Overview

Comprehensive Description

Biology

Found usually over sandy or muddy bottoms in coastal waters to about 60 m depth. Occurs in nursery and feeding grounds in river estuaries during summer and fall. Juveniles often stay in the estuarine waters throughout the year. Feeds mainly on worms, small crustaceans and organic detritus. A small specimen of this species was caught in Tokyo Bay, Japan, probably brought in with the ballast water of a ship (Ref. 10325).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Leiostomus xanthurus is a moderately deep-bodied, compressed fish with an elevated back. Body color is typically bluish-gray dorsally, fading to golden yellow or yellow-tan ventrally. A set of 12 -15 dark streaks run obliquely from the dorsal surface down the sides to about mid-body. These tend to fade with age. Fins are typically pale yellow in color. The head is short, with a small, inferior mouth. The maxilla extends to approximately the middle of the eye. The dorsal fin is continuous, with a notch separating the spinous portion from the soft rays. There are 9-11 dorsal spines, and 29-35 soft rays. The anal fin has 2 spines and 12-13 rays. The caudal peduncle is moderately deep, and the caudal fin is notched. A large black spot is set above the upper edge of the gill cover. There are 72-77 lateral line scales (Johnson 1978).
  • Bigelow, H.B., and W.C. Schroeder. 1953. Fishes of the Gulf of Maine. U.S. Fish Wildl. Serv. Fish. Bull. 74:1-577.
  • Bullock, W.L. 1957. The acanthocephalan parasites of the fishes of the Texas coast. Publ. Inst. Mar. Sci. Univ. Texas 4:278-283.
  • Burton, D.T. 1979. Ventilation frequency compensation responses of three eurythermal estuarine fish exposed to moderate temperature increases. J. Fish Biol. 15:589-600.
  • Burton, D.T., L.B. Richardson, and C.J. Moore. 1980. Effect of oxygen reduction rate and constant low dissolved oxygen concentrations on two estuarine fish. Trans. Am. Fish. Soc. 109:552-557.
  • Chao, L.N., and J.A. Musick. 1977. Life history, feeding habits, and functional morphology of juvenile sciaenid fishes in the York River estuary. U.S. Natl. Mar. Fish. Serv. Fish. Bull. 75:657-702.
  • Chao, L.N., 1978 Sciaenidae. In W. Fischer (ed.) FAO species identification sheets for fishery purposes. West Atlantic (Fishing Area 31). Volume 4. FAO, Rome.
  • Dawson, C.E. 1958. A study of the biology and life history of the spot, Leiostomus xanthurus Lacepede, with special reference to South Carolina. S.C. Wildl. Mar. Res. Dep. Contrib. Bears Bluff Lab. No. 28. 48 pp.
  • DeVries, D.A. 1982. Age and growth of spot in North Carolina. Northeast Fish Widl. Conf., April 13-15, 1982 Cherry Hill, NJ (Abstract).
  • Govoni, J.J. 1983. Helminth parasitism of three larval fishes in the northern Gulf ofMexico. U.S. Natl. Mar. Fish. Serv. Fish. Bull. 81:895-898.
  • Govoni, J.J., A.J. Chester, D.E. Hoss, and P.B. Ortner. 1985. An observation of episodic feeding and growth of larval Leiostomus xanthurus in the northern Gulf of Mexico. J. Plankton Res. 7:137-141.
  • Govoni, J.J., D.S. Peters, and J.V. Merriner. 1982. Carbon assimilation during larval development of the marine teleost Leiostomus xanthurus Lacepede. J. Exp. Mar. Biol. Ecol. 64:287-299.
  • Gunter, G. 1945. Studies on the marine fishes of Texas. Publ. Inst. Mar. Sci. Univ. Texas 1:9-190.
  • Hales, L.S. and M.J. Van Den Avyle. 1989. Species profiles: life histories and environmental requirements of coastal fishes and invertebrates (South Atlantic)Spot. U.S. Fish and Wildlife Service Biological Report 82(11). U.S. Army Corps of Engineers TR EL-82-4.
  • Hettler, W.F. 1979. Swimming speeds of juvenile estuarine fish in a circular flume.Proc. Ann. Conf. Southeast. Assoc. Fish Wildl. Agencies 31:392-398.
  • Hettler, W.F., and L.C. Clements. 1978. Effects of acute thermal stress on marinefish embryos and larvae. Pages 171-190 in Fourth National Workshop on Entrainment and Impingement, Ecological Analysts Communications, Melville, New York.
  • Hildebrand, S.F., and L. Cable. 1930. Development and life history of fourteen teleostean fishes at Beaufort, North Carolina. Bull. U.S. Bur. Fish. 46:383-488.
  • Hildebrand, S.F., and W.C. Schroeder. 1928. Fishes of Chesapeake Bay. Bull. U.S. Bur. Fish. 43, Part 1. 366 pp.
  • Hodson, R.G., R.G. Fechhelm, and R.J. Monroe. 1981a. Upper temperature tolerance of the spot, Leiostomus xanthurus, from the Cape Fear River Estuary, North Carolina. Estuaries 4:345-356.
  • Hodson, R.G., J.O. Hackman, and C.R. Bennett. 1981b. Food habits of young spot in nursery areas of the Cape Fear River Estuary, North Carolina. Trans. Am. Fish. Soc. 110:495-501.
  • Hoss, D.E., W.F. Hettler, and L.C. Clements. 1974. Effects of thermal shock on larval estuarine fish - ecological implications with respect to entrainment in power plant cooling systems. Pages 357-371 in: J.H.S. Blaxter, ed. The Early Life History of Fish. Springer-Verlag, New York.
  • Houde, E.D. 1978. Critical food levels for growth and survival of laboratory reared larvae of three species of subtropical marine fishes. Bull. Mar. Sci.28:395-411.
  • Johnson, G.D. 1978. Development of Fishes of the Mid-Atlantic Bight. Volume IV, Carangidae through Ephippidae. U.S. Fish. Wildl. Serv. Biol. Serv. Program FWS/OBS-78/12. 416 pp.
  • Kjelson, M.A., and G.N. Johnson. 1976. Further observations of the feeding ecology of postlarval pinfish, Lagodon rhomboides, and spot, Leiostomus xanthurus. U.S. Natl. Mar. Fish. Serv. Fish. Bull. 74:423-432.
  • Kjelson, M.A., D.S. Peters, G.W. Thayer, and G.N. Johnson. 1975. The general feeding ecology of postlarval fishes in the Newport River estuary. U.S. Natl. Mar. Fish. Serv. Fish. Bull. 73:137-144.
  • Lewis, R.M., and M.H. Judy. 1983. The occurrence of spot, Leiostomus xanthurus, and Atlantic croaker, Micropogonias undulatus, larvae in Onslow Bay and the Newport River estuary, North Carolina. U.S. Natl. Mar. Fish. Serv. Fish. Bull. 81:405-412.
  • Murphy, Michael D. 2003. Species account for spot (Leiostomus xanthurus) in: Florida. Florida Fish and Wildlife Research Institute, Florida Fish and Wildlife Conservation Commission. Available on the Internet at: http://www.floridamarine.org/features/view_article.asp?id=5573
  • Music, J.L. 1974. Observations on the spot Leiostomus xanthurus in Georgia's estuarine and close inshore ocean waters. Ga. Dep. Nat. Resour. Contrib. Ser.28. 29 pp.
  • Nelson, W.R. 1969. Studies on the croaker, Micropogon undulatus Linnaeus, and the spot, Leiostomus xanthurus Lacepede, in Mobile Bay, Alabama. J. Mar. Sci. Alabama 1:4-92.
  • Neumann, D.A., J.M. O'Conner, and J.A. Sherk, Jr. 1981. Oxygen consumption of white perch (Morone americana), striped bass (Morone saxatilis), and spot (Leiostomus xanthurus). Comp. Biochem. Physiol. 69A:467-478.
  • Pacheco, A.L. 1962. Age and growth of spot in lower Chesapeake Bay, with notes on the distribution and abundance of juveniles in the York River system. Chesapeake Sci. 3:18-28.
  • Parker, J.C. 1971. The biology of the spot, Leiostomus xanthurus, and the Atlantic croaker, Micropogon undulatus, in two Gulf of Mexico nursery areas. Tex. A&M Univ. Sea Grant Publ. NOAA-TAMU-SG-14, College Station, TX.
  • McRae, G., R.G. Muller, and R. Paperno. 1997. Update on Florida's Spot Fishery Report to the Marine Fisheries Commission, July 10, 1997. Department of Environmental Protection Florida Marine Research Institute, 100 Eighth Avenue Southeast, St. Petersburg, FL 33701-5095.
  • Pearson, J.C. 1932. Winter trawl fishery of the Virginia and North Carolina coasts. U.S. Bur. Fish. Investigative Rep. 10. 31 pp.
  • Powell, A.B., and H.R. Gordy. 1980. Egg and larval development of the spot, Leiostomus xanthurus. U.S. Natl. Mar. Fish. Serv. Fish. Bull. 78:701-714.
  • Roberts, M.H., Jr. 1980. Survival of juvenile spot (Leiostomus xanthurus) exposed to bromochlorinated and chlorinated sewage in estuarine waters. Mar. Environ. Res. 3:63-80.
  • Roelofs, E.W. 1954. Food studies of young sciaenid fishes, Micropogon and Leiostomus, from North Carolina. Copeia 1954:151-153.Rozas, L.P., and C.T. Hackney. 1984. Use of oligohaline marshes by fishes and macrofaunal crustaceans in North Carolina. Estuaries 7:213-224.
  • Rulifson, R.A. 1977. Temperature and water velocity effects on the swimming performances of young-of-the-year striped mullet (Mugil cephalus), spot (Leiostomus xanthurus), and pinfish (Lagodon rhomboides). J. Fish. Res. Board Can. 34:2316-2322.
  • Sawyer, R.T., A.R. Lawler, and R.M. Overstreet. 1975. Marine leeches of the eastern U.S. and the Gulf of Mexico with a key to the species. J. Nat. Hist. 9:633-667.
  • Townsend, B.C., Jr. 1956. A study of the spot, Leiostomus xanthurus Lacepede, in Alligator Harbor, Florida. M.S. Thesis. Florida State University, Tallahassee. 43 pp.
  • Warlen, S.M., and A.J. Chester. 1985. Age, growth and distribution of larval spot; Leiostomus xanthurus, off North Carolina. U.S. Natl. Mar. Fish. Serv. Fish Bull. 83:587-599.
  • Weinstein, M.P. 1983. Population dynamics of an estuarine dependent fish, the spot (Leiostomus xanthurus), along a tidal creek-seagrass meadow coenocline. Can. J. Fish. Aquat. Sci. 40:1633-1638.
  • Weinstein, M.P., and M.P. Walters. 1981. Growth, survival, and production in young-of-year populations of Leiostomus xanthurus Lacepede residing in tidal creeks. Estuaries 4:185-197.
  • Welsh, W.W., and C.M. Breder, Jr. 1923. Contributions to the life histories of Sciaenidae of the eastern United States coast. Bull. U.S. Bur. Fish. 39:141-201.
  • Wenner, C-A., C.A. Barans, B.W. Stender, and F.H. Berry. 1979a. Results of MARMAP otter trawl investigations in the South Atlantic Bight. I. Fall, 1973. S.C. Dep. Wildl. Mar. Res. Center Tech. Rep. 33. 79 pp.
  • Wenner, C.A., C.A. Barans, B.W. Stender, and F.H. Berry. 1980. Results of MARMAP otter trawl investigations in the South Atlantic Bight. V. Summer, 1975. S.C. Dep. Wildl. Mar. Res. Center Tech. Rep. 45. 57 pp.
  • Yoder, J.A., L.P. Atkinson, J.O. Blanton, D.R. Deibel, D.W. Menzel, and G.A. Paffenhofer. 1981. Plankton productivity and the distribution of fishes on the southeastern U.S. continental shelf. Science 214:352-353.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic: Massachusetts to northern Mexico; absent in southern Florida.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Leiostomus xanthurus (commonly known as the "Spot") can be found in marine areas along the Atlantic seaboard from the Gulf of Maine down the coast all the way to the mouth of the Rio Grande. The greatest abundance can be found in the stretch between the Chesapeake Bay and South Carolina (Florida Caribbean Science Center 2000; Husser 1999; Chesapeake Bay Program 2000).

Biogeographic Regions: atlantic ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic: Massachusetts Bay to northern Mexico; absent in southern Florida.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Gulf of Maine, Gulf of Mexico, North West Atlantic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Estuarine and coastal waters from Cape Cod to Bay of Campeche, Mexico; especially abundant in estuaries in summer and fall from Delaware Bay to Georgia (Phillips et al. 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Leiostomus xanthurus is common along the Atlantic coast from Cape Cod south to the Bay of Campeche, Mexico. It occurs irregularly in south Florida and the Florida Keys, and north of Cape Cod, Massachusetts (Bigelow and Schroeder 1953; Chao 1978). Spot are common throughout the Indian River Lagoon, especially around Brevard and Indian River Counties.
  • Bigelow, H.B., and W.C. Schroeder. 1953. Fishes of the Gulf of Maine. U.S. Fish Wildl. Serv. Fish. Bull. 74:1-577.
  • Bullock, W.L. 1957. The acanthocephalan parasites of the fishes of the Texas coast. Publ. Inst. Mar. Sci. Univ. Texas 4:278-283.
  • Burton, D.T. 1979. Ventilation frequency compensation responses of three eurythermal estuarine fish exposed to moderate temperature increases. J. Fish Biol. 15:589-600.
  • Burton, D.T., L.B. Richardson, and C.J. Moore. 1980. Effect of oxygen reduction rate and constant low dissolved oxygen concentrations on two estuarine fish. Trans. Am. Fish. Soc. 109:552-557.
  • Chao, L.N., and J.A. Musick. 1977. Life history, feeding habits, and functional morphology of juvenile sciaenid fishes in the York River estuary. U.S. Natl. Mar. Fish. Serv. Fish. Bull. 75:657-702.
  • Chao, L.N., 1978 Sciaenidae. In W. Fischer (ed.) FAO species identification sheets for fishery purposes. West Atlantic (Fishing Area 31). Volume 4. FAO, Rome.
  • Dawson, C.E. 1958. A study of the biology and life history of the spot, Leiostomus xanthurus Lacepede, with special reference to South Carolina. S.C. Wildl. Mar. Res. Dep. Contrib. Bears Bluff Lab. No. 28. 48 pp.
  • DeVries, D.A. 1982. Age and growth of spot in North Carolina. Northeast Fish Widl. Conf., April 13-15, 1982 Cherry Hill, NJ (Abstract).
  • Govoni, J.J. 1983. Helminth parasitism of three larval fishes in the northern Gulf ofMexico. U.S. Natl. Mar. Fish. Serv. Fish. Bull. 81:895-898.
  • Govoni, J.J., A.J. Chester, D.E. Hoss, and P.B. Ortner. 1985. An observation of episodic feeding and growth of larval Leiostomus xanthurus in the northern Gulf of Mexico. J. Plankton Res. 7:137-141.
  • Govoni, J.J., D.S. Peters, and J.V. Merriner. 1982. Carbon assimilation during larval development of the marine teleost Leiostomus xanthurus Lacepede. J. Exp. Mar. Biol. Ecol. 64:287-299.
  • Gunter, G. 1945. Studies on the marine fishes of Texas. Publ. Inst. Mar. Sci. Univ. Texas 1:9-190.
  • Hales, L.S. and M.J. Van Den Avyle. 1989. Species profiles: life histories and environmental requirements of coastal fishes and invertebrates (South Atlantic)Spot. U.S. Fish and Wildlife Service Biological Report 82(11). U.S. Army Corps of Engineers TR EL-82-4.
  • Hettler, W.F. 1979. Swimming speeds of juvenile estuarine fish in a circular flume.Proc. Ann. Conf. Southeast. Assoc. Fish Wildl. Agencies 31:392-398.
  • Hettler, W.F., and L.C. Clements. 1978. Effects of acute thermal stress on marinefish embryos and larvae. Pages 171-190 in Fourth National Workshop on Entrainment and Impingement, Ecological Analysts Communications, Melville, New York.
  • Hildebrand, S.F., and L. Cable. 1930. Development and life history of fourteen teleostean fishes at Beaufort, North Carolina. Bull. U.S. Bur. Fish. 46:383-488.
  • Hildebrand, S.F., and W.C. Schroeder. 1928. Fishes of Chesapeake Bay. Bull. U.S. Bur. Fish. 43, Part 1. 366 pp.
  • Hodson, R.G., R.G. Fechhelm, and R.J. Monroe. 1981a. Upper temperature tolerance of the spot, Leiostomus xanthurus, from the Cape Fear River Estuary, North Carolina. Estuaries 4:345-356.
  • Hodson, R.G., J.O. Hackman, and C.R. Bennett. 1981b. Food habits of young spot in nursery areas of the Cape Fear River Estuary, North Carolina. Trans. Am. Fish. Soc. 110:495-501.
  • Hoss, D.E., W.F. Hettler, and L.C. Clements. 1974. Effects of thermal shock on larval estuarine fish - ecological implications with respect to entrainment in power plant cooling systems. Pages 357-371 in: J.H.S. Blaxter, ed. The Early Life History of Fish. Springer-Verlag, New York.
  • Houde, E.D. 1978. Critical food levels for growth and survival of laboratory reared larvae of three species of subtropical marine fishes. Bull. Mar. Sci.28:395-411.
  • Johnson, G.D. 1978. Development of Fishes of the Mid-Atlantic Bight. Volume IV, Carangidae through Ephippidae. U.S. Fish. Wildl. Serv. Biol. Serv. Program FWS/OBS-78/12. 416 pp.
  • Kjelson, M.A., and G.N. Johnson. 1976. Further observations of the feeding ecology of postlarval pinfish, Lagodon rhomboides, and spot, Leiostomus xanthurus. U.S. Natl. Mar. Fish. Serv. Fish. Bull. 74:423-432.
  • Kjelson, M.A., D.S. Peters, G.W. Thayer, and G.N. Johnson. 1975. The general feeding ecology of postlarval fishes in the Newport River estuary. U.S. Natl. Mar. Fish. Serv. Fish. Bull. 73:137-144.
  • Lewis, R.M., and M.H. Judy. 1983. The occurrence of spot, Leiostomus xanthurus, and Atlantic croaker, Micropogonias undulatus, larvae in Onslow Bay and the Newport River estuary, North Carolina. U.S. Natl. Mar. Fish. Serv. Fish. Bull. 81:405-412.
  • Murphy, Michael D. 2003. Species account for spot (Leiostomus xanthurus) in: Florida. Florida Fish and Wildlife Research Institute, Florida Fish and Wildlife Conservation Commission. Available on the Internet at: http://www.floridamarine.org/features/view_article.asp?id=5573
  • Music, J.L. 1974. Observations on the spot Leiostomus xanthurus in Georgia's estuarine and close inshore ocean waters. Ga. Dep. Nat. Resour. Contrib. Ser.28. 29 pp.
  • Nelson, W.R. 1969. Studies on the croaker, Micropogon undulatus Linnaeus, and the spot, Leiostomus xanthurus Lacepede, in Mobile Bay, Alabama. J. Mar. Sci. Alabama 1:4-92.
  • Neumann, D.A., J.M. O'Conner, and J.A. Sherk, Jr. 1981. Oxygen consumption of white perch (Morone americana), striped bass (Morone saxatilis), and spot (Leiostomus xanthurus). Comp. Biochem. Physiol. 69A:467-478.
  • Pacheco, A.L. 1962. Age and growth of spot in lower Chesapeake Bay, with notes on the distribution and abundance of juveniles in the York River system. Chesapeake Sci. 3:18-28.
  • Parker, J.C. 1971. The biology of the spot, Leiostomus xanthurus, and the Atlantic croaker, Micropogon undulatus, in two Gulf of Mexico nursery areas. Tex. A&M Univ. Sea Grant Publ. NOAA-TAMU-SG-14, College Station, TX.
  • McRae, G., R.G. Muller, and R. Paperno. 1997. Update on Florida's Spot Fishery Report to the Marine Fisheries Commission, July 10, 1997. Department of Environmental Protection Florida Marine Research Institute, 100 Eighth Avenue Southeast, St. Petersburg, FL 33701-5095.
  • Pearson, J.C. 1932. Winter trawl fishery of the Virginia and North Carolina coasts. U.S. Bur. Fish. Investigative Rep. 10. 31 pp.
  • Powell, A.B., and H.R. Gordy. 1980. Egg and larval development of the spot, Leiostomus xanthurus. U.S. Natl. Mar. Fish. Serv. Fish. Bull. 78:701-714.
  • Roberts, M.H., Jr. 1980. Survival of juvenile spot (Leiostomus xanthurus) exposed to bromochlorinated and chlorinated sewage in estuarine waters. Mar. Environ. Res. 3:63-80.
  • Roelofs, E.W. 1954. Food studies of young sciaenid fishes, Micropogon and Leiostomus, from North Carolina. Copeia 1954:151-153.Rozas, L.P., and C.T. Hackney. 1984. Use of oligohaline marshes by fishes and macrofaunal crustaceans in North Carolina. Estuaries 7:213-224.
  • Rulifson, R.A. 1977. Temperature and water velocity effects on the swimming performances of young-of-the-year striped mullet (Mugil cephalus), spot (Leiostomus xanthurus), and pinfish (Lagodon rhomboides). J. Fish. Res. Board Can. 34:2316-2322.
  • Sawyer, R.T., A.R. Lawler, and R.M. Overstreet. 1975. Marine leeches of the eastern U.S. and the Gulf of Mexico with a key to the species. J. Nat. Hist. 9:633-667.
  • Townsend, B.C., Jr. 1956. A study of the spot, Leiostomus xanthurus Lacepede, in Alligator Harbor, Florida. M.S. Thesis. Florida State University, Tallahassee. 43 pp.
  • Warlen, S.M., and A.J. Chester. 1985. Age, growth and distribution of larval spot; Leiostomus xanthurus, off North Carolina. U.S. Natl. Mar. Fish. Serv. Fish Bull. 83:587-599.
  • Weinstein, M.P. 1983. Population dynamics of an estuarine dependent fish, the spot (Leiostomus xanthurus), along a tidal creek-seagrass meadow coenocline. Can. J. Fish. Aquat. Sci. 40:1633-1638.
  • Weinstein, M.P., and M.P. Walters. 1981. Growth, survival, and production in young-of-year populations of Leiostomus xanthurus Lacepede residing in tidal creeks. Estuaries 4:185-197.
  • Welsh, W.W., and C.M. Breder, Jr. 1923. Contributions to the life histories of Sciaenidae of the eastern United States coast. Bull. U.S. Bur. Fish. 39:141-201.
  • Wenner, C-A., C.A. Barans, B.W. Stender, and F.H. Berry. 1979a. Results of MARMAP otter trawl investigations in the South Atlantic Bight. I. Fall, 1973. S.C. Dep. Wildl. Mar. Res. Center Tech. Rep. 33. 79 pp.
  • Wenner, C.A., C.A. Barans, B.W. Stender, and F.H. Berry. 1980. Results of MARMAP otter trawl investigations in the South Atlantic Bight. V. Summer, 1975. S.C. Dep. Wildl. Mar. Res. Center Tech. Rep. 45. 57 pp.
  • Yoder, J.A., L.P. Atkinson, J.O. Blanton, D.R. Deibel, D.W. Menzel, and G.A. Paffenhofer. 1981. Plankton productivity and the distribution of fishes on the southeastern U.S. continental shelf. Science 214:352-353.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Massachusetts to northern Mexico; absent in southern Florida.
  • Bigelow, H. B. and Schroeder, W. C., 1953; Robins, C. R. and G. C. Ray, 1986; Sasaki, K., S. Hosoya and S. Watanabe, 1989.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Leiostomus xanthurus can reach a maximum of 36 centimeters but usually barely exceed a foot in length. Approximate lengths for fish ages 1-5 are 5.5 inches, 8.5 inches, 9.5 inches, 11.5 inches, and 13.5 inches, respectively. Characterized by and named for the dark, round, eye-sized spot behind the upper edge of the gill cover, these fish have deep, short, and compressed bodies. Their coloring is a bluish gray to silver with a gold tint on the sides. The fins are pale yellow--except for the dorsal and caudal fins which are a milky color. While there are approximately a dozen thin, oblique bars on the upper portion of the fish stretching from the gill to the tail, the dorsal fin has thirty rays while the anal fin has more than twelve rays. The tail is slightly concave and has no chin barbels. A lateral line goes all the way down to the tail. The spiny and soft parts of the dorsal fin are separated by a deep notch. These fish have short heads with a small mouth, which lack teeth on the lower jaw. There is no real distinction between males and females (Florida Caribbean Science Center 2000; Husser 1999; Chesapeake Bay Program 2000; Schultz 2001; EarthMax Development 2001).

Average mass: 227 g.

Average mass: 247.5 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 360 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

36.0 cm TL (male/unsexed; (Ref. 7251)); max. published weight: 450 g (Ref. 40637); max. reported age: 4 years (Ref. 12193)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Length: 36 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Leiostomus xanthusrus grows to approximately 11 inches total length (TL). In the first year it may reach 5.9 inches; in the second year, 8.7 inches; and in the third year 11 inches (Townsend 1956; Welsh and Breder, 1923; McRae et al. 1997). The lifespan may be as long as 5 years (DeVries 1982).Growth rates in spot show both seasonal and annual variation. In young juveniles, growth rates are fastest in late spring and early summer, with high estuarine water temperatures in late summer and early fall tending to reduce feeding and retarding growth (Weinstein and Walters, 1981).Both juvenile and adult spot grow more slowly during winter (Dawson, 1958).
  • Bigelow, H.B., and W.C. Schroeder. 1953. Fishes of the Gulf of Maine. U.S. Fish Wildl. Serv. Fish. Bull. 74:1-577.
  • Bullock, W.L. 1957. The acanthocephalan parasites of the fishes of the Texas coast. Publ. Inst. Mar. Sci. Univ. Texas 4:278-283.
  • Burton, D.T. 1979. Ventilation frequency compensation responses of three eurythermal estuarine fish exposed to moderate temperature increases. J. Fish Biol. 15:589-600.
  • Burton, D.T., L.B. Richardson, and C.J. Moore. 1980. Effect of oxygen reduction rate and constant low dissolved oxygen concentrations on two estuarine fish. Trans. Am. Fish. Soc. 109:552-557.
  • Chao, L.N., and J.A. Musick. 1977. Life history, feeding habits, and functional morphology of juvenile sciaenid fishes in the York River estuary. U.S. Natl. Mar. Fish. Serv. Fish. Bull. 75:657-702.
  • Chao, L.N., 1978 Sciaenidae. In W. Fischer (ed.) FAO species identification sheets for fishery purposes. West Atlantic (Fishing Area 31). Volume 4. FAO, Rome.
  • Dawson, C.E. 1958. A study of the biology and life history of the spot, Leiostomus xanthurus Lacepede, with special reference to South Carolina. S.C. Wildl. Mar. Res. Dep. Contrib. Bears Bluff Lab. No. 28. 48 pp.
  • DeVries, D.A. 1982. Age and growth of spot in North Carolina. Northeast Fish Widl. Conf., April 13-15, 1982 Cherry Hill, NJ (Abstract).
  • Govoni, J.J. 1983. Helminth parasitism of three larval fishes in the northern Gulf ofMexico. U.S. Natl. Mar. Fish. Serv. Fish. Bull. 81:895-898.
  • Govoni, J.J., A.J. Chester, D.E. Hoss, and P.B. Ortner. 1985. An observation of episodic feeding and growth of larval Leiostomus xanthurus in the northern Gulf of Mexico. J. Plankton Res. 7:137-141.
  • Govoni, J.J., D.S. Peters, and J.V. Merriner. 1982. Carbon assimilation during larval development of the marine teleost Leiostomus xanthurus Lacepede. J. Exp. Mar. Biol. Ecol. 64:287-299.
  • Gunter, G. 1945. Studies on the marine fishes of Texas. Publ. Inst. Mar. Sci. Univ. Texas 1:9-190.
  • Hales, L.S. and M.J. Van Den Avyle. 1989. Species profiles: life histories and environmental requirements of coastal fishes and invertebrates (South Atlantic)Spot. U.S. Fish and Wildlife Service Biological Report 82(11). U.S. Army Corps of Engineers TR EL-82-4.
  • Hettler, W.F. 1979. Swimming speeds of juvenile estuarine fish in a circular flume.Proc. Ann. Conf. Southeast. Assoc. Fish Wildl. Agencies 31:392-398.
  • Hettler, W.F., and L.C. Clements. 1978. Effects of acute thermal stress on marinefish embryos and larvae. Pages 171-190 in Fourth National Workshop on Entrainment and Impingement, Ecological Analysts Communications, Melville, New York.
  • Hildebrand, S.F., and L. Cable. 1930. Development and life history of fourteen teleostean fishes at Beaufort, North Carolina. Bull. U.S. Bur. Fish. 46:383-488.
  • Hildebrand, S.F., and W.C. Schroeder. 1928. Fishes of Chesapeake Bay. Bull. U.S. Bur. Fish. 43, Part 1. 366 pp.
  • Hodson, R.G., R.G. Fechhelm, and R.J. Monroe. 1981a. Upper temperature tolerance of the spot, Leiostomus xanthurus, from the Cape Fear River Estuary, North Carolina. Estuaries 4:345-356.
  • Hodson, R.G., J.O. Hackman, and C.R. Bennett. 1981b. Food habits of young spot in nursery areas of the Cape Fear River Estuary, North Carolina. Trans. Am. Fish. Soc. 110:495-501.
  • Hoss, D.E., W.F. Hettler, and L.C. Clements. 1974. Effects of thermal shock on larval estuarine fish - ecological implications with respect to entrainment in power plant cooling systems. Pages 357-371 in: J.H.S. Blaxter, ed. The Early Life History of Fish. Springer-Verlag, New York.
  • Houde, E.D. 1978. Critical food levels for growth and survival of laboratory reared larvae of three species of subtropical marine fishes. Bull. Mar. Sci.28:395-411.
  • Johnson, G.D. 1978. Development of Fishes of the Mid-Atlantic Bight. Volume IV, Carangidae through Ephippidae. U.S. Fish. Wildl. Serv. Biol. Serv. Program FWS/OBS-78/12. 416 pp.
  • Kjelson, M.A., and G.N. Johnson. 1976. Further observations of the feeding ecology of postlarval pinfish, Lagodon rhomboides, and spot, Leiostomus xanthurus. U.S. Natl. Mar. Fish. Serv. Fish. Bull. 74:423-432.
  • Kjelson, M.A., D.S. Peters, G.W. Thayer, and G.N. Johnson. 1975. The general feeding ecology of postlarval fishes in the Newport River estuary. U.S. Natl. Mar. Fish. Serv. Fish. Bull. 73:137-144.
  • Lewis, R.M., and M.H. Judy. 1983. The occurrence of spot, Leiostomus xanthurus, and Atlantic croaker, Micropogonias undulatus, larvae in Onslow Bay and the Newport River estuary, North Carolina. U.S. Natl. Mar. Fish. Serv. Fish. Bull. 81:405-412.
  • Murphy, Michael D. 2003. Species account for spot (Leiostomus xanthurus) in: Florida. Florida Fish and Wildlife Research Institute, Florida Fish and Wildlife Conservation Commission. Available on the Internet at: http://www.floridamarine.org/features/view_article.asp?id=5573
  • Music, J.L. 1974. Observations on the spot Leiostomus xanthurus in Georgia's estuarine and close inshore ocean waters. Ga. Dep. Nat. Resour. Contrib. Ser.28. 29 pp.
  • Nelson, W.R. 1969. Studies on the croaker, Micropogon undulatus Linnaeus, and the spot, Leiostomus xanthurus Lacepede, in Mobile Bay, Alabama. J. Mar. Sci. Alabama 1:4-92.
  • Neumann, D.A., J.M. O'Conner, and J.A. Sherk, Jr. 1981. Oxygen consumption of white perch (Morone americana), striped bass (Morone saxatilis), and spot (Leiostomus xanthurus). Comp. Biochem. Physiol. 69A:467-478.
  • Pacheco, A.L. 1962. Age and growth of spot in lower Chesapeake Bay, with notes on the distribution and abundance of juveniles in the York River system. Chesapeake Sci. 3:18-28.
  • Parker, J.C. 1971. The biology of the spot, Leiostomus xanthurus, and the Atlantic croaker, Micropogon undulatus, in two Gulf of Mexico nursery areas. Tex. A&M Univ. Sea Grant Publ. NOAA-TAMU-SG-14, College Station, TX.
  • McRae, G., R.G. Muller, and R. Paperno. 1997. Update on Florida's Spot Fishery Report to the Marine Fisheries Commission, July 10, 1997. Department of Environmental Protection Florida Marine Research Institute, 100 Eighth Avenue Southeast, St. Petersburg, FL 33701-5095.
  • Pearson, J.C. 1932. Winter trawl fishery of the Virginia and North Carolina coasts. U.S. Bur. Fish. Investigative Rep. 10. 31 pp.
  • Powell, A.B., and H.R. Gordy. 1980. Egg and larval development of the spot, Leiostomus xanthurus. U.S. Natl. Mar. Fish. Serv. Fish. Bull. 78:701-714.
  • Roberts, M.H., Jr. 1980. Survival of juvenile spot (Leiostomus xanthurus) exposed to bromochlorinated and chlorinated sewage in estuarine waters. Mar. Environ. Res. 3:63-80.
  • Roelofs, E.W. 1954. Food studies of young sciaenid fishes, Micropogon and Leiostomus, from North Carolina. Copeia 1954:151-153.Rozas, L.P., and C.T. Hackney. 1984. Use of oligohaline marshes by fishes and macrofaunal crustaceans in North Carolina. Estuaries 7:213-224.
  • Rulifson, R.A. 1977. Temperature and water velocity effects on the swimming performances of young-of-the-year striped mullet (Mugil cephalus), spot (Leiostomus xanthurus), and pinfish (Lagodon rhomboides). J. Fish. Res. Board Can. 34:2316-2322.
  • Sawyer, R.T., A.R. Lawler, and R.M. Overstreet. 1975. Marine leeches of the eastern U.S. and the Gulf of Mexico with a key to the species. J. Nat. Hist. 9:633-667.
  • Townsend, B.C., Jr. 1956. A study of the spot, Leiostomus xanthurus Lacepede, in Alligator Harbor, Florida. M.S. Thesis. Florida State University, Tallahassee. 43 pp.
  • Warlen, S.M., and A.J. Chester. 1985. Age, growth and distribution of larval spot; Leiostomus xanthurus, off North Carolina. U.S. Natl. Mar. Fish. Serv. Fish Bull. 83:587-599.
  • Weinstein, M.P. 1983. Population dynamics of an estuarine dependent fish, the spot (Leiostomus xanthurus), along a tidal creek-seagrass meadow coenocline. Can. J. Fish. Aquat. Sci. 40:1633-1638.
  • Weinstein, M.P., and M.P. Walters. 1981. Growth, survival, and production in young-of-year populations of Leiostomus xanthurus Lacepede residing in tidal creeks. Estuaries 4:185-197.
  • Welsh, W.W., and C.M. Breder, Jr. 1923. Contributions to the life histories of Sciaenidae of the eastern United States coast. Bull. U.S. Bur. Fish. 39:141-201.
  • Wenner, C-A., C.A. Barans, B.W. Stender, and F.H. Berry. 1979a. Results of MARMAP otter trawl investigations in the South Atlantic Bight. I. Fall, 1973. S.C. Dep. Wildl. Mar. Res. Center Tech. Rep. 33. 79 pp.
  • Wenner, C.A., C.A. Barans, B.W. Stender, and F.H. Berry. 1980. Results of MARMAP otter trawl investigations in the South Atlantic Bight. V. Summer, 1975. S.C. Dep. Wildl. Mar. Res. Center Tech. Rep. 45. 57 pp.
  • Yoder, J.A., L.P. Atkinson, J.O. Blanton, D.R. Deibel, D.W. Menzel, and G.A. Paffenhofer. 1981. Plankton productivity and the distribution of fishes on the southeastern U.S. continental shelf. Science 214:352-353.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

to 36 cm TL (male/unsexed).
  • Bigelow, H. B. and Schroeder, W. C., 1953; Robins, C. R. and G. C. Ray, 1986; Sasaki, K., S. Hosoya and S. Watanabe, 1989.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Look Alikes

Adults are not typically mistaken for other Sciaenids due to the prominent spot and faint oblique stripes. However, juveniles resemble a number of related species including the Atlantic croaker, Micropogonias undulatus and the silver perch, Bairdiella chrysoura. The Atlantic croaker is differentiated from the spot by having barbells on the lower jaw and a serrate preopercule. The silver perch is differentiated by its rounded caudal fin and well developed teeth.
  • Bigelow, H.B., and W.C. Schroeder. 1953. Fishes of the Gulf of Maine. U.S. Fish Wildl. Serv. Fish. Bull. 74:1-577.
  • Bullock, W.L. 1957. The acanthocephalan parasites of the fishes of the Texas coast. Publ. Inst. Mar. Sci. Univ. Texas 4:278-283.
  • Burton, D.T. 1979. Ventilation frequency compensation responses of three eurythermal estuarine fish exposed to moderate temperature increases. J. Fish Biol. 15:589-600.
  • Burton, D.T., L.B. Richardson, and C.J. Moore. 1980. Effect of oxygen reduction rate and constant low dissolved oxygen concentrations on two estuarine fish. Trans. Am. Fish. Soc. 109:552-557.
  • Chao, L.N., and J.A. Musick. 1977. Life history, feeding habits, and functional morphology of juvenile sciaenid fishes in the York River estuary. U.S. Natl. Mar. Fish. Serv. Fish. Bull. 75:657-702.
  • Chao, L.N., 1978 Sciaenidae. In W. Fischer (ed.) FAO species identification sheets for fishery purposes. West Atlantic (Fishing Area 31). Volume 4. FAO, Rome.
  • Dawson, C.E. 1958. A study of the biology and life history of the spot, Leiostomus xanthurus Lacepede, with special reference to South Carolina. S.C. Wildl. Mar. Res. Dep. Contrib. Bears Bluff Lab. No. 28. 48 pp.
  • DeVries, D.A. 1982. Age and growth of spot in North Carolina. Northeast Fish Widl. Conf., April 13-15, 1982 Cherry Hill, NJ (Abstract).
  • Govoni, J.J. 1983. Helminth parasitism of three larval fishes in the northern Gulf ofMexico. U.S. Natl. Mar. Fish. Serv. Fish. Bull. 81:895-898.
  • Govoni, J.J., A.J. Chester, D.E. Hoss, and P.B. Ortner. 1985. An observation of episodic feeding and growth of larval Leiostomus xanthurus in the northern Gulf of Mexico. J. Plankton Res. 7:137-141.
  • Govoni, J.J., D.S. Peters, and J.V. Merriner. 1982. Carbon assimilation during larval development of the marine teleost Leiostomus xanthurus Lacepede. J. Exp. Mar. Biol. Ecol. 64:287-299.
  • Gunter, G. 1945. Studies on the marine fishes of Texas. Publ. Inst. Mar. Sci. Univ. Texas 1:9-190.
  • Hales, L.S. and M.J. Van Den Avyle. 1989. Species profiles: life histories and environmental requirements of coastal fishes and invertebrates (South Atlantic)Spot. U.S. Fish and Wildlife Service Biological Report 82(11). U.S. Army Corps of Engineers TR EL-82-4.
  • Hettler, W.F. 1979. Swimming speeds of juvenile estuarine fish in a circular flume.Proc. Ann. Conf. Southeast. Assoc. Fish Wildl. Agencies 31:392-398.
  • Hettler, W.F., and L.C. Clements. 1978. Effects of acute thermal stress on marinefish embryos and larvae. Pages 171-190 in Fourth National Workshop on Entrainment and Impingement, Ecological Analysts Communications, Melville, New York.
  • Hildebrand, S.F., and L. Cable. 1930. Development and life history of fourteen teleostean fishes at Beaufort, North Carolina. Bull. U.S. Bur. Fish. 46:383-488.
  • Hildebrand, S.F., and W.C. Schroeder. 1928. Fishes of Chesapeake Bay. Bull. U.S. Bur. Fish. 43, Part 1. 366 pp.
  • Hodson, R.G., R.G. Fechhelm, and R.J. Monroe. 1981a. Upper temperature tolerance of the spot, Leiostomus xanthurus, from the Cape Fear River Estuary, North Carolina. Estuaries 4:345-356.
  • Hodson, R.G., J.O. Hackman, and C.R. Bennett. 1981b. Food habits of young spot in nursery areas of the Cape Fear River Estuary, North Carolina. Trans. Am. Fish. Soc. 110:495-501.
  • Hoss, D.E., W.F. Hettler, and L.C. Clements. 1974. Effects of thermal shock on larval estuarine fish - ecological implications with respect to entrainment in power plant cooling systems. Pages 357-371 in: J.H.S. Blaxter, ed. The Early Life History of Fish. Springer-Verlag, New York.
  • Houde, E.D. 1978. Critical food levels for growth and survival of laboratory reared larvae of three species of subtropical marine fishes. Bull. Mar. Sci.28:395-411.
  • Johnson, G.D. 1978. Development of Fishes of the Mid-Atlantic Bight. Volume IV, Carangidae through Ephippidae. U.S. Fish. Wildl. Serv. Biol. Serv. Program FWS/OBS-78/12. 416 pp.
  • Kjelson, M.A., and G.N. Johnson. 1976. Further observations of the feeding ecology of postlarval pinfish, Lagodon rhomboides, and spot, Leiostomus xanthurus. U.S. Natl. Mar. Fish. Serv. Fish. Bull. 74:423-432.
  • Kjelson, M.A., D.S. Peters, G.W. Thayer, and G.N. Johnson. 1975. The general feeding ecology of postlarval fishes in the Newport River estuary. U.S. Natl. Mar. Fish. Serv. Fish. Bull. 73:137-144.
  • Lewis, R.M., and M.H. Judy. 1983. The occurrence of spot, Leiostomus xanthurus, and Atlantic croaker, Micropogonias undulatus, larvae in Onslow Bay and the Newport River estuary, North Carolina. U.S. Natl. Mar. Fish. Serv. Fish. Bull. 81:405-412.
  • Murphy, Michael D. 2003. Species account for spot (Leiostomus xanthurus) in: Florida. Florida Fish and Wildlife Research Institute, Florida Fish and Wildlife Conservation Commission. Available on the Internet at: http://www.floridamarine.org/features/view_article.asp?id=5573
  • Music, J.L. 1974. Observations on the spot Leiostomus xanthurus in Georgia's estuarine and close inshore ocean waters. Ga. Dep. Nat. Resour. Contrib. Ser.28. 29 pp.
  • Nelson, W.R. 1969. Studies on the croaker, Micropogon undulatus Linnaeus, and the spot, Leiostomus xanthurus Lacepede, in Mobile Bay, Alabama. J. Mar. Sci. Alabama 1:4-92.
  • Neumann, D.A., J.M. O'Conner, and J.A. Sherk, Jr. 1981. Oxygen consumption of white perch (Morone americana), striped bass (Morone saxatilis), and spot (Leiostomus xanthurus). Comp. Biochem. Physiol. 69A:467-478.
  • Pacheco, A.L. 1962. Age and growth of spot in lower Chesapeake Bay, with notes on the distribution and abundance of juveniles in the York River system. Chesapeake Sci. 3:18-28.
  • Parker, J.C. 1971. The biology of the spot, Leiostomus xanthurus, and the Atlantic croaker, Micropogon undulatus, in two Gulf of Mexico nursery areas. Tex. A&M Univ. Sea Grant Publ. NOAA-TAMU-SG-14, College Station, TX.
  • McRae, G., R.G. Muller, and R. Paperno. 1997. Update on Florida's Spot Fishery Report to the Marine Fisheries Commission, July 10, 1997. Department of Environmental Protection Florida Marine Research Institute, 100 Eighth Avenue Southeast, St. Petersburg, FL 33701-5095.
  • Pearson, J.C. 1932. Winter trawl fishery of the Virginia and North Carolina coasts. U.S. Bur. Fish. Investigative Rep. 10. 31 pp.
  • Powell, A.B., and H.R. Gordy. 1980. Egg and larval development of the spot, Leiostomus xanthurus. U.S. Natl. Mar. Fish. Serv. Fish. Bull. 78:701-714.
  • Roberts, M.H., Jr. 1980. Survival of juvenile spot (Leiostomus xanthurus) exposed to bromochlorinated and chlorinated sewage in estuarine waters. Mar. Environ. Res. 3:63-80.
  • Roelofs, E.W. 1954. Food studies of young sciaenid fishes, Micropogon and Leiostomus, from North Carolina. Copeia 1954:151-153.Rozas, L.P., and C.T. Hackney. 1984. Use of oligohaline marshes by fishes and macrofaunal crustaceans in North Carolina. Estuaries 7:213-224.
  • Rulifson, R.A. 1977. Temperature and water velocity effects on the swimming performances of young-of-the-year striped mullet (Mugil cephalus), spot (Leiostomus xanthurus), and pinfish (Lagodon rhomboides). J. Fish. Res. Board Can. 34:2316-2322.
  • Sawyer, R.T., A.R. Lawler, and R.M. Overstreet. 1975. Marine leeches of the eastern U.S. and the Gulf of Mexico with a key to the species. J. Nat. Hist. 9:633-667.
  • Townsend, B.C., Jr. 1956. A study of the spot, Leiostomus xanthurus Lacepede, in Alligator Harbor, Florida. M.S. Thesis. Florida State University, Tallahassee. 43 pp.
  • Warlen, S.M., and A.J. Chester. 1985. Age, growth and distribution of larval spot; Leiostomus xanthurus, off North Carolina. U.S. Natl. Mar. Fish. Serv. Fish Bull. 83:587-599.
  • Weinstein, M.P. 1983. Population dynamics of an estuarine dependent fish, the spot (Leiostomus xanthurus), along a tidal creek-seagrass meadow coenocline. Can. J. Fish. Aquat. Sci. 40:1633-1638.
  • Weinstein, M.P., and M.P. Walters. 1981. Growth, survival, and production in young-of-year populations of Leiostomus xanthurus Lacepede residing in tidal creeks. Estuaries 4:185-197.
  • Welsh, W.W., and C.M. Breder, Jr. 1923. Contributions to the life histories of Sciaenidae of the eastern United States coast. Bull. U.S. Bur. Fish. 39:141-201.
  • Wenner, C-A., C.A. Barans, B.W. Stender, and F.H. Berry. 1979a. Results of MARMAP otter trawl investigations in the South Atlantic Bight. I. Fall, 1973. S.C. Dep. Wildl. Mar. Res. Center Tech. Rep. 33. 79 pp.
  • Wenner, C.A., C.A. Barans, B.W. Stender, and F.H. Berry. 1980. Results of MARMAP otter trawl investigations in the South Atlantic Bight. V. Summer, 1975. S.C. Dep. Wildl. Mar. Res. Center Tech. Rep. 45. 57 pp.
  • Yoder, J.A., L.P. Atkinson, J.O. Blanton, D.R. Deibel, D.W. Menzel, and G.A. Paffenhofer. 1981. Plankton productivity and the distribution of fishes on the southeastern U.S. continental shelf. Science 214:352-353.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

demersal; oceanodromous (Ref. 51243); brackish; marine; depth range ? - 60 m (Ref. 10325)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Leiostomus xanthurus are found in estuaries and coastal saltwaters roaming over sandy and muddy bottoms. They migrate seasonally--entering the bays and estuaries in the spring. They can go to waters as deep as 60 meters but usually stay in much shallower areas. They can tolerate a wide range of temperatures (35-95 degrees) and salinity (freshwater-37 ppt.) In fact, recent research has been conducted on the effects of salinity changes for juvenile Spot. During the experiment, the fish adjusted quickly to salinity changes, adapting better to an increase in salinity than a decrease. These remarkable adaptations of the young Spot might show how the Spot can emigrate from estuaries. Further research is expected to be conducted on whether or not the temperature of the water is important to the euryhaline Spot in salinity adaptation (Schultz 2001; Maryland Department of Natural Resources 2001; Miller and Moser 1994).

Aquatic Biomes: benthic ; rivers and streams; coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

benthic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 2649 specimens in 1 taxon.
Water temperature and chemistry ranges based on 793 samples.

Environmental ranges
  Depth range (m): 0 - 243
  Temperature range (°C): 8.422 - 25.997
  Nitrate (umol/L): 0.286 - 16.740
  Salinity (PPS): 32.507 - 36.329
  Oxygen (ml/l): 3.350 - 6.494
  Phosphate (umol/l): 0.092 - 1.218
  Silicate (umol/l): 0.756 - 8.021

Graphical representation

Depth range (m): 0 - 243

Temperature range (°C): 8.422 - 25.997

Nitrate (umol/L): 0.286 - 16.740

Salinity (PPS): 32.507 - 36.329

Oxygen (ml/l): 3.350 - 6.494

Phosphate (umol/l): 0.092 - 1.218

Silicate (umol/l): 0.756 - 8.021
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Comments: Shallow coastal waters and estuaries, prefers mud or sand bottoms. Juveniles especially abundant in estuaries throughout year, return to more saline waters as they grow older. Adults tend to move offshore for winter. Reported to occur in freshwater as far as 23 miles upstream from brackish water (Phillips et al. 1989). Most spawn offshore over outer continental shelf; some may spawn inshore; eggs and larvae are pelagic (Manooch 1984). In offshore waters of North Carolina, larvae are most dense in mid-water and at bottom during day, appear to migrate to surface at night; in nearshore waters, larval concentrations greatest on bottom both day and night (Phillips et al. 1989). Seagrass meadows and tidal creeks are important nursery habitats for postlarval individuals and juveniles (Phillips et al. 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Demersal; brackish; marine; depth to 60 m. Sandy or muddy bottoms in coastal waters. Occurs in estuarine waters during summer and fall. Juveniles often stay in estuaries throughout the year.
  • Bigelow, H. B. and Schroeder, W. C., 1953; Robins, C. R. and G. C. Ray, 1986; Sasaki, K., S. Hosoya and S. Watanabe, 1989.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Migrates between inshore nonspawning habitat and offshore spawning habitat (Manooch 1984).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Leiostomus xanthurus are omnivores. They consume bottom dwelling, soft bodied (benthic) invertebrates and smaller, easily crushed crabs and shrimp. Polychaetes, crustaceans, worms, small fish, small plankton, and mullusks, as well as plant and animal detritus, are also favorites (Husser 1999; Chesapeake Bay Program 2000; Schultz 2001; Atlantic Edge 2001).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Early stages eat zooplankton (copepods, etc.) and other small crustaceans; juveniles are benthic grazing generalists, eat copepods, nematodes, dipterans, clam siphons, amphipods, and polychaetes; all sizes eat bivalve siphons and maldanid polychaete tails (Phillips et al. 1989). Adults feed by scooping up benthic sediments in mouth and spitting out unwanted material; eat mainly polychaetes and copepods, with decapods, nematodes, and diatoms of lesser importance (Phillips et al. 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Leiostomus xanthurus show 2 distinct feeding modes: larvae are selective plankton feeders, while juveniles and adults are partly olfactory-dependent, benthic feeders that prey on infaunal and epibenthic invertebrates. Preferred larval foods include ciliates, invertebrate eggs, and copepod nauplii. Individuals up to 25 mm SL feed primarily on copepods and ostracods (Hildebrand and Cable 1930). Upon metamorphosis, the diet changes to include insect larvae, polychaetes, harpacticoid copepods and other crustaceans (Hildebrand and Cable 1930; Townsend 1956; Hodson et al. 1981b); however, the juvenile diet can be flexible and often is reflective of prey availability in specific areas (Hales and Van Den Avyle 1989). Chao and Musick (1977) reported that in Chesapeake Bay, prey for adult spot includes zooplankton and benthic infauna, with polychaetes most frequently observed in gut contents. Other prey types included amohipods, cumaceans, gastropods, nematodes, mysids, and copepods After growth to 10 - 15 mm SL, larvae of all sizes feed diurnally (Govoni et al. 1983). Competitors: Spot likely compete with other estuarine species; however little research has been undertaken in this area.Habitats: Spot are common in coastal waters during the spawning season, and in estuaries and nearshore waters during other parts of the year. They are typically found over sandy or muddy bottoms in waters up to approximately 60 m deep. Activity Time: Postlarvae feed most actively during daylight hours, with peaks in late morning (Kjelson et al. 1975). Juveniles switch to nocturnal feeding after metamorphosis, perhaps as a predator avoidance mechanism, or to avoid high daytime temperatures in shallow marshes (Hodson et al. 1981b). Adults tend to be nocturnal.
  • Bigelow, H.B., and W.C. Schroeder. 1953. Fishes of the Gulf of Maine. U.S. Fish Wildl. Serv. Fish. Bull. 74:1-577.
  • Bullock, W.L. 1957. The acanthocephalan parasites of the fishes of the Texas coast. Publ. Inst. Mar. Sci. Univ. Texas 4:278-283.
  • Burton, D.T. 1979. Ventilation frequency compensation responses of three eurythermal estuarine fish exposed to moderate temperature increases. J. Fish Biol. 15:589-600.
  • Burton, D.T., L.B. Richardson, and C.J. Moore. 1980. Effect of oxygen reduction rate and constant low dissolved oxygen concentrations on two estuarine fish. Trans. Am. Fish. Soc. 109:552-557.
  • Chao, L.N., and J.A. Musick. 1977. Life history, feeding habits, and functional morphology of juvenile sciaenid fishes in the York River estuary. U.S. Natl. Mar. Fish. Serv. Fish. Bull. 75:657-702.
  • Chao, L.N., 1978 Sciaenidae. In W. Fischer (ed.) FAO species identification sheets for fishery purposes. West Atlantic (Fishing Area 31). Volume 4. FAO, Rome.
  • Dawson, C.E. 1958. A study of the biology and life history of the spot, Leiostomus xanthurus Lacepede, with special reference to South Carolina. S.C. Wildl. Mar. Res. Dep. Contrib. Bears Bluff Lab. No. 28. 48 pp.
  • DeVries, D.A. 1982. Age and growth of spot in North Carolina. Northeast Fish Widl. Conf., April 13-15, 1982 Cherry Hill, NJ (Abstract).
  • Govoni, J.J. 1983. Helminth parasitism of three larval fishes in the northern Gulf ofMexico. U.S. Natl. Mar. Fish. Serv. Fish. Bull. 81:895-898.
  • Govoni, J.J., A.J. Chester, D.E. Hoss, and P.B. Ortner. 1985. An observation of episodic feeding and growth of larval Leiostomus xanthurus in the northern Gulf of Mexico. J. Plankton Res. 7:137-141.
  • Govoni, J.J., D.S. Peters, and J.V. Merriner. 1982. Carbon assimilation during larval development of the marine teleost Leiostomus xanthurus Lacepede. J. Exp. Mar. Biol. Ecol. 64:287-299.
  • Gunter, G. 1945. Studies on the marine fishes of Texas. Publ. Inst. Mar. Sci. Univ. Texas 1:9-190.
  • Hales, L.S. and M.J. Van Den Avyle. 1989. Species profiles: life histories and environmental requirements of coastal fishes and invertebrates (South Atlantic)Spot. U.S. Fish and Wildlife Service Biological Report 82(11). U.S. Army Corps of Engineers TR EL-82-4.
  • Hettler, W.F. 1979. Swimming speeds of juvenile estuarine fish in a circular flume.Proc. Ann. Conf. Southeast. Assoc. Fish Wildl. Agencies 31:392-398.
  • Hettler, W.F., and L.C. Clements. 1978. Effects of acute thermal stress on marinefish embryos and larvae. Pages 171-190 in Fourth National Workshop on Entrainment and Impingement, Ecological Analysts Communications, Melville, New York.
  • Hildebrand, S.F., and L. Cable. 1930. Development and life history of fourteen teleostean fishes at Beaufort, North Carolina. Bull. U.S. Bur. Fish. 46:383-488.
  • Hildebrand, S.F., and W.C. Schroeder. 1928. Fishes of Chesapeake Bay. Bull. U.S. Bur. Fish. 43, Part 1. 366 pp.
  • Hodson, R.G., R.G. Fechhelm, and R.J. Monroe. 1981a. Upper temperature tolerance of the spot, Leiostomus xanthurus, from the Cape Fear River Estuary, North Carolina. Estuaries 4:345-356.
  • Hodson, R.G., J.O. Hackman, and C.R. Bennett. 1981b. Food habits of young spot in nursery areas of the Cape Fear River Estuary, North Carolina. Trans. Am. Fish. Soc. 110:495-501.
  • Hoss, D.E., W.F. Hettler, and L.C. Clements. 1974. Effects of thermal shock on larval estuarine fish - ecological implications with respect to entrainment in power plant cooling systems. Pages 357-371 in: J.H.S. Blaxter, ed. The Early Life History of Fish. Springer-Verlag, New York.
  • Houde, E.D. 1978. Critical food levels for growth and survival of laboratory reared larvae of three species of subtropical marine fishes. Bull. Mar. Sci.28:395-411.
  • Johnson, G.D. 1978. Development of Fishes of the Mid-Atlantic Bight. Volume IV, Carangidae through Ephippidae. U.S. Fish. Wildl. Serv. Biol. Serv. Program FWS/OBS-78/12. 416 pp.
  • Kjelson, M.A., and G.N. Johnson. 1976. Further observations of the feeding ecology of postlarval pinfish, Lagodon rhomboides, and spot, Leiostomus xanthurus. U.S. Natl. Mar. Fish. Serv. Fish. Bull. 74:423-432.
  • Kjelson, M.A., D.S. Peters, G.W. Thayer, and G.N. Johnson. 1975. The general feeding ecology of postlarval fishes in the Newport River estuary. U.S. Natl. Mar. Fish. Serv. Fish. Bull. 73:137-144.
  • Lewis, R.M., and M.H. Judy. 1983. The occurrence of spot, Leiostomus xanthurus, and Atlantic croaker, Micropogonias undulatus, larvae in Onslow Bay and the Newport River estuary, North Carolina. U.S. Natl. Mar. Fish. Serv. Fish. Bull. 81:405-412.
  • Murphy, Michael D. 2003. Species account for spot (Leiostomus xanthurus) in: Florida. Florida Fish and Wildlife Research Institute, Florida Fish and Wildlife Conservation Commission. Available on the Internet at: http://www.floridamarine.org/features/view_article.asp?id=5573
  • Music, J.L. 1974. Observations on the spot Leiostomus xanthurus in Georgia's estuarine and close inshore ocean waters. Ga. Dep. Nat. Resour. Contrib. Ser.28. 29 pp.
  • Nelson, W.R. 1969. Studies on the croaker, Micropogon undulatus Linnaeus, and the spot, Leiostomus xanthurus Lacepede, in Mobile Bay, Alabama. J. Mar. Sci. Alabama 1:4-92.
  • Neumann, D.A., J.M. O'Conner, and J.A. Sherk, Jr. 1981. Oxygen consumption of white perch (Morone americana), striped bass (Morone saxatilis), and spot (Leiostomus xanthurus). Comp. Biochem. Physiol. 69A:467-478.
  • Pacheco, A.L. 1962. Age and growth of spot in lower Chesapeake Bay, with notes on the distribution and abundance of juveniles in the York River system. Chesapeake Sci. 3:18-28.
  • Parker, J.C. 1971. The biology of the spot, Leiostomus xanthurus, and the Atlantic croaker, Micropogon undulatus, in two Gulf of Mexico nursery areas. Tex. A&M Univ. Sea Grant Publ. NOAA-TAMU-SG-14, College Station, TX.
  • McRae, G., R.G. Muller, and R. Paperno. 1997. Update on Florida's Spot Fishery Report to the Marine Fisheries Commission, July 10, 1997. Department of Environmental Protection Florida Marine Research Institute, 100 Eighth Avenue Southeast, St. Petersburg, FL 33701-5095.
  • Pearson, J.C. 1932. Winter trawl fishery of the Virginia and North Carolina coasts. U.S. Bur. Fish. Investigative Rep. 10. 31 pp.
  • Powell, A.B., and H.R. Gordy. 1980. Egg and larval development of the spot, Leiostomus xanthurus. U.S. Natl. Mar. Fish. Serv. Fish. Bull. 78:701-714.
  • Roberts, M.H., Jr. 1980. Survival of juvenile spot (Leiostomus xanthurus) exposed to bromochlorinated and chlorinated sewage in estuarine waters. Mar. Environ. Res. 3:63-80.
  • Roelofs, E.W. 1954. Food studies of young sciaenid fishes, Micropogon and Leiostomus, from North Carolina. Copeia 1954:151-153.Rozas, L.P., and C.T. Hackney. 1984. Use of oligohaline marshes by fishes and macrofaunal crustaceans in North Carolina. Estuaries 7:213-224.
  • Rulifson, R.A. 1977. Temperature and water velocity effects on the swimming performances of young-of-the-year striped mullet (Mugil cephalus), spot (Leiostomus xanthurus), and pinfish (Lagodon rhomboides). J. Fish. Res. Board Can. 34:2316-2322.
  • Sawyer, R.T., A.R. Lawler, and R.M. Overstreet. 1975. Marine leeches of the eastern U.S. and the Gulf of Mexico with a key to the species. J. Nat. Hist. 9:633-667.
  • Townsend, B.C., Jr. 1956. A study of the spot, Leiostomus xanthurus Lacepede, in Alligator Harbor, Florida. M.S. Thesis. Florida State University, Tallahassee. 43 pp.
  • Warlen, S.M., and A.J. Chester. 1985. Age, growth and distribution of larval spot; Leiostomus xanthurus, off North Carolina. U.S. Natl. Mar. Fish. Serv. Fish Bull. 83:587-599.
  • Weinstein, M.P. 1983. Population dynamics of an estuarine dependent fish, the spot (Leiostomus xanthurus), along a tidal creek-seagrass meadow coenocline. Can. J. Fish. Aquat. Sci. 40:1633-1638.
  • Weinstein, M.P., and M.P. Walters. 1981. Growth, survival, and production in young-of-year populations of Leiostomus xanthurus Lacepede residing in tidal creeks. Estuaries 4:185-197.
  • Welsh, W.W., and C.M. Breder, Jr. 1923. Contributions to the life histories of Sciaenidae of the eastern United States coast. Bull. U.S. Bur. Fish. 39:141-201.
  • Wenner, C-A., C.A. Barans, B.W. Stender, and F.H. Berry. 1979a. Results of MARMAP otter trawl investigations in the South Atlantic Bight. I. Fall, 1973. S.C. Dep. Wildl. Mar. Res. Center Tech. Rep. 33. 79 pp.
  • Wenner, C.A., C.A. Barans, B.W. Stender, and F.H. Berry. 1980. Results of MARMAP otter trawl investigations in the South Atlantic Bight. V. Summer, 1975. S.C. Dep. Wildl. Mar. Res. Center Tech. Rep. 45. 57 pp.
  • Yoder, J.A., L.P. Atkinson, J.O. Blanton, D.R. Deibel, D.W. Menzel, and G.A. Paffenhofer. 1981. Plankton productivity and the distribution of fishes on the southeastern U.S. continental shelf. Science 214:352-353.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Worms, small crustaceans and organic detritus.
  • Bigelow, H. B. and Schroeder, W. C., 1953; Robins, C. R. and G. C. Ray, 1986; Sasaki, K., S. Hosoya and S. Watanabe, 1989.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Predators: Predators of spot include silversides (Menidia spp.), which may affect postlarval distribution in estuaries (Weinstein and Walters 1981). Juveniles and adult spot are also preyed upon by many fishes, including striped bass, sharks, seatrout, bluefish, mackerels, gars, and flounders (Hollis 1952; Rozas and Hackney 1984). Parasites: Parasites of spot include copepods of the genera Lernaeenicus and Ergasilus, as well as a marine leech, Myzobdella lugubris (Sawyer et al. 1975). Internal parasites include trematodes, microsporideans, and acanthocephalans (Sprague and Hussey 1980; Govoni 1983).
  • Bigelow, H.B., and W.C. Schroeder. 1953. Fishes of the Gulf of Maine. U.S. Fish Wildl. Serv. Fish. Bull. 74:1-577.
  • Bullock, W.L. 1957. The acanthocephalan parasites of the fishes of the Texas coast. Publ. Inst. Mar. Sci. Univ. Texas 4:278-283.
  • Burton, D.T. 1979. Ventilation frequency compensation responses of three eurythermal estuarine fish exposed to moderate temperature increases. J. Fish Biol. 15:589-600.
  • Burton, D.T., L.B. Richardson, and C.J. Moore. 1980. Effect of oxygen reduction rate and constant low dissolved oxygen concentrations on two estuarine fish. Trans. Am. Fish. Soc. 109:552-557.
  • Chao, L.N., and J.A. Musick. 1977. Life history, feeding habits, and functional morphology of juvenile sciaenid fishes in the York River estuary. U.S. Natl. Mar. Fish. Serv. Fish. Bull. 75:657-702.
  • Chao, L.N., 1978 Sciaenidae. In W. Fischer (ed.) FAO species identification sheets for fishery purposes. West Atlantic (Fishing Area 31). Volume 4. FAO, Rome.
  • Dawson, C.E. 1958. A study of the biology and life history of the spot, Leiostomus xanthurus Lacepede, with special reference to South Carolina. S.C. Wildl. Mar. Res. Dep. Contrib. Bears Bluff Lab. No. 28. 48 pp.
  • DeVries, D.A. 1982. Age and growth of spot in North Carolina. Northeast Fish Widl. Conf., April 13-15, 1982 Cherry Hill, NJ (Abstract).
  • Govoni, J.J. 1983. Helminth parasitism of three larval fishes in the northern Gulf ofMexico. U.S. Natl. Mar. Fish. Serv. Fish. Bull. 81:895-898.
  • Govoni, J.J., A.J. Chester, D.E. Hoss, and P.B. Ortner. 1985. An observation of episodic feeding and growth of larval Leiostomus xanthurus in the northern Gulf of Mexico. J. Plankton Res. 7:137-141.
  • Govoni, J.J., D.S. Peters, and J.V. Merriner. 1982. Carbon assimilation during larval development of the marine teleost Leiostomus xanthurus Lacepede. J. Exp. Mar. Biol. Ecol. 64:287-299.
  • Gunter, G. 1945. Studies on the marine fishes of Texas. Publ. Inst. Mar. Sci. Univ. Texas 1:9-190.
  • Hales, L.S. and M.J. Van Den Avyle. 1989. Species profiles: life histories and environmental requirements of coastal fishes and invertebrates (South Atlantic)Spot. U.S. Fish and Wildlife Service Biological Report 82(11). U.S. Army Corps of Engineers TR EL-82-4.
  • Hettler, W.F. 1979. Swimming speeds of juvenile estuarine fish in a circular flume.Proc. Ann. Conf. Southeast. Assoc. Fish Wildl. Agencies 31:392-398.
  • Hettler, W.F., and L.C. Clements. 1978. Effects of acute thermal stress on marinefish embryos and larvae. Pages 171-190 in Fourth National Workshop on Entrainment and Impingement, Ecological Analysts Communications, Melville, New York.
  • Hildebrand, S.F., and L. Cable. 1930. Development and life history of fourteen teleostean fishes at Beaufort, North Carolina. Bull. U.S. Bur. Fish. 46:383-488.
  • Hildebrand, S.F., and W.C. Schroeder. 1928. Fishes of Chesapeake Bay. Bull. U.S. Bur. Fish. 43, Part 1. 366 pp.
  • Hodson, R.G., R.G. Fechhelm, and R.J. Monroe. 1981a. Upper temperature tolerance of the spot, Leiostomus xanthurus, from the Cape Fear River Estuary, North Carolina. Estuaries 4:345-356.
  • Hodson, R.G., J.O. Hackman, and C.R. Bennett. 1981b. Food habits of young spot in nursery areas of the Cape Fear River Estuary, North Carolina. Trans. Am. Fish. Soc. 110:495-501.
  • Hoss, D.E., W.F. Hettler, and L.C. Clements. 1974. Effects of thermal shock on larval estuarine fish - ecological implications with respect to entrainment in power plant cooling systems. Pages 357-371 in: J.H.S. Blaxter, ed. The Early Life History of Fish. Springer-Verlag, New York.
  • Houde, E.D. 1978. Critical food levels for growth and survival of laboratory reared larvae of three species of subtropical marine fishes. Bull. Mar. Sci.28:395-411.
  • Johnson, G.D. 1978. Development of Fishes of the Mid-Atlantic Bight. Volume IV, Carangidae through Ephippidae. U.S. Fish. Wildl. Serv. Biol. Serv. Program FWS/OBS-78/12. 416 pp.
  • Kjelson, M.A., and G.N. Johnson. 1976. Further observations of the feeding ecology of postlarval pinfish, Lagodon rhomboides, and spot, Leiostomus xanthurus. U.S. Natl. Mar. Fish. Serv. Fish. Bull. 74:423-432.
  • Kjelson, M.A., D.S. Peters, G.W. Thayer, and G.N. Johnson. 1975. The general feeding ecology of postlarval fishes in the Newport River estuary. U.S. Natl. Mar. Fish. Serv. Fish. Bull. 73:137-144.
  • Lewis, R.M., and M.H. Judy. 1983. The occurrence of spot, Leiostomus xanthurus, and Atlantic croaker, Micropogonias undulatus, larvae in Onslow Bay and the Newport River estuary, North Carolina. U.S. Natl. Mar. Fish. Serv. Fish. Bull. 81:405-412.
  • Murphy, Michael D. 2003. Species account for spot (Leiostomus xanthurus) in: Florida. Florida Fish and Wildlife Research Institute, Florida Fish and Wildlife Conservation Commission. Available on the Internet at: http://www.floridamarine.org/features/view_article.asp?id=5573
  • Music, J.L. 1974. Observations on the spot Leiostomus xanthurus in Georgia's estuarine and close inshore ocean waters. Ga. Dep. Nat. Resour. Contrib. Ser.28. 29 pp.
  • Nelson, W.R. 1969. Studies on the croaker, Micropogon undulatus Linnaeus, and the spot, Leiostomus xanthurus Lacepede, in Mobile Bay, Alabama. J. Mar. Sci. Alabama 1:4-92.
  • Neumann, D.A., J.M. O'Conner, and J.A. Sherk, Jr. 1981. Oxygen consumption of white perch (Morone americana), striped bass (Morone saxatilis), and spot (Leiostomus xanthurus). Comp. Biochem. Physiol. 69A:467-478.
  • Pacheco, A.L. 1962. Age and growth of spot in lower Chesapeake Bay, with notes on the distribution and abundance of juveniles in the York River system. Chesapeake Sci. 3:18-28.
  • Parker, J.C. 1971. The biology of the spot, Leiostomus xanthurus, and the Atlantic croaker, Micropogon undulatus, in two Gulf of Mexico nursery areas. Tex. A&M Univ. Sea Grant Publ. NOAA-TAMU-SG-14, College Station, TX.
  • McRae, G., R.G. Muller, and R. Paperno. 1997. Update on Florida's Spot Fishery Report to the Marine Fisheries Commission, July 10, 1997. Department of Environmental Protection Florida Marine Research Institute, 100 Eighth Avenue Southeast, St. Petersburg, FL 33701-5095.
  • Pearson, J.C. 1932. Winter trawl fishery of the Virginia and North Carolina coasts. U.S. Bur. Fish. Investigative Rep. 10. 31 pp.
  • Powell, A.B., and H.R. Gordy. 1980. Egg and larval development of the spot, Leiostomus xanthurus. U.S. Natl. Mar. Fish. Serv. Fish. Bull. 78:701-714.
  • Roberts, M.H., Jr. 1980. Survival of juvenile spot (Leiostomus xanthurus) exposed to bromochlorinated and chlorinated sewage in estuarine waters. Mar. Environ. Res. 3:63-80.
  • Roelofs, E.W. 1954. Food studies of young sciaenid fishes, Micropogon and Leiostomus, from North Carolina. Copeia 1954:151-153.Rozas, L.P., and C.T. Hackney. 1984. Use of oligohaline marshes by fishes and macrofaunal crustaceans in North Carolina. Estuaries 7:213-224.
  • Rulifson, R.A. 1977. Temperature and water velocity effects on the swimming performances of young-of-the-year striped mullet (Mugil cephalus), spot (Leiostomus xanthurus), and pinfish (Lagodon rhomboides). J. Fish. Res. Board Can. 34:2316-2322.
  • Sawyer, R.T., A.R. Lawler, and R.M. Overstreet. 1975. Marine leeches of the eastern U.S. and the Gulf of Mexico with a key to the species. J. Nat. Hist. 9:633-667.
  • Townsend, B.C., Jr. 1956. A study of the spot, Leiostomus xanthurus Lacepede, in Alligator Harbor, Florida. M.S. Thesis. Florida State University, Tallahassee. 43 pp.
  • Warlen, S.M., and A.J. Chester. 1985. Age, growth and distribution of larval spot; Leiostomus xanthurus, off North Carolina. U.S. Natl. Mar. Fish. Serv. Fish Bull. 83:587-599.
  • Weinstein, M.P. 1983. Population dynamics of an estuarine dependent fish, the spot (Leiostomus xanthurus), along a tidal creek-seagrass meadow coenocline. Can. J. Fish. Aquat. Sci. 40:1633-1638.
  • Weinstein, M.P., and M.P. Walters. 1981. Growth, survival, and production in young-of-year populations of Leiostomus xanthurus Lacepede residing in tidal creeks. Estuaries 4:185-197.
  • Welsh, W.W., and C.M. Breder, Jr. 1923. Contributions to the life histories of Sciaenidae of the eastern United States coast. Bull. U.S. Bur. Fish. 39:141-201.
  • Wenner, C-A., C.A. Barans, B.W. Stender, and F.H. Berry. 1979a. Results of MARMAP otter trawl investigations in the South Atlantic Bight. I. Fall, 1973. S.C. Dep. Wildl. Mar. Res. Center Tech. Rep. 33. 79 pp.
  • Wenner, C.A., C.A. Barans, B.W. Stender, and F.H. Berry. 1980. Results of MARMAP otter trawl investigations in the South Atlantic Bight. V. Summer, 1975. S.C. Dep. Wildl. Mar. Res. Center Tech. Rep. 45. 57 pp.
  • Yoder, J.A., L.P. Atkinson, J.O. Blanton, D.R. Deibel, D.W. Menzel, and G.A. Paffenhofer. 1981. Plankton productivity and the distribution of fishes on the southeastern U.S. continental shelf. Science 214:352-353.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

  • Christian RR, Luczkovich JJ (1999) Organizing and understanding a winter’s seagrass foodweb network through effective trophic levels. Ecol Model 117:99–124
  • Baird D, Ulanowicz RE (1989) The seasonal dynamics of the Chesapeake Bay ecosystem. Ecol Monogr 59:329–364
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

  • Christian RR, Luczkovich JJ (1999) Organizing and understanding a winter’s seagrass foodweb network through effective trophic levels. Ecol Model 117:99–124
  • Baird D, Ulanowicz RE (1989) The seasonal dynamics of the Chesapeake Bay ecosystem. Ecol Monogr 59:329–364
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Leiostomus xanthurus is one of the most common demersal fishes in coastal and estuarine waters of the Atlantic, and has both commercial and recreational importance. In some areas, the recreational catch often exceeds the commercial harvest (Hales and Van Den Avyle 1989). Locomotion: Larval spot have limited swimming abilities measured at 0.25 - 1.0 m/s for brief periods (Lewis and Judy 1983). Adult spot have significantly slower swimming speeds than other estuarine species (Hettler 1979), with a typical speed of approximately 0.7 m/s (Rulifson 1977).Spot Small spot (<2.7 cm SL) are unable to orient in currents exceeding 15 cm/s. Larger spot, (to 5 cm SL) cannot maintain orientation when currents exceed 30 cm/sec (Hales and Van Den Avyle 1989).
  • Bigelow, H.B., and W.C. Schroeder. 1953. Fishes of the Gulf of Maine. U.S. Fish Wildl. Serv. Fish. Bull. 74:1-577.
  • Bullock, W.L. 1957. The acanthocephalan parasites of the fishes of the Texas coast. Publ. Inst. Mar. Sci. Univ. Texas 4:278-283.
  • Burton, D.T. 1979. Ventilation frequency compensation responses of three eurythermal estuarine fish exposed to moderate temperature increases. J. Fish Biol. 15:589-600.
  • Burton, D.T., L.B. Richardson, and C.J. Moore. 1980. Effect of oxygen reduction rate and constant low dissolved oxygen concentrations on two estuarine fish. Trans. Am. Fish. Soc. 109:552-557.
  • Chao, L.N., and J.A. Musick. 1977. Life history, feeding habits, and functional morphology of juvenile sciaenid fishes in the York River estuary. U.S. Natl. Mar. Fish. Serv. Fish. Bull. 75:657-702.
  • Chao, L.N., 1978 Sciaenidae. In W. Fischer (ed.) FAO species identification sheets for fishery purposes. West Atlantic (Fishing Area 31). Volume 4. FAO, Rome.
  • Dawson, C.E. 1958. A study of the biology and life history of the spot, Leiostomus xanthurus Lacepede, with special reference to South Carolina. S.C. Wildl. Mar. Res. Dep. Contrib. Bears Bluff Lab. No. 28. 48 pp.
  • DeVries, D.A. 1982. Age and growth of spot in North Carolina. Northeast Fish Widl. Conf., April 13-15, 1982 Cherry Hill, NJ (Abstract).
  • Govoni, J.J. 1983. Helminth parasitism of three larval fishes in the northern Gulf ofMexico. U.S. Natl. Mar. Fish. Serv. Fish. Bull. 81:895-898.
  • Govoni, J.J., A.J. Chester, D.E. Hoss, and P.B. Ortner. 1985. An observation of episodic feeding and growth of larval Leiostomus xanthurus in the northern Gulf of Mexico. J. Plankton Res. 7:137-141.
  • Govoni, J.J., D.S. Peters, and J.V. Merriner. 1982. Carbon assimilation during larval development of the marine teleost Leiostomus xanthurus Lacepede. J. Exp. Mar. Biol. Ecol. 64:287-299.
  • Gunter, G. 1945. Studies on the marine fishes of Texas. Publ. Inst. Mar. Sci. Univ. Texas 1:9-190.
  • Hales, L.S. and M.J. Van Den Avyle. 1989. Species profiles: life histories and environmental requirements of coastal fishes and invertebrates (South Atlantic)Spot. U.S. Fish and Wildlife Service Biological Report 82(11). U.S. Army Corps of Engineers TR EL-82-4.
  • Hettler, W.F. 1979. Swimming speeds of juvenile estuarine fish in a circular flume.Proc. Ann. Conf. Southeast. Assoc. Fish Wildl. Agencies 31:392-398.
  • Hettler, W.F., and L.C. Clements. 1978. Effects of acute thermal stress on marinefish embryos and larvae. Pages 171-190 in Fourth National Workshop on Entrainment and Impingement, Ecological Analysts Communications, Melville, New York.
  • Hildebrand, S.F., and L. Cable. 1930. Development and life history of fourteen teleostean fishes at Beaufort, North Carolina. Bull. U.S. Bur. Fish. 46:383-488.
  • Hildebrand, S.F., and W.C. Schroeder. 1928. Fishes of Chesapeake Bay. Bull. U.S. Bur. Fish. 43, Part 1. 366 pp.
  • Hodson, R.G., R.G. Fechhelm, and R.J. Monroe. 1981a. Upper temperature tolerance of the spot, Leiostomus xanthurus, from the Cape Fear River Estuary, North Carolina. Estuaries 4:345-356.
  • Hodson, R.G., J.O. Hackman, and C.R. Bennett. 1981b. Food habits of young spot in nursery areas of the Cape Fear River Estuary, North Carolina. Trans. Am. Fish. Soc. 110:495-501.
  • Hoss, D.E., W.F. Hettler, and L.C. Clements. 1974. Effects of thermal shock on larval estuarine fish - ecological implications with respect to entrainment in power plant cooling systems. Pages 357-371 in: J.H.S. Blaxter, ed. The Early Life History of Fish. Springer-Verlag, New York.
  • Houde, E.D. 1978. Critical food levels for growth and survival of laboratory reared larvae of three species of subtropical marine fishes. Bull. Mar. Sci.28:395-411.
  • Johnson, G.D. 1978. Development of Fishes of the Mid-Atlantic Bight. Volume IV, Carangidae through Ephippidae. U.S. Fish. Wildl. Serv. Biol. Serv. Program FWS/OBS-78/12. 416 pp.
  • Kjelson, M.A., and G.N. Johnson. 1976. Further observations of the feeding ecology of postlarval pinfish, Lagodon rhomboides, and spot, Leiostomus xanthurus. U.S. Natl. Mar. Fish. Serv. Fish. Bull. 74:423-432.
  • Kjelson, M.A., D.S. Peters, G.W. Thayer, and G.N. Johnson. 1975. The general feeding ecology of postlarval fishes in the Newport River estuary. U.S. Natl. Mar. Fish. Serv. Fish. Bull. 73:137-144.
  • Lewis, R.M., and M.H. Judy. 1983. The occurrence of spot, Leiostomus xanthurus, and Atlantic croaker, Micropogonias undulatus, larvae in Onslow Bay and the Newport River estuary, North Carolina. U.S. Natl. Mar. Fish. Serv. Fish. Bull. 81:405-412.
  • Murphy, Michael D. 2003. Species account for spot (Leiostomus xanthurus) in: Florida. Florida Fish and Wildlife Research Institute, Florida Fish and Wildlife Conservation Commission. Available on the Internet at: http://www.floridamarine.org/features/view_article.asp?id=5573
  • Music, J.L. 1974. Observations on the spot Leiostomus xanthurus in Georgia's estuarine and close inshore ocean waters. Ga. Dep. Nat. Resour. Contrib. Ser.28. 29 pp.
  • Nelson, W.R. 1969. Studies on the croaker, Micropogon undulatus Linnaeus, and the spot, Leiostomus xanthurus Lacepede, in Mobile Bay, Alabama. J. Mar. Sci. Alabama 1:4-92.
  • Neumann, D.A., J.M. O'Conner, and J.A. Sherk, Jr. 1981. Oxygen consumption of white perch (Morone americana), striped bass (Morone saxatilis), and spot (Leiostomus xanthurus). Comp. Biochem. Physiol. 69A:467-478.
  • Pacheco, A.L. 1962. Age and growth of spot in lower Chesapeake Bay, with notes on the distribution and abundance of juveniles in the York River system. Chesapeake Sci. 3:18-28.
  • Parker, J.C. 1971. The biology of the spot, Leiostomus xanthurus, and the Atlantic croaker, Micropogon undulatus, in two Gulf of Mexico nursery areas. Tex. A&M Univ. Sea Grant Publ. NOAA-TAMU-SG-14, College Station, TX.
  • McRae, G., R.G. Muller, and R. Paperno. 1997. Update on Florida's Spot Fishery Report to the Marine Fisheries Commission, July 10, 1997. Department of Environmental Protection Florida Marine Research Institute, 100 Eighth Avenue Southeast, St. Petersburg, FL 33701-5095.
  • Pearson, J.C. 1932. Winter trawl fishery of the Virginia and North Carolina coasts. U.S. Bur. Fish. Investigative Rep. 10. 31 pp.
  • Powell, A.B., and H.R. Gordy. 1980. Egg and larval development of the spot, Leiostomus xanthurus. U.S. Natl. Mar. Fish. Serv. Fish. Bull. 78:701-714.
  • Roberts, M.H., Jr. 1980. Survival of juvenile spot (Leiostomus xanthurus) exposed to bromochlorinated and chlorinated sewage in estuarine waters. Mar. Environ. Res. 3:63-80.
  • Roelofs, E.W. 1954. Food studies of young sciaenid fishes, Micropogon and Leiostomus, from North Carolina. Copeia 1954:151-153.Rozas, L.P., and C.T. Hackney. 1984. Use of oligohaline marshes by fishes and macrofaunal crustaceans in North Carolina. Estuaries 7:213-224.
  • Rulifson, R.A. 1977. Temperature and water velocity effects on the swimming performances of young-of-the-year striped mullet (Mugil cephalus), spot (Leiostomus xanthurus), and pinfish (Lagodon rhomboides). J. Fish. Res. Board Can. 34:2316-2322.
  • Sawyer, R.T., A.R. Lawler, and R.M. Overstreet. 1975. Marine leeches of the eastern U.S. and the Gulf of Mexico with a key to the species. J. Nat. Hist. 9:633-667.
  • Townsend, B.C., Jr. 1956. A study of the spot, Leiostomus xanthurus Lacepede, in Alligator Harbor, Florida. M.S. Thesis. Florida State University, Tallahassee. 43 pp.
  • Warlen, S.M., and A.J. Chester. 1985. Age, growth and distribution of larval spot; Leiostomus xanthurus, off North Carolina. U.S. Natl. Mar. Fish. Serv. Fish Bull. 83:587-599.
  • Weinstein, M.P. 1983. Population dynamics of an estuarine dependent fish, the spot (Leiostomus xanthurus), along a tidal creek-seagrass meadow coenocline. Can. J. Fish. Aquat. Sci. 40:1633-1638.
  • Weinstein, M.P., and M.P. Walters. 1981. Growth, survival, and production in young-of-year populations of Leiostomus xanthurus Lacepede residing in tidal creeks. Estuaries 4:185-197.
  • Welsh, W.W., and C.M. Breder, Jr. 1923. Contributions to the life histories of Sciaenidae of the eastern United States coast. Bull. U.S. Bur. Fish. 39:141-201.
  • Wenner, C-A., C.A. Barans, B.W. Stender, and F.H. Berry. 1979a. Results of MARMAP otter trawl investigations in the South Atlantic Bight. I. Fall, 1973. S.C. Dep. Wildl. Mar. Res. Center Tech. Rep. 33. 79 pp.
  • Wenner, C.A., C.A. Barans, B.W. Stender, and F.H. Berry. 1980. Results of MARMAP otter trawl investigations in the South Atlantic Bight. V. Summer, 1975. S.C. Dep. Wildl. Mar. Res. Center Tech. Rep. 45. 57 pp.
  • Yoder, J.A., L.P. Atkinson, J.O. Blanton, D.R. Deibel, D.W. Menzel, and G.A. Paffenhofer. 1981. Plankton productivity and the distribution of fishes on the southeastern U.S. continental shelf. Science 214:352-353.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Constitute a major proportion of biomass and numbers of fishes present in estuarine waters of mid-Atlantic region; considered important in structure and function of ecosystem (Phillips et al. 1989). Important as food for cormorants, spotted seatrout, and, in Chesapeake Bay, striped bass (Phillips et al. 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: captivity:
4 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 4 years
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

During the fall to early winter months, L. xanthurus moves offshore to spawn in the shallow to middle-shelf waters. This period of spawning extends from fall to early spring. In areas such as North Carolina, the period is October to February. In areas such as Florida, the period is from December to March. The spawning occurs in waters a little deeper and further offshore than most Sciaenids. Anywhere from one hundred thousand to 1.7 million eggs may then be carried shoreward by winds and currents. Fertlization is external and occurs at night in shallow waters. The larvae grow rapidly in the warmer offshore waters. The young Spot then move into coastal shallows and the lower bays during the winter. This is where they spend their first year. Usually, during the summer, the young reside in the tidal creeks and shallow estuarine areas. Then, during the winter, once again, they go into deeper estuarine waters or the ocean. Young Spot tend to move into areas with lower salinity and even freshwater until they are old enough to return back to the saltwater. Young Spot have also been known to reside in eelgrass communities. The age of maturity is about 2-3 years when the Spot are about 186-214 milimeters in length. The maximum age for a Spot is 5 years (Husser 1999; Chesapeake Bay Program 2000; EarthMax Development 2001; Schultz 2001; Maryland Department of Natural Resources 2001).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Spawns September-November off Chesapeake Bay, October- February (peak December-January) off North Carolina, December-March along Florida. Juveniles first occur in marshes of the Albemarle Sound and Neuse River estuaries in February; young remain in Chesapeake Bay and Albemarle Sound estuaries until September or October, then go to sea (Phillips et al. 1989). Sexually mature in about 2 years; few live longer than age III (Manooch 1984, Phillips et al. 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Spot typically migrate offshore and spawn in the relatively deep water of the outer continental shelf, though some evidently spawn in both nearshore waters and estuaries (Dawson 1958; Lewis and Judy 1983). Ripe adults aggregate off beaches in fall and begin migration offshore, possibly migrating to more southern waters in the process (Pearson 1932). Spot may spawn repeatedly over several weeks (Hildebrand and Cable 1930), with some individuals remaining offshore after spawning (Pearson 1932; Wenner et al. 1979, 1980). In the south Atlantic region of the U.S., spawning occurs from October through March, peaking in December and January (Townsend 1956; Lewis and Judy 1983; Warlen and Chester 1985). This is later than in mid-Atlantic waters and earlier than in the Gulf of Mexico, where spawning begins in December and peaks in January and February (Nelson 1969). Most spot reach sexual maturity in the second year, but some require 3 years (Hales and Van Den Avyle 1989). Dawson (1958) and Music (1974) reported that spot measuring 170 -175 mm total length (TL) showed ripened gonads. However, other research (Hildebrand and Cable 1930; Gunter 1945; Townsend 1956) suggests sexual maturity is attained at somewhat larger size, between 185 - 210 mm TL. Music (1974) reported that males may reach maturity at slightly smaller sizes than do females, 170 mm TL for males vs. 205 mm TL for females. Dawson (1958) estimated fecundity for spot at approximately 77,000 - 84,000 eggs per season.
  • Bigelow, H.B., and W.C. Schroeder. 1953. Fishes of the Gulf of Maine. U.S. Fish Wildl. Serv. Fish. Bull. 74:1-577.
  • Bullock, W.L. 1957. The acanthocephalan parasites of the fishes of the Texas coast. Publ. Inst. Mar. Sci. Univ. Texas 4:278-283.
  • Burton, D.T. 1979. Ventilation frequency compensation responses of three eurythermal estuarine fish exposed to moderate temperature increases. J. Fish Biol. 15:589-600.
  • Burton, D.T., L.B. Richardson, and C.J. Moore. 1980. Effect of oxygen reduction rate and constant low dissolved oxygen concentrations on two estuarine fish. Trans. Am. Fish. Soc. 109:552-557.
  • Chao, L.N., and J.A. Musick. 1977. Life history, feeding habits, and functional morphology of juvenile sciaenid fishes in the York River estuary. U.S. Natl. Mar. Fish. Serv. Fish. Bull. 75:657-702.
  • Chao, L.N., 1978 Sciaenidae. In W. Fischer (ed.) FAO species identification sheets for fishery purposes. West Atlantic (Fishing Area 31). Volume 4. FAO, Rome.
  • Dawson, C.E. 1958. A study of the biology and life history of the spot, Leiostomus xanthurus Lacepede, with special reference to South Carolina. S.C. Wildl. Mar. Res. Dep. Contrib. Bears Bluff Lab. No. 28. 48 pp.
  • DeVries, D.A. 1982. Age and growth of spot in North Carolina. Northeast Fish Widl. Conf., April 13-15, 1982 Cherry Hill, NJ (Abstract).
  • Govoni, J.J. 1983. Helminth parasitism of three larval fishes in the northern Gulf ofMexico. U.S. Natl. Mar. Fish. Serv. Fish. Bull. 81:895-898.
  • Govoni, J.J., A.J. Chester, D.E. Hoss, and P.B. Ortner. 1985. An observation of episodic feeding and growth of larval Leiostomus xanthurus in the northern Gulf of Mexico. J. Plankton Res. 7:137-141.
  • Govoni, J.J., D.S. Peters, and J.V. Merriner. 1982. Carbon assimilation during larval development of the marine teleost Leiostomus xanthurus Lacepede. J. Exp. Mar. Biol. Ecol. 64:287-299.
  • Gunter, G. 1945. Studies on the marine fishes of Texas. Publ. Inst. Mar. Sci. Univ. Texas 1:9-190.
  • Hales, L.S. and M.J. Van Den Avyle. 1989. Species profiles: life histories and environmental requirements of coastal fishes and invertebrates (South Atlantic)Spot. U.S. Fish and Wildlife Service Biological Report 82(11). U.S. Army Corps of Engineers TR EL-82-4.
  • Hettler, W.F. 1979. Swimming speeds of juvenile estuarine fish in a circular flume.Proc. Ann. Conf. Southeast. Assoc. Fish Wildl. Agencies 31:392-398.
  • Hettler, W.F., and L.C. Clements. 1978. Effects of acute thermal stress on marinefish embryos and larvae. Pages 171-190 in Fourth National Workshop on Entrainment and Impingement, Ecological Analysts Communications, Melville, New York.
  • Hildebrand, S.F., and L. Cable. 1930. Development and life history of fourteen teleostean fishes at Beaufort, North Carolina. Bull. U.S. Bur. Fish. 46:383-488.
  • Hildebrand, S.F., and W.C. Schroeder. 1928. Fishes of Chesapeake Bay. Bull. U.S. Bur. Fish. 43, Part 1. 366 pp.
  • Hodson, R.G., R.G. Fechhelm, and R.J. Monroe. 1981a. Upper temperature tolerance of the spot, Leiostomus xanthurus, from the Cape Fear River Estuary, North Carolina. Estuaries 4:345-356.
  • Hodson, R.G., J.O. Hackman, and C.R. Bennett. 1981b. Food habits of young spot in nursery areas of the Cape Fear River Estuary, North Carolina. Trans. Am. Fish. Soc. 110:495-501.
  • Hoss, D.E., W.F. Hettler, and L.C. Clements. 1974. Effects of thermal shock on larval estuarine fish - ecological implications with respect to entrainment in power plant cooling systems. Pages 357-371 in: J.H.S. Blaxter, ed. The Early Life History of Fish. Springer-Verlag, New York.
  • Houde, E.D. 1978. Critical food levels for growth and survival of laboratory reared larvae of three species of subtropical marine fishes. Bull. Mar. Sci.28:395-411.
  • Johnson, G.D. 1978. Development of Fishes of the Mid-Atlantic Bight. Volume IV, Carangidae through Ephippidae. U.S. Fish. Wildl. Serv. Biol. Serv. Program FWS/OBS-78/12. 416 pp.
  • Kjelson, M.A., and G.N. Johnson. 1976. Further observations of the feeding ecology of postlarval pinfish, Lagodon rhomboides, and spot, Leiostomus xanthurus. U.S. Natl. Mar. Fish. Serv. Fish. Bull. 74:423-432.
  • Kjelson, M.A., D.S. Peters, G.W. Thayer, and G.N. Johnson. 1975. The general feeding ecology of postlarval fishes in the Newport River estuary. U.S. Natl. Mar. Fish. Serv. Fish. Bull. 73:137-144.
  • Lewis, R.M., and M.H. Judy. 1983. The occurrence of spot, Leiostomus xanthurus, and Atlantic croaker, Micropogonias undulatus, larvae in Onslow Bay and the Newport River estuary, North Carolina. U.S. Natl. Mar. Fish. Serv. Fish. Bull. 81:405-412.
  • Murphy, Michael D. 2003. Species account for spot (Leiostomus xanthurus) in: Florida. Florida Fish and Wildlife Research Institute, Florida Fish and Wildlife Conservation Commission. Available on the Internet at: http://www.floridamarine.org/features/view_article.asp?id=5573
  • Music, J.L. 1974. Observations on the spot Leiostomus xanthurus in Georgia's estuarine and close inshore ocean waters. Ga. Dep. Nat. Resour. Contrib. Ser.28. 29 pp.
  • Nelson, W.R. 1969. Studies on the croaker, Micropogon undulatus Linnaeus, and the spot, Leiostomus xanthurus Lacepede, in Mobile Bay, Alabama. J. Mar. Sci. Alabama 1:4-92.
  • Neumann, D.A., J.M. O'Conner, and J.A. Sherk, Jr. 1981. Oxygen consumption of white perch (Morone americana), striped bass (Morone saxatilis), and spot (Leiostomus xanthurus). Comp. Biochem. Physiol. 69A:467-478.
  • Pacheco, A.L. 1962. Age and growth of spot in lower Chesapeake Bay, with notes on the distribution and abundance of juveniles in the York River system. Chesapeake Sci. 3:18-28.
  • Parker, J.C. 1971. The biology of the spot, Leiostomus xanthurus, and the Atlantic croaker, Micropogon undulatus, in two Gulf of Mexico nursery areas. Tex. A&M Univ. Sea Grant Publ. NOAA-TAMU-SG-14, College Station, TX.
  • McRae, G., R.G. Muller, and R. Paperno. 1997. Update on Florida's Spot Fishery Report to the Marine Fisheries Commission, July 10, 1997. Department of Environmental Protection Florida Marine Research Institute, 100 Eighth Avenue Southeast, St. Petersburg, FL 33701-5095.
  • Pearson, J.C. 1932. Winter trawl fishery of the Virginia and North Carolina coasts. U.S. Bur. Fish. Investigative Rep. 10. 31 pp.
  • Powell, A.B., and H.R. Gordy. 1980. Egg and larval development of the spot, Leiostomus xanthurus. U.S. Natl. Mar. Fish. Serv. Fish. Bull. 78:701-714.
  • Roberts, M.H., Jr. 1980. Survival of juvenile spot (Leiostomus xanthurus) exposed to bromochlorinated and chlorinated sewage in estuarine waters. Mar. Environ. Res. 3:63-80.
  • Roelofs, E.W. 1954. Food studies of young sciaenid fishes, Micropogon and Leiostomus, from North Carolina. Copeia 1954:151-153.Rozas, L.P., and C.T. Hackney. 1984. Use of oligohaline marshes by fishes and macrofaunal crustaceans in North Carolina. Estuaries 7:213-224.
  • Rulifson, R.A. 1977. Temperature and water velocity effects on the swimming performances of young-of-the-year striped mullet (Mugil cephalus), spot (Leiostomus xanthurus), and pinfish (Lagodon rhomboides). J. Fish. Res. Board Can. 34:2316-2322.
  • Sawyer, R.T., A.R. Lawler, and R.M. Overstreet. 1975. Marine leeches of the eastern U.S. and the Gulf of Mexico with a key to the species. J. Nat. Hist. 9:633-667.
  • Townsend, B.C., Jr. 1956. A study of the spot, Leiostomus xanthurus Lacepede, in Alligator Harbor, Florida. M.S. Thesis. Florida State University, Tallahassee. 43 pp.
  • Warlen, S.M., and A.J. Chester. 1985. Age, growth and distribution of larval spot; Leiostomus xanthurus, off North Carolina. U.S. Natl. Mar. Fish. Serv. Fish Bull. 83:587-599.
  • Weinstein, M.P. 1983. Population dynamics of an estuarine dependent fish, the spot (Leiostomus xanthurus), along a tidal creek-seagrass meadow coenocline. Can. J. Fish. Aquat. Sci. 40:1633-1638.
  • Weinstein, M.P., and M.P. Walters. 1981. Growth, survival, and production in young-of-year populations of Leiostomus xanthurus Lacepede residing in tidal creeks. Estuaries 4:185-197.
  • Welsh, W.W., and C.M. Breder, Jr. 1923. Contributions to the life histories of Sciaenidae of the eastern United States coast. Bull. U.S. Bur. Fish. 39:141-201.
  • Wenner, C-A., C.A. Barans, B.W. Stender, and F.H. Berry. 1979a. Results of MARMAP otter trawl investigations in the South Atlantic Bight. I. Fall, 1973. S.C. Dep. Wildl. Mar. Res. Center Tech. Rep. 33. 79 pp.
  • Wenner, C.A., C.A. Barans, B.W. Stender, and F.H. Berry. 1980. Results of MARMAP otter trawl investigations in the South Atlantic Bight. V. Summer, 1975. S.C. Dep. Wildl. Mar. Res. Center Tech. Rep. 45. 57 pp.
  • Yoder, J.A., L.P. Atkinson, J.O. Blanton, D.R. Deibel, D.W. Menzel, and G.A. Paffenhofer. 1981. Plankton productivity and the distribution of fishes on the southeastern U.S. continental shelf. Science 214:352-353.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

no information.
  • Bigelow, H. B. and Schroeder, W. C., 1953; Robins, C. R. and G. C. Ray, 1986; Sasaki, K., S. Hosoya and S. Watanabe, 1989.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Growth

Eggs are pelagic and buoyant. Under laboratory conditions, eggs hatched at 20ºC within 24 hours. Larvae absorb the yolk sac and oil globule within 5 days of hatching (Powell and Gordy 1980). Larvae are initially found in surface waters but become more demersal as they grow (Hildebrand and Cable 1930; Lewis and Judy 1983). Due to the limited swimming ability of larvae, it is believed that passive mechanisms (wind, Ekman transport, tides) are the primary transporters of larvae to the nursery habitats of estuaries and bays. Larvae arrive at estuaries when they are approximately 10 - 24 mm Standard length (SL) and 40 - 47 days old (Warlen and Chester 1985), typically in January (Hildebrand and Cable 1983; Lewis and Judy 1983), with recruitment peaking in February and March (Hildebrand and Cable 1983). Larvae continuing to enter estuaries through June. Postlarvae and smaller juveniles tend to congregate in shallow water areas of tidal creeks in estuaries for 3-6 months (Weinstein and Walters 1981). Thereafter, they tend to migrate to other estuarine habitats, and often migrate to deeper waters (Weinstein 1983; Weinstein and Brooks 1983; Rojas and Hackney 1984). Warlen and Chester (1985) examined growth characteristics of larvae and juveniles and found that initial growth is rapid while larvae remain in offshore waters, presumably due to the abundance of plankton available. Growth then slows in the early period of estuarine residency, until approximately April. After metamorphosis to the juvenile stage, growth is again accelerated.
  • Bigelow, H.B., and W.C. Schroeder. 1953. Fishes of the Gulf of Maine. U.S. Fish Wildl. Serv. Fish. Bull. 74:1-577.
  • Bullock, W.L. 1957. The acanthocephalan parasites of the fishes of the Texas coast. Publ. Inst. Mar. Sci. Univ. Texas 4:278-283.
  • Burton, D.T. 1979. Ventilation frequency compensation responses of three eurythermal estuarine fish exposed to moderate temperature increases. J. Fish Biol. 15:589-600.
  • Burton, D.T., L.B. Richardson, and C.J. Moore. 1980. Effect of oxygen reduction rate and constant low dissolved oxygen concentrations on two estuarine fish. Trans. Am. Fish. Soc. 109:552-557.
  • Chao, L.N., and J.A. Musick. 1977. Life history, feeding habits, and functional morphology of juvenile sciaenid fishes in the York River estuary. U.S. Natl. Mar. Fish. Serv. Fish. Bull. 75:657-702.
  • Chao, L.N., 1978 Sciaenidae. In W. Fischer (ed.) FAO species identification sheets for fishery purposes. West Atlantic (Fishing Area 31). Volume 4. FAO, Rome.
  • Dawson, C.E. 1958. A study of the biology and life history of the spot, Leiostomus xanthurus Lacepede, with special reference to South Carolina. S.C. Wildl. Mar. Res. Dep. Contrib. Bears Bluff Lab. No. 28. 48 pp.
  • DeVries, D.A. 1982. Age and growth of spot in North Carolina. Northeast Fish Widl. Conf., April 13-15, 1982 Cherry Hill, NJ (Abstract).
  • Govoni, J.J. 1983. Helminth parasitism of three larval fishes in the northern Gulf ofMexico. U.S. Natl. Mar. Fish. Serv. Fish. Bull. 81:895-898.
  • Govoni, J.J., A.J. Chester, D.E. Hoss, and P.B. Ortner. 1985. An observation of episodic feeding and growth of larval Leiostomus xanthurus in the northern Gulf of Mexico. J. Plankton Res. 7:137-141.
  • Govoni, J.J., D.S. Peters, and J.V. Merriner. 1982. Carbon assimilation during larval development of the marine teleost Leiostomus xanthurus Lacepede. J. Exp. Mar. Biol. Ecol. 64:287-299.
  • Gunter, G. 1945. Studies on the marine fishes of Texas. Publ. Inst. Mar. Sci. Univ. Texas 1:9-190.
  • Hales, L.S. and M.J. Van Den Avyle. 1989. Species profiles: life histories and environmental requirements of coastal fishes and invertebrates (South Atlantic)Spot. U.S. Fish and Wildlife Service Biological Report 82(11). U.S. Army Corps of Engineers TR EL-82-4.
  • Hettler, W.F. 1979. Swimming speeds of juvenile estuarine fish in a circular flume.Proc. Ann. Conf. Southeast. Assoc. Fish Wildl. Agencies 31:392-398.
  • Hettler, W.F., and L.C. Clements. 1978. Effects of acute thermal stress on marinefish embryos and larvae. Pages 171-190 in Fourth National Workshop on Entrainment and Impingement, Ecological Analysts Communications, Melville, New York.
  • Hildebrand, S.F., and L. Cable. 1930. Development and life history of fourteen teleostean fishes at Beaufort, North Carolina. Bull. U.S. Bur. Fish. 46:383-488.
  • Hildebrand, S.F., and W.C. Schroeder. 1928. Fishes of Chesapeake Bay. Bull. U.S. Bur. Fish. 43, Part 1. 366 pp.
  • Hodson, R.G., R.G. Fechhelm, and R.J. Monroe. 1981a. Upper temperature tolerance of the spot, Leiostomus xanthurus, from the Cape Fear River Estuary, North Carolina. Estuaries 4:345-356.
  • Hodson, R.G., J.O. Hackman, and C.R. Bennett. 1981b. Food habits of young spot in nursery areas of the Cape Fear River Estuary, North Carolina. Trans. Am. Fish. Soc. 110:495-501.
  • Hoss, D.E., W.F. Hettler, and L.C. Clements. 1974. Effects of thermal shock on larval estuarine fish - ecological implications with respect to entrainment in power plant cooling systems. Pages 357-371 in: J.H.S. Blaxter, ed. The Early Life History of Fish. Springer-Verlag, New York.
  • Houde, E.D. 1978. Critical food levels for growth and survival of laboratory reared larvae of three species of subtropical marine fishes. Bull. Mar. Sci.28:395-411.
  • Johnson, G.D. 1978. Development of Fishes of the Mid-Atlantic Bight. Volume IV, Carangidae through Ephippidae. U.S. Fish. Wildl. Serv. Biol. Serv. Program FWS/OBS-78/12. 416 pp.
  • Kjelson, M.A., and G.N. Johnson. 1976. Further observations of the feeding ecology of postlarval pinfish, Lagodon rhomboides, and spot, Leiostomus xanthurus. U.S. Natl. Mar. Fish. Serv. Fish. Bull. 74:423-432.
  • Kjelson, M.A., D.S. Peters, G.W. Thayer, and G.N. Johnson. 1975. The general feeding ecology of postlarval fishes in the Newport River estuary. U.S. Natl. Mar. Fish. Serv. Fish. Bull. 73:137-144.
  • Lewis, R.M., and M.H. Judy. 1983. The occurrence of spot, Leiostomus xanthurus, and Atlantic croaker, Micropogonias undulatus, larvae in Onslow Bay and the Newport River estuary, North Carolina. U.S. Natl. Mar. Fish. Serv. Fish. Bull. 81:405-412.
  • Murphy, Michael D. 2003. Species account for spot (Leiostomus xanthurus) in: Florida. Florida Fish and Wildlife Research Institute, Florida Fish and Wildlife Conservation Commission. Available on the Internet at: http://www.floridamarine.org/features/view_article.asp?id=5573
  • Music, J.L. 1974. Observations on the spot Leiostomus xanthurus in Georgia's estuarine and close inshore ocean waters. Ga. Dep. Nat. Resour. Contrib. Ser.28. 29 pp.
  • Nelson, W.R. 1969. Studies on the croaker, Micropogon undulatus Linnaeus, and the spot, Leiostomus xanthurus Lacepede, in Mobile Bay, Alabama. J. Mar. Sci. Alabama 1:4-92.
  • Neumann, D.A., J.M. O'Conner, and J.A. Sherk, Jr. 1981. Oxygen consumption of white perch (Morone americana), striped bass (Morone saxatilis), and spot (Leiostomus xanthurus). Comp. Biochem. Physiol. 69A:467-478.
  • Pacheco, A.L. 1962. Age and growth of spot in lower Chesapeake Bay, with notes on the distribution and abundance of juveniles in the York River system. Chesapeake Sci. 3:18-28.
  • Parker, J.C. 1971. The biology of the spot, Leiostomus xanthurus, and the Atlantic croaker, Micropogon undulatus, in two Gulf of Mexico nursery areas. Tex. A&M Univ. Sea Grant Publ. NOAA-TAMU-SG-14, College Station, TX.
  • McRae, G., R.G. Muller, and R. Paperno. 1997. Update on Florida's Spot Fishery Report to the Marine Fisheries Commission, July 10, 1997. Department of Environmental Protection Florida Marine Research Institute, 100 Eighth Avenue Southeast, St. Petersburg, FL 33701-5095.
  • Pearson, J.C. 1932. Winter trawl fishery of the Virginia and North Carolina coasts. U.S. Bur. Fish. Investigative Rep. 10. 31 pp.
  • Powell, A.B., and H.R. Gordy. 1980. Egg and larval development of the spot, Leiostomus xanthurus. U.S. Natl. Mar. Fish. Serv. Fish. Bull. 78:701-714.
  • Roberts, M.H., Jr. 1980. Survival of juvenile spot (Leiostomus xanthurus) exposed to bromochlorinated and chlorinated sewage in estuarine waters. Mar. Environ. Res. 3:63-80.
  • Roelofs, E.W. 1954. Food studies of young sciaenid fishes, Micropogon and Leiostomus, from North Carolina. Copeia 1954:151-153.Rozas, L.P., and C.T. Hackney. 1984. Use of oligohaline marshes by fishes and macrofaunal crustaceans in North Carolina. Estuaries 7:213-224.
  • Rulifson, R.A. 1977. Temperature and water velocity effects on the swimming performances of young-of-the-year striped mullet (Mugil cephalus), spot (Leiostomus xanthurus), and pinfish (Lagodon rhomboides). J. Fish. Res. Board Can. 34:2316-2322.
  • Sawyer, R.T., A.R. Lawler, and R.M. Overstreet. 1975. Marine leeches of the eastern U.S. and the Gulf of Mexico with a key to the species. J. Nat. Hist. 9:633-667.
  • Townsend, B.C., Jr. 1956. A study of the spot, Leiostomus xanthurus Lacepede, in Alligator Harbor, Florida. M.S. Thesis. Florida State University, Tallahassee. 43 pp.
  • Warlen, S.M., and A.J. Chester. 1985. Age, growth and distribution of larval spot; Leiostomus xanthurus, off North Carolina. U.S. Natl. Mar. Fish. Serv. Fish Bull. 83:587-599.
  • Weinstein, M.P. 1983. Population dynamics of an estuarine dependent fish, the spot (Leiostomus xanthurus), along a tidal creek-seagrass meadow coenocline. Can. J. Fish. Aquat. Sci. 40:1633-1638.
  • Weinstein, M.P., and M.P. Walters. 1981. Growth, survival, and production in young-of-year populations of Leiostomus xanthurus Lacepede residing in tidal creeks. Estuaries 4:185-197.
  • Welsh, W.W., and C.M. Breder, Jr. 1923. Contributions to the life histories of Sciaenidae of the eastern United States coast. Bull. U.S. Bur. Fish. 39:141-201.
  • Wenner, C-A., C.A. Barans, B.W. Stender, and F.H. Berry. 1979a. Results of MARMAP otter trawl investigations in the South Atlantic Bight. I. Fall, 1973. S.C. Dep. Wildl. Mar. Res. Center Tech. Rep. 33. 79 pp.
  • Wenner, C.A., C.A. Barans, B.W. Stender, and F.H. Berry. 1980. Results of MARMAP otter trawl investigations in the South Atlantic Bight. V. Summer, 1975. S.C. Dep. Wildl. Mar. Res. Center Tech. Rep. 45. 57 pp.
  • Yoder, J.A., L.P. Atkinson, J.O. Blanton, D.R. Deibel, D.W. Menzel, and G.A. Paffenhofer. 1981. Plankton productivity and the distribution of fishes on the southeastern U.S. continental shelf. Science 214:352-353.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Leiostomus xanthurus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTACCTGATTTTTGGTGCATGAGCCGGAATAGTAGGCACAGCCTTGAGCCTCCTAATCCGAGCAGAGCTTAGTCAACCTGGCTCACTCCTCGGAGATGACCAGATTTATAACGTAATCGTTACAGCACATGCCTTCGTTATAATTTTCTTTATAGTAATGCCCATCATGATTGGAGGGTTTGGCAACTGACTCATTCCACTAATGATCGGAGCCCCCGACATGGCATTTCCTCGAATGAATAATATGAGCTTCTGACTCCTCCCTCCTTCCTTCCTTCTGCTCCTTACCTCTTCAGGGGTAGAGGCAGGGGCCGGAACAGGGTGAACAGTCTATCCCCCACTCGCCGGGAACCTTGCACACGCAGGTGCTTCCGTCGACCTGGCCATTTTCTCCCTCCACCTCGCAGGTGTTTCATCAATTCTAGGGGCCATTAATTTTATTACAACCATCGTTAACATGAAACCTCCTGCCATCTCGCAGTACCAGACACCTTTATTTGTATGAGCCGTGCTAATTACAGCCGTCCTTCTCCTACTTTCACTCCCTGTATTAGCTGCTGGCATTACAATGCTTCTCACAGACCGCAACCTAAACACAACCTTCTTCGATCCCGCAGGAGGGGGTGATCCCATTCTTTATCAACACTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Leiostomus xanthurus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 21
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Although L. xanthurus are not an endangered species, in 1991 the Chespeake Bay Atlantic Croaker and Spot Fishery Management Plan (FMP) stated that the bycatch of Spot was a problem. This plan took effect from Delaware south through Florida because many of the fish were being caught accidentally in nets designed for other fish. So, the plan called for a minimum size to be caught. Substantial progress has been made in the reduction of the bycatch of Spot (Maryland Department of Natural Resources 2001).

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; bait: occasionally
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Spot make for fair eating because they are small in size and there is a great abundance of them. Leiostomus xanthurus are used for pet food processors; about 3000-4000 tons a year are used for this purpose. Spot are important recreational and commercial fish; in 1980 they were ranked third in the recreational fishing survey at 1.3 million fish. Spot are one of the most frequently caught fish by fishermen. Their flesh is excellent and can be fried fresh or after being stored in salt. The flesh is soft and has a good flavor; they are known as very good panfish. Spot have great economic importance to the community fisheries in the Chesapeake areas and the Carolinas (Husser 1999; Volusia County Government 2001; Chesapeake Bay Program 2000; EarthMax Development 2001; Raffield Fisheries 1998).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: Important to both recreational anglers and commercial fishermen in mid-Atlantic region; largest commercial landings in North Carolina; most of harvest probably for human consumption (Phillips et al. 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Fisheries Importance: In 2001, statewide landings in Florida were 352,786 pounds. Of this, approximately 90% of the statewide landings were made on the Atlantic coast of Florida; with the recreational fishery for spot accounting for 86% of the total (Murphy 2003). Commercial landings on the Atlantic are generally concentrated around Brevard, Indian River and Martin counties. Before 1995, the commercial fishery for spot relied almost exclusively on gill nets. The ban on entangling nets enacted in late 1995 prompted a shift toward smaller gear such as cast nets and haul seines. As reflected in the reduced commercial landings since the rule went into effect, Florida's abolition of entangling gear use in July 1995 almost eliminated the traditional commercial fishery for spot. Reduced fishing pressure could result in higher and more stable recruitment in the future (McRae 1997b).
  • Bigelow, H.B., and W.C. Schroeder. 1953. Fishes of the Gulf of Maine. U.S. Fish Wildl. Serv. Fish. Bull. 74:1-577.
  • Bullock, W.L. 1957. The acanthocephalan parasites of the fishes of the Texas coast. Publ. Inst. Mar. Sci. Univ. Texas 4:278-283.
  • Burton, D.T. 1979. Ventilation frequency compensation responses of three eurythermal estuarine fish exposed to moderate temperature increases. J. Fish Biol. 15:589-600.
  • Burton, D.T., L.B. Richardson, and C.J. Moore. 1980. Effect of oxygen reduction rate and constant low dissolved oxygen concentrations on two estuarine fish. Trans. Am. Fish. Soc. 109:552-557.
  • Chao, L.N., and J.A. Musick. 1977. Life history, feeding habits, and functional morphology of juvenile sciaenid fishes in the York River estuary. U.S. Natl. Mar. Fish. Serv. Fish. Bull. 75:657-702.
  • Chao, L.N., 1978 Sciaenidae. In W. Fischer (ed.) FAO species identification sheets for fishery purposes. West Atlantic (Fishing Area 31). Volume 4. FAO, Rome.
  • Dawson, C.E. 1958. A study of the biology and life history of the spot, Leiostomus xanthurus Lacepede, with special reference to South Carolina. S.C. Wildl. Mar. Res. Dep. Contrib. Bears Bluff Lab. No. 28. 48 pp.
  • DeVries, D.A. 1982. Age and growth of spot in North Carolina. Northeast Fish Widl. Conf., April 13-15, 1982 Cherry Hill, NJ (Abstract).
  • Govoni, J.J. 1983. Helminth parasitism of three larval fishes in the northern Gulf ofMexico. U.S. Natl. Mar. Fish. Serv. Fish. Bull. 81:895-898.
  • Govoni, J.J., A.J. Chester, D.E. Hoss, and P.B. Ortner. 1985. An observation of episodic feeding and growth of larval Leiostomus xanthurus in the northern Gulf of Mexico. J. Plankton Res. 7:137-141.
  • Govoni, J.J., D.S. Peters, and J.V. Merriner. 1982. Carbon assimilation during larval development of the marine teleost Leiostomus xanthurus Lacepede. J. Exp. Mar. Biol. Ecol. 64:287-299.
  • Gunter, G. 1945. Studies on the marine fishes of Texas. Publ. Inst. Mar. Sci. Univ. Texas 1:9-190.
  • Hales, L.S. and M.J. Van Den Avyle. 1989. Species profiles: life histories and environmental requirements of coastal fishes and invertebrates (South Atlantic)Spot. U.S. Fish and Wildlife Service Biological Report 82(11). U.S. Army Corps of Engineers TR EL-82-4.
  • Hettler, W.F. 1979. Swimming speeds of juvenile estuarine fish in a circular flume.Proc. Ann. Conf. Southeast. Assoc. Fish Wildl. Agencies 31:392-398.
  • Hettler, W.F., and L.C. Clements. 1978. Effects of acute thermal stress on marinefish embryos and larvae. Pages 171-190 in Fourth National Workshop on Entrainment and Impingement, Ecological Analysts Communications, Melville, New York.
  • Hildebrand, S.F., and L. Cable. 1930. Development and life history of fourteen teleostean fishes at Beaufort, North Carolina. Bull. U.S. Bur. Fish. 46:383-488.
  • Hildebrand, S.F., and W.C. Schroeder. 1928. Fishes of Chesapeake Bay. Bull. U.S. Bur. Fish. 43, Part 1. 366 pp.
  • Hodson, R.G., R.G. Fechhelm, and R.J. Monroe. 1981a. Upper temperature tolerance of the spot, Leiostomus xanthurus, from the Cape Fear River Estuary, North Carolina. Estuaries 4:345-356.
  • Hodson, R.G., J.O. Hackman, and C.R. Bennett. 1981b. Food habits of young spot in nursery areas of the Cape Fear River Estuary, North Carolina. Trans. Am. Fish. Soc. 110:495-501.
  • Hoss, D.E., W.F. Hettler, and L.C. Clements. 1974. Effects of thermal shock on larval estuarine fish - ecological implications with respect to entrainment in power plant cooling systems. Pages 357-371 in: J.H.S. Blaxter, ed. The Early Life History of Fish. Springer-Verlag, New York.
  • Houde, E.D. 1978. Critical food levels for growth and survival of laboratory reared larvae of three species of subtropical marine fishes. Bull. Mar. Sci.28:395-411.
  • Johnson, G.D. 1978. Development of Fishes of the Mid-Atlantic Bight. Volume IV, Carangidae through Ephippidae. U.S. Fish. Wildl. Serv. Biol. Serv. Program FWS/OBS-78/12. 416 pp.
  • Kjelson, M.A., and G.N. Johnson. 1976. Further observations of the feeding ecology of postlarval pinfish, Lagodon rhomboides, and spot, Leiostomus xanthurus. U.S. Natl. Mar. Fish. Serv. Fish. Bull. 74:423-432.
  • Kjelson, M.A., D.S. Peters, G.W. Thayer, and G.N. Johnson. 1975. The general feeding ecology of postlarval fishes in the Newport River estuary. U.S. Natl. Mar. Fish. Serv. Fish. Bull. 73:137-144.
  • Lewis, R.M., and M.H. Judy. 1983. The occurrence of spot, Leiostomus xanthurus, and Atlantic croaker, Micropogonias undulatus, larvae in Onslow Bay and the Newport River estuary, North Carolina. U.S. Natl. Mar. Fish. Serv. Fish. Bull. 81:405-412.
  • Murphy, Michael D. 2003. Species account for spot (Leiostomus xanthurus) in: Florida. Florida Fish and Wildlife Research Institute, Florida Fish and Wildlife Conservation Commission. Available on the Internet at: http://www.floridamarine.org/features/view_article.asp?id=5573
  • Music, J.L. 1974. Observations on the spot Leiostomus xanthurus in Georgia's estuarine and close inshore ocean waters. Ga. Dep. Nat. Resour. Contrib. Ser.28. 29 pp.
  • Nelson, W.R. 1969. Studies on the croaker, Micropogon undulatus Linnaeus, and the spot, Leiostomus xanthurus Lacepede, in Mobile Bay, Alabama. J. Mar. Sci. Alabama 1:4-92.
  • Neumann, D.A., J.M. O'Conner, and J.A. Sherk, Jr. 1981. Oxygen consumption of white perch (Morone americana), striped bass (Morone saxatilis), and spot (Leiostomus xanthurus). Comp. Biochem. Physiol. 69A:467-478.
  • Pacheco, A.L. 1962. Age and growth of spot in lower Chesapeake Bay, with notes on the distribution and abundance of juveniles in the York River system. Chesapeake Sci. 3:18-28.
  • Parker, J.C. 1971. The biology of the spot, Leiostomus xanthurus, and the Atlantic croaker, Micropogon undulatus, in two Gulf of Mexico nursery areas. Tex. A&M Univ. Sea Grant Publ. NOAA-TAMU-SG-14, College Station, TX.
  • McRae, G., R.G. Muller, and R. Paperno. 1997. Update on Florida's Spot Fishery Report to the Marine Fisheries Commission, July 10, 1997. Department of Environmental Protection Florida Marine Research Institute, 100 Eighth Avenue Southeast, St. Petersburg, FL 33701-5095.
  • Pearson, J.C. 1932. Winter trawl fishery of the Virginia and North Carolina coasts. U.S. Bur. Fish. Investigative Rep. 10. 31 pp.
  • Powell, A.B., and H.R. Gordy. 1980. Egg and larval development of the spot, Leiostomus xanthurus. U.S. Natl. Mar. Fish. Serv. Fish. Bull. 78:701-714.
  • Roberts, M.H., Jr. 1980. Survival of juvenile spot (Leiostomus xanthurus) exposed to bromochlorinated and chlorinated sewage in estuarine waters. Mar. Environ. Res. 3:63-80.
  • Roelofs, E.W. 1954. Food studies of young sciaenid fishes, Micropogon and Leiostomus, from North Carolina. Copeia 1954:151-153.Rozas, L.P., and C.T. Hackney. 1984. Use of oligohaline marshes by fishes and macrofaunal crustaceans in North Carolina. Estuaries 7:213-224.
  • Rulifson, R.A. 1977. Temperature and water velocity effects on the swimming performances of young-of-the-year striped mullet (Mugil cephalus), spot (Leiostomus xanthurus), and pinfish (Lagodon rhomboides). J. Fish. Res. Board Can. 34:2316-2322.
  • Sawyer, R.T., A.R. Lawler, and R.M. Overstreet. 1975. Marine leeches of the eastern U.S. and the Gulf of Mexico with a key to the species. J. Nat. Hist. 9:633-667.
  • Townsend, B.C., Jr. 1956. A study of the spot, Leiostomus xanthurus Lacepede, in Alligator Harbor, Florida. M.S. Thesis. Florida State University, Tallahassee. 43 pp.
  • Warlen, S.M., and A.J. Chester. 1985. Age, growth and distribution of larval spot; Leiostomus xanthurus, off North Carolina. U.S. Natl. Mar. Fish. Serv. Fish Bull. 83:587-599.
  • Weinstein, M.P. 1983. Population dynamics of an estuarine dependent fish, the spot (Leiostomus xanthurus), along a tidal creek-seagrass meadow coenocline. Can. J. Fish. Aquat. Sci. 40:1633-1638.
  • Weinstein, M.P., and M.P. Walters. 1981. Growth, survival, and production in young-of-year populations of Leiostomus xanthurus Lacepede residing in tidal creeks. Estuaries 4:185-197.
  • Welsh, W.W., and C.M. Breder, Jr. 1923. Contributions to the life histories of Sciaenidae of the eastern United States coast. Bull. U.S. Bur. Fish. 39:141-201.
  • Wenner, C-A., C.A. Barans, B.W. Stender, and F.H. Berry. 1979a. Results of MARMAP otter trawl investigations in the South Atlantic Bight. I. Fall, 1973. S.C. Dep. Wildl. Mar. Res. Center Tech. Rep. 33. 79 pp.
  • Wenner, C.A., C.A. Barans, B.W. Stender, and F.H. Berry. 1980. Results of MARMAP otter trawl investigations in the South Atlantic Bight. V. Summer, 1975. S.C. Dep. Wildl. Mar. Res. Center Tech. Rep. 45. 57 pp.
  • Yoder, J.A., L.P. Atkinson, J.O. Blanton, D.R. Deibel, D.W. Menzel, and G.A. Paffenhofer. 1981. Plankton productivity and the distribution of fishes on the southeastern U.S. continental shelf. Science 214:352-353.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Spot croaker

The spot croaker (Leiostomus xanthurus) or spot is a small saltwater fish species inhabiting estuary and coastal waters along the eastern coast of United States, Gulf of Mexico, and the Caribbean.[2] The spot croaker derives its name from the prominent dark spot behind each gill. It is also known for its the croaking sound it produces using its swim bladder. It is part of the family Sciaendae and the only species in its the genus, Leiostomus. Spot croakers spawn offshore and the spawn migrate inland to develop into juveniles. They are frequently caught by recreational anglers and make excellent table fare. Their diets consist largely of organic detritus, small crustaceans, and worms. Bloodworms are the ideal bait when fishing for spot croaker. The community of Hampstead, North Carolina hosts the North Carolina Spot Festival the last weekend of September to honor the fish.[3]

Contents

Naming and taxonomy

Almost every common name for the spot croaker refers to the darkened "spot" above the gill cover of the mature individuals. The croaker part of the name comes the association to the loud croaking sound they produce with their swim bladders.[4] The spot croaker is called simply a spot by most countries that have a coastline within their natural range.[5]

The genus Leiostomus belongs to the family Sciaenidae. This family contains 270 species from 70 genera that live in fresh, brackish, and marine water environments. All members of the genus Leiostomus carry either croaker or drum of some sort in their name, because of the croaking sound they produce.[6]

Description

The spot croaker is a deep-bodied flat fish with an arched back. A large black spot is set above the upper edge of the gill cover. Its body color is gray-blue dorsally, fading to yellow ventrally. It also has a set of 12–15 darker streaks that run forward diagonally from the dorsal surface to about the middle of its body. These streaks often fade with age. The fins are pale yellow in color. The head is blunt with a small mouth. The upper jawbone extends to approximately the middle of the eye.[1] There are no teeth in the lower jaw.[7] The dorsal fin is almost continuous, with a dip separating the stiff dorsal spines from the soft rays. It has 9-11 dorsal spines and 29–35 soft rays. The anal fin has two spines and 12–13 rays. The caudal area is moderately deep, and the caudal fin is notched. A large black spot is set above the upper edge of the gill cover.[1]

Croaking

Being in the family Sciaenidae, the spot croaker has the ability to produce a croaking sound,[7] the most recognizable auditory trait as its name suggests. The spot croaker uses sonic muscle fibers that run horizontally along its body, around its swim bladder, connected to a central tendon which runs ventrally around the swim bladder. The fish contracts its sonic muscle fibers against the swim bladder to produce the croaking sound. The swim bladder is used as a resonating chamber, which is more expansive and branched than the swim bladder of fishes not in the Sciaenidae family.[8]

Range and behavior

School of spot croakers at a jetty

The spot croaker is most commonly found between the Chesapeake Bay and South Carolina. It is also found along the Atlantic coast of the US, the Florida Keys, and the Gulf of Mexico, but in smaller populations. They inhabit costal areas, no deeper than 60 m.[1] This appears to be due to the tendency of Spot croakers to ascend in response to higher salinity concentrations which would be experienced in the lower depths.[9] During the summer months, spot croakers inhabit shallower bays and estuaries and move out into the costal waters during the winter months as the temperature drops; the northern populations also migrate south for the winter until the water warms up again.

Spot croakers are bottom feeders, and their diets consist of worms, mollusks,small crustaceans, and detritus. As they grow, the size of their prey increases.[10] Predators of the spot croaker include striped bass, weakfish, summer flounder, bluefish, and various species of sharks.[10]

Life cycle

Spot croakers populate the area along the Atlantic Coast, in both estuarine and coastal waters from Maine to Florida; the highest concentration are between the Chesapeake Bay and South Carolina. Spot croakers migrate seasonally, staying in bays and estuaries in the spring, until late summer when the move offshore to spawn. Spot croakers mature around the age of two or three, and grow seven to eight inches in length. They can live up to six years, although fish older than four are rare. Spawning takes place offshore from fall to early spring.[10] The larvae have been known to hatch as far as 63 nautical miles offshore, but they migrate towards the coast and inhabit estuaries and inlets while they develop into juveniles. As they mature, spot croakers migrate toward higher-salinity areas.[10]

Management

The short lifespans of spot make their year-to-year fishing catches fluctuate greatly. With little population information, it cannot be concluded whether or not they are overfished, as well as their general health. Management of spot croakers will continue to be minimal in the regulations set forth.[11]

References

  1. ^ a b c d K., Hill (9 June 2005). "Leiostomus xanthurus (spot)". Smithsonian Marine Station. http://www.sms.si.edu/irlspec/leiosto_xanthu.htm. Retrieved 25 October 2011.
  2. ^ Susan, Luna; Froese, Rainer (6 October 2010). "Leiostomus xanthurus Lacepède, 1802 Spot croaker". fish base. http://www.fishbase.org/Summary/SpeciesSummary.php?ID=429&AT=spot. Retrieved 20 October 2011.
  3. ^ "North Carolina Spot Festival". http://www.ncspotfestival.com/. Retrieved 2008-12-04.
  4. ^ "Croaker". destin fishing guide. http://fishingdestinguide.com/CROAKER.html. Retrieved 14 November 2011.
  5. ^ Froese, Rainer, and Daniel Pauly, eds. (2008). "Leiostomus xanthurus" in FishBase. May 2008 version.
  6. ^ Froese, Rainer, and Daniel Pauly, eds. (2010). "Sciaenidae" in FishBase. october 2010 version.
  7. ^ a b "spot". Chesapeake Bay Program. http://www.chesapeakebay.net/bfg_spot.aspx?menuitem=14489. Retrieved 23 November 2011.
  8. ^ Collin, Shaun; N. Justin Marshall (2003). Sensory processing in aquatic environments. New York: Springer-Verlag New York. p. 176. ISBN 0-387-95527-5. 
  9. ^ De Vries, M.C.; Forward, R.B.; Hettler, W.F. (1995). "Behavioral response of larval Atlantic menhaden Brevoortia tyrannus (Latrobe) and spot Leiostomus xanthurus (Lacépède) to rates of salinity change". Journal of Experimental Marine Biology and Ecology 185 (1): 93–108. doi:10.1016/0022-0981(94)00137-3. 
  10. ^ a b c d Govoni, John J.; Ortner, Peter B.; Al-Yamani, Faiza; Hill, Leonard C. (1986). "Selective feeding of spot, Leiostomus xanthurus, and Atlantic croaker, Micropogonias undulatus, larvae in the northern Gulf of Mexico". Marine Ecology Progress Series 28: 175–83. doi:10.3354/meps028175. OCLC 4665755823. hdl:1969.3/21394. 
  11. ^ "2010 Maryland FMP Report Section 3.Atlantic croaker (Micropogonias undulates) and Spot (Leiostomus xanthurus)". July 2011. pp. 1–5. http://www.dnr.state.md.us/fisheries/fmp/2010/Section_3_Atlantic_croaker_spot.pdf. Retrieved 9 January 2011.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Monotypic genus.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!