taxon.
Water temperature and chemistry ranges based on 161 samples.

Environmental ranges
  Depth range (m): 0.5 - 300
  Temperature range (°C): 24.430 - 29.336
  Nitrate (umol/L): 0.033 - 1.248
  Salinity (PPS): 33.507 - 36.148
  Oxygen (ml/l): 4.436 - 4.840
  Phosphate (umol/l): 0.071 - 0.351
  Silicate (umol/l): 0.810 - 5.551

Graphical representation

Depth range (m): 0.5 - 300

Temperature range (°C): 24.430 - 29.336

Nitrate (umol/L): 0.033 - 1.248

Salinity (PPS): 33.507 - 36.148

Oxygen (ml/l): 4.436 - 4.840

Phosphate (umol/l): 0.071 - 0.351

Silicate (umol/l): 0.810 - 5.551
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 1 - 60m.
From 1 to 60 meters.

Habitat: reef-associated. Crown squirrelfish.  (Lacepede, 1801)  Attains 17 cm. Wide ranging in the Indo-Pacific south to East London.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

A common species that inhabits shallow coral reefs (Ref. 58534) and lagoon and seaward reefs to depths of 30 m or more. Benthopelagic (Ref. 58302). Occurs under ledges or in crevices during the day and feeds on isopods; at night it roams over open sand and low-profile reef areas to feed on polychaetes and small crabs. Stomach contents listed gastropods (e.g. Atys sp.), polychaetes, small clams, solenogastrid, isopods, brachyuran crabs, and other crustaceans (Ref. 27370). Tends to occur in aggregations (Ref. 30573). Venomous spine on its preopercle. Size rarely exceeds 13 cm. Minimum depth reported taken from Ref. 30874.
  • Parrish, J.D., J.E. Norris, M.W. Callahan, J.K. Callahan, E.J. Magarifuji and R.E. Schroeder 1986 Piscivory in a coral reef fish community. p. 285-297. In C.A. Simenstad and G.M. Cailliet (eds.) Contemporary studies on fish feeding. Dr. W. Junk Publishers, Dordrecht, The Netherlands. (Ref. 2763)   http://www.fishbase.org/references/FBRefSummary.php?id=2763&speccode=4908 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Sargocentron diadema

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 11
Specimens with Barcodes: 50
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Sargocentron diadema

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTTTATTTAGTATTCGGTGCCTGAGCTGGAATAGTTGGCACAGCCCTTAGCCTTCTTATTCGAGCTGAACTTAGCCAGCCCGGAGCCCTTCTGGGAGACGACCAGATTTATAATGTCATTGTTACAGCACATGCATTTGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGAGGCTTCGGGAACTGATTAATTCCTTTAATAATCGGAGCCCCCGACATGGCATTCCCTCGAATGAACAACATGAGCTTCTGACTTCTTCCCCCCTCATTCCTGCTTTTATTAGCTTCTTCCGGAGTTGAAGCTGGTGCCGGGACAGGATGAACGGTGTACCCACCGCTGGCAGGCAACCTAGCACACGCAGGAGCTTCTGTCGACCTGACTATTTTCTCACTCCATCTAGCAGGGATTTCCTCAATTCTAGGGGCCATTAATTTTATTACAACAATTATTAACATGAAACCTCCTGCCATTTCTCAATATCAGACACCGCTGTTTGTATGAGCTGTCCTAATTACAGCAGTACTTCTCCTTCTCTCCCTGCCCGTACTCGCAGCAGGCATTACTATGCTACTTACAGACCGAAACCTAAATACAACATTCTTCGACCCAGCAGGAGGTGGAGACCCAATTCTTTATCAACACCT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial; price category: medium; price reliability: very questionable: based on ex-vessel price for species in this family
  • Miyasaka, A. 1993 A database on scientific and common names of fishes exported from Hawaii. The information was derived from the above mentioned database. A printout of the names is also available from the State of Hawaii, Department of Land and Natural Resources, 1151 Punchbowl Street, Honolulu, Hawaii. (Ref. 5358)   http://www.fishbase.org/references/FBRefSummary.php?id=5358&speccode=4306 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Sargocentron diadema

Sargocentron diadema, known commonly as the crowned squirrelfish, is a member of the family Holocentridae in the order Beryciformes. Squirrelfish in general are large, active, nocturnal fish which are usually red in color.[2]

Distribution[edit]

The crowned squirrelfish is commonly found on the reefs of the Indo-Pacific, from East Africa to Tahiti.[3]

Description[edit]

The fish is bright red with thin white lines crossing from the gill cover to the caudal peduncle. The gill cover has two vertical white lines. A third line runs along the upper lip and below the large eye.[3]

In captivity[edit]

This species is sometimes kept in aquaria. It is an active, shoaling fish which is kept in large tanks with other individuals of the species. Other species of a similar size can be kept with it, but it may eat smaller fish. It can be sustained on meat-based fish food.[2]

The aquarium is kept between 72 and 78°F (22-26°C) the pH is about 8.1 to 8.4, and the salinity is 1.020 to 1.025.[4]

References[edit]

  1. ^ The Taxonomicon
  2. ^ a b Bailey, M. and G. Sandford. The Ultimate Encyclopedia of Aquarium Fish & Fish Care. pg. 246.
  3. ^ a b Mills, D. Eyewitness Handbooks Aquarium Fish: The Visual Guide to More Than 500 Marine and Freshwater Fish Varieties. pg. 284.
  4. ^ Aquatic Community
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!