Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Comprehensive Description

Biology

Occurs in deep oceanic waters (Ref. 9563), most abundant in waters of 8° to 10°C. Stomach contents of the specimen from north of the Hawaiian Archipelago include onychoteuthids, ommastrephid squid, vertebrae and fin rays from an unidentified fish, bird feathers and parasitic nematodes (Ref. 11006). Taken as longline by-catch by Japanese fishing for Thunnus maccoyii.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Circumglobal in southern temperate waters.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This species is circumglobal in southern temperate waters. There are a few records from Hawaii (Ito et al. 1994), which are likely vagrants.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

New Zealand Exclusive Economic Zone, South Africa (country)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Circumglobal in Southern Ocean temperate waters, mostly between 30° and 50°S; waifs in northern Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 17 - 18; Dorsal soft rays (total): 9 - 12; Analspines: 0; Analsoft rays: 11 - 13; Vertebrae: 44
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 1640 mm FL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

164 cm FL (male/unsexed; (Ref. 168))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Pelvic fins enormous in juveniles, longer than head length. Pelvic fins fitting into a deep ventral groove at all sizes. Interpelvic process tiny and bifid. No anterior corselet. Swim bladder present with two anterior projections that extend into the back of the skull. The morphological adaptations required for maintaining high brain and retinal temperatures are discussed in Ref. 11221.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

pelagic-oceanic; oceanodromous (Ref. 51243); marine; depth range 200 - ? m (Ref. 9563)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This species occurs over deep oceanic waters, from the surface to below 200 m. Stomach contents of the specimen from north of the Hawaiian Archipelago included onychoteuthid and ommastrephid squids, vertebrae and fin rays from an unidentified fish, bird feathers and parasitic nematodes (Ito et al. 1994). This species biology is poorly known. Larvae of this species have never been identified.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Occurs in deep oceanic waters (Ref. 9563), most abundant in waters of 8° to 10°C. Stomach contents of the specimen from north of the Hawaiian Archipelago include onychoteuthids, ommastrephid squid, vertebrae and fin rays from an unidentified fish, bird feathers and parasitic nematodes (Ref. 11006). Taken as by-catch by Japanese longliners fishing for Thunnus maccoyii.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Gasterochisma melampus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGGCAATCACACGCTGATTTTTCTCGACTAACCATAAAGATATCGGCACCCTCTATCTAGTATTTGGTGCATGAGCTGGAATAGTCGGCACGGCCTTAAGCCTGCTTATCCGAGCCGAACTAAGTCAACCGGGCGCCCTTCTTGGGGACGACCAGGTCTACAACGTAATTGTGACGGCGCATGCCTTCGTAATAATCTTCTTTATAGTAATACCAATTATGATTGGAGGGTTTGGGAACTGACTCATCCCCCTAATGATCGGGGCCCCAGACATAGCATTCCCCCGAATAAACAACATAAGCTTTTGACTACTCCCTCCTTCTTTCCTTCTGCTCCTCGCCTCTTCAGGAGTCGAAGCAGGTGCCGGAACCGGTTGAACCGTCTACCCCCCTCTAGCAGGTAATCTAGCCCACGCAGGAGCGTCTGTCGACCTTACTATCTTTTCTCTCCACTTAGCAGGTATTTCTTCAATTCTTGGGGCAATTAATTTCATTACTACCATTATCAATATGAAACCCGCAGCTATCTCCCAGTACCAGACACCCCTATTTGTGTGAGCCGTCCTAATTACGGCTGTCCTTCTCCTGCTATCCCTACCAGTCCTCGCTGCTGGCATTACAATGCTCCTTACAGACCGAAATTTAAACACAACCTTCTTCGACCCTGCGGGCGGTGGAGACCCAATTCTTTACCAACACCTGTTCTGATTCTTCGGCCACCCAGAAGTATATATTCTCATCCTCCCCGGATTTGGAATTATCTCCCACATTGTTGCCTACTATTCCGGTAAAAAAGAACCTTTTGGTTACATGGGTATAGTCTGAGCCATGATGGCCATCGGCCTACTAGGCTTCATCGTATGGGCCCACCATATGTTCACAGTAGGTATGGACGTAGACACACGGGCCTACTTCACATCCGCAACAATAATTATCGCAATTCCAACGGGTGTAAAAGTCTTTAGCTGACTTGCAACCCTGCACGGAGGTGCCGTAAAATGAGAAACTCCCCTTCTATGAGCCATCGGCTTCATCTTCCTCTTCACAGTCGGAGGTCTAACAGGAATTGTCTTAGCTAATTCGTCTCTAGACATTGTTCTTCACGACACATACTACGTCGTAGCCCACTTCCACTACGTTCTGTCTATGGGGGCCGTGTTCGCCATTGTCGCTGCCTTCGTCCACTGATTCCCACTATTTACCGGATATACCCTTCATAGCACCTGAACTAAAATTCACTTCGGAGTTATTTTCATCGGTGTAAACCTCACATTCTTCCCACAACATTTCCTAGGACTAGCCGGAATGCCCCGACGATACTCGGACTACCCAGACGCCTACACACTCTGAAACACAATCTCCTCTATCGGGTCCCTAATTTCCCTTGTGGCAGTAATTATGTTCCTGTTCATCATCTGAGAGGCATTCGCCGCCAAACGTGAAGTACTGTCAGTGGAGCTAACTGCAACCAACGTAGAGTGACTTCACGGCTGCCCTCCCCCTTACCACACATTCGAGGAGCCTGCATTCGTCCTAGTTCAATCAGACTAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Gasterochisma melampus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 15
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2011

Assessor/s
Collette, B., Boustany, A., Carpenter, K.E., Di Natale, A., Fox, W., Graves, J., Juan Jorda, M., Miyabe, N., Nelson, R., Oxenford, H. & Uozumi, Y.

Reviewer/s
Russell, B. & Polidoro, B.

Contributor/s

Justification
This species is widespread and common in the Southern Ocean. It is taken as bycatch in long-line fisheries for Southern Bluefin Tuna. It is listed as Least Concern. More information is needed on this species biology and population trends.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is not of commercial interest but is taken as bycatch by Japanese longliners (Collette and Nauen 1983). It is estimated that this species was caught at approximately 900 t annually from 1990 to the early 2000s (Miyabe pers. comm. 2010). It is also caught by other nations that have quotas for Southern Bluefin Tuna. There is no other population information for this species.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
This species is taken as longline bycatch by Japanese fishing for Thunnus maccoyii (Southern Bluefin Tuna). It is sometimes eaten in Japan.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no conservation measures for this species. More research is needed on this species biology and population trends.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; gamefish: yes; price category: very high; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Butterfly kingfish

The butterfly kingfish (Gasterochisma melampus) is an ocean-dwelling ray-finned bony fish in the Mackerel family, Scombridae – a family which it shares with the tunas, mackerels, spanish mackerels and bonitos. Unlike the 50 species from those four tribes, however, this species is unique in that it is the only Scombrid to be classified apart from the rest, into the subfamily Gasterochismatinae and genus Gasterochisma.[2][3][4]

Although taxonomists and the Food and Agriculture Organization of the United Nations (FAO) have accepted the name "butterfly kingfish", this fish has had many common names, including big-scaled mackerel, bigscale mackerel, butterfly mackerel, butterfly tuna, scaled tunny, scaly tuna and others. In 1993, the U.S. Food and Drug Administration (FDA) gave approval for this fish to be marketed simply as "mackerel".[5]

Contents

Description

The juveniles of the butterfly kingfish are characterized by enormous pelvic fins that are longer than the length of its head, and that become more proportional as the fish grows. At any size, the pelvic fin tucks into a deep ventral groove, in much the same way as the first dorsal spines do in all scombrids. This species has very large cycloid scales, below which is a thick layer of fat. The swim bladder has two anterior projections that extend into the back of the skull, near the inner ear.[6] This fish lacks the median keel on the caudal peduncle – it only has the characteristic pair of small keels on each side of the base of the caudal fin, as do other scombrids. It has 21 precaudal vertebrae, plus 23 caudal vertebrae.[4]

Drawing of a butterfly kingfish

This fish can be found around the world in southern temperate waters of 8–15 °C (46–59 °F), but most commonly under 10 °C (50 °F), and at depths of up to 200 metres (660 ft) in the open ocean. It grows to a length of up to 1.64 metres (5.4 ft).[7]

Most bony fishes are ectothermic, or cold-blooded, but this species, much like the related tunas, is endothermic and is able to raise its body temperature to achieve a degree of thermoregulation.[8] It has a brain heater organ derived from the lateral rectus eye muscle, which is distinct from that of the billfishes, whose heater is derived from their superior rectus.[4]

Etymology

Gasterochisma derives from the Ancient Greek: γαστήρ (gaster) "stomach", and χίασμα (chiasma) "crossing; X-shaped; sign of the 'X'".[7]

Taxonomy

The evolutionary lineage of the butterfly kingfish is more primitave and quite different from that of the rest of the scombrids. Additionally, the morphology of this species is substantially different from that of the others – some suggest that it might belong in a different family altogether.[6] At present, however, morphology and nuclear phylogeny provide support that Gasterochisma is the basal Scombrid, and that both its genus, Gasterochisma, and its subfamily, Gasterochismatinae, remain as monotypic taxa under the family Scombridae.[4]

The following cladogram shows the most likely evolutionary relationships between the butterfly kingfish and the tunas, mackerels, spanish mackerels and bonitos.

Butterfly kingfish, in the family Scombridae
family Scombridae 
 subfamily
Gasterochismatinae 

genus Gasterochisma

 G. melampus, Butterfly kingfish 






 subfamily
Scombrinae 




tribe Scombrini 


 Mackerels (2 genera)










tribe Scomberomorini 

 Spanish Mackerels (3 genera)







tribe Sardini 



 Bonitos (4 genera)







tribe Thunnini



 Tunas  (5 genera)












Cladogram: With 51 different species in the Scombridae family, the butterfly kingfish sits uniquely, apart from the rest – it is the only Scombrid species that does not belong to the Scombrinae subfamily.[2][4]

References

  1. ^ Collette, B., Boustany, A., Carpenter, K.E., Di Natale, A., Fox, W., Graves, J., Juan Jorda, M., Miyabe, N., Nelson, R., Oxenford, H. & Uozumi, Y. (2011). "Gasterochisma melampus". IUCN Red List of Threatened Species. Version 2012.2. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/170340. Retrieved 22 October 2012.
  2. ^ a b Graham, Jeffrey B.; Dickson, Kathryn A. (2004). "Tuna Comparative Physiology" (PDF). The Journal of Experimental Biology 207: 4015–4024. doi:10.1242/​jeb.01267. http://jeb.biologists.org/content/207/23/4015.full.pdf+html. Retrieved 20 September 2012.
  3. ^ "Gasterochisma melampus". Integrated Taxonomic Information System. http://www.itis.gov/servlet/SingleRpt/SingleRpt?search_topic=TSN&search_value=202065. Retrieved 18 April 2006.
  4. ^ a b c d e Orrell, T.M.; Collette, B.B; Johnson, G.D. (2006). "Molecular data support separate Scombroid and Xiphioid Clades" (PDF). Bulletin of Marine Science 79 (3): 505–519. http://www.ingentaconnect.com/search/download?pub=infobike%3a%2f%2fumrsmas%2fbullmar%2f2006%2f00000079%2f00000003%2fart00007&mimetype=application%2fpdf. Retrieved 28 October 2012.
  5. ^ Randolph, S.; Snyder, M.. The seafood list: FDA's guide to acceptable market names for seafood sold in interstate commerce.. Washington, D.C.: U.S. Government Printing Office.
  6. ^ a b Collette, Bruce B.; Reeb, Carol; Block, Barbara A. (2001). "Chapter 1: Systematics of the Tunas and Mackerels (scombridae)". In Block, Barbara A.; Stevens, E. Donald. Tuna: physiology, ecology, and evolution; Volume 19 of Fish Physiology. San Diego, Calif.: Academic Press. p. 5. ISBN 9780123504432. http://books.google.com/books?id=M0ghO6oLXnEC&pg=PA5&lpg=PA5&hl=en#v=onepage&q&f=false.
  7. ^ a b Froese, Rainer, and Daniel Pauly, eds. (2012). "Gasterochisma melampus" in FishBase. October 2012 version.
  8. ^ Block, B.A.; Finnerty, J.R. (1993). "Endothermy in fishes: a phylogenetic analysis of constraints, predispositions, and selection pressures". Environmental Biology of Fishes 40 (3): 283–302. doi:10.1007/BF00002518. http://www.science.siu.edu/zoology/sears/BlockFinnerty1994.pdf.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!